JAC Advance Access published online on September 26, 2008
Journal of Antimicrobial Chemotherapy, doi:10.1093/jac/dkn407
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Original research |
SmvA, and not AcrB, is the major efflux pump for acriflavine and related compounds in Salmonella enterica serovar Typhimurium
1 Laboratorio de Microbiología, Departamento de Ciencias Biológicas, Universidad Andrés Bello, Santiago, Chile 2 Programa de Microbiología y Micología, Instituto de Ciencias Biomédicas, Facultad de Medicina, Universidad de Chile, Santiago, Chile
* Corresponding author. Tel: +56-2-661-8374; Fax: +56-2-661-8069; E-mail: gmora{at}unab.cl
Received 1 August 2008; returned 19 August 2008; revised 2 September 2008; accepted 3 September 2008
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
Objectives: The aim was to study the role played by SmvA pump in the efflux of quaternary ammonium compounds (QACs) in Salmonella enterica serovar Typhimurium (Salmonella Typhimurium).
Methods: Mutants in the smvA, acrB and tolC genes were constructed by the red swap method. P22 was used to transduce tolC to acrB and smvA mutant strains. The susceptibility of these strains to acriflavine and a variety of QACs was determined by MIC assays.
Results: In comparison with the Salmonella Typhimurium wild-type strain, the smvA mutant was more susceptible to QACs than the acrB mutant strain. A tolC single mutant was more susceptible than an acrB mutant to QACs, acriflavine, ethidium bromide, malachite green and pyronin B. The tolC–acrB double mutant was as susceptible as the single tolC mutant to QACs. Additionally, the smvA mutant strain was more susceptible to acriflavine than the acrB mutant (MICs = 31.3 versus 125 mg/L, i.e. 4-fold). Finally, the tolC–smvA double mutant (3.9 mg/L) was approximately 10 times more susceptible to acriflavine than either smvA (31.3 mg/L) or tolC (31.3 mg/L) single mutants.
Conclusions: It is the SmvA efflux pump, and not AcrB, that plays the major role in the efflux of acriflavine and other QACs from Salmonella Typhimurium. This apparently conflicting report is due to the fact that in Escherichia coli the smvA gene does not exist. Our results suggest that tolC and smvA genes encode components of two different efflux systems with overlapping specificities that work in parallel to export acriflavine and other QACs.
Key Words: multidrug resistance , quaternary ammonium compounds , TolC , enteric bacteria
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
Salmonella enterica is a pathogen that causes a variety of diseases in humans ranging from gastroenteritis to bacteraemia and typhoid fever.1 Emerging resistance to antibiotics in Salmonella has been found in both humans and animals, and is thus a potentially serious public health problem.2 Salmonella enterica serovar Typhimurium (Salmonella Typhimurium) is an important cause of food poisoning and is the second most common cause of bacterial diarrhoea in the Western world. The fatality rate is dependent upon the country and the serovar, but is usually 1% to 4%. This incidence is increased at least 2-fold when antibiotic-resistant strains are involved.3
Salmonella Typhimurium resistance to antibiotics arises by the enzymatic inactivation of drugs, the alteration of antibiotic targets by mutation and by the active antibiotic efflux. Efflux involves complexes of proteins that function to decrease the concentration of specific drug or multiple toxic substrates by transporting these substrates across the inner and outer membranes into the external medium.4 To date, five major families of efflux systems have been identified in Gram-negative bacteria, including: the ATP-binding cassette, small multidrug resistance, major facilitator superfamily (MFS), multidrug and toxic compound extrusion and resistance-nodulation-division (RND) efflux pumps.4
Multidrug efflux pumps, especially those belonging to the RND family, play a major role in establishing intrinsic or developed resistance of Gram-negative bacteria to a wide range of toxic compounds, including antibiotics. A well-studied example is the AcrAB–TolC multidrug resistance tripartite pump system of Escherichia coli, which confers resistance to a wide variety of lipophilic and amphiphilic compounds, including the quaternary ammonium compounds (QACs) and acriflavine.5 The presence and impact of the AcrAB–TolC systems in multidrug resistance have been reported for other members of Enterobacteriaceae.5,6 In the case of Salmonella Typhimurium, there are several significant publications on the roles of AcrB and TolC in multidrug resistance to detergents, bile salts, quinolones, fluoroquinolones, β-lactams, tetracycline and other antimicrobials.6–8
In addition, Salmonella Typhimurium has another gene, smvA, whose function also contributes to multidrug resistance. This gene is predicted to encode an MFS efflux pump in the inner membrane.9 Unlike the acrRAB operon, which is widely distributed throughout all Enterobacteriaceae genomes, homologues of smvA are not found in E. coli and Shigella spp. This gene appears to be present only in the genomes of Salmonella and Klebsiella. SmvA is most similar to the KmrA pump of Klebsiella pneumoniae (75% identity), which is involved in resistance to a variety of antimicrobial agents, and the well-characterized Staphylococcus aureus QacA pump (32% identity), involved in the efflux of toxic QACs. Like mutations in qacA, mutations in smvA confer increased susceptibility to methyl viologen (paraquat), a hydrophilic, doubly charged QAC.9 The present study was performed to evaluate the role played by SmvA in the efflux of QACs in Salmonella Typhimurium.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
Bacterial strains, media and growth conditions
The Salmonella Typhimurium strains used in this study are derivatives of the parental wild-type strain 14028s (ATCC) and are listed in Table 1. Bacteria were grown routinely at 37°C and aerated by shaking. Rich medium for growth was Luria–Bertani (LB) broth (Bacto tryptone, 10 g/L; Bacto yeast extract, 5 g/L; and NaCl, 5 g/L) and minimal medium was M9 glucose (NaH2PO4, 6 mg/mL; K2HPO4, 3 mg/mL; NH4Cl, 1 mg/mL; NaCl, 0.5 mg/mL; MgSO4, 0.12 mg/mL; CaCl2, 0.015 mg/mL; and glucose, 2 mg/mL). When required, LB medium was supplemented with ampicillin (100 mg/L), chloramphenicol (25 mg/L), kanamycin (50 mg/L), arabinose (2 mg/mL) or glucose (2 mg/mL). Solid media included Bacto agar (15 g/L). PBS buffer comprises 55 mg/mL NaH2PO4·7H2O, 15 mg/mL K2HPO4 and 4.25 mg/mL NaCl.
|
Construction of gene deletion mutants
Gene deletion was performed according to the method of Datsenko and Wanner,10 with recombination between short homologous DNA regions catalysed by phage 
Red recombinase. Briefly, PCR primers (60 bp) were designed with 40 bp of 5' homology to the Salmonella Typhimurium ATCC 14028s acrB gene and 20 bp of 3' homology to the kanamycin or chloramphenicol cassettes present in plasmids pKD4 or pKD3 (acrB1, acaggagccgttaagacatgcctaatttctttatcgatcgtgtaggctgga; acrB2, tatcaacagtgagcaaatcagcgatgttctgtcgaatgaccatatgaatat). Purified PCR products were used to electroporate Salmonella Typhimurium/pKD46 grown at 30°C in LB supplemented with 10 mM L-arabinose and 100 mg/L ampicillin. Bacteria were plated on LB agar plates (1.5% agar) supplemented with kanamycin or chloramphenicol, and were incubated at 37°C to select for the allelic exchange and cured plasmid pKD46. The presence of the 
acrB::kan mutant allele was confirmed by PCR amplification, using primers flanking the sites of substitution, and backcrossed into a wild-type genetic background by generalized transduction using phage P22 HT105/1 int201. The smvA::cam mutant was obtained previously in our laboratory.9 Double mutants were obtained by generalized transduction of acrB::kan or smvA::cam alleles using P22 HT105/1 int201 into the recipient tolC::FRT mutant background. The ‘FRT scar’ for tolC was obtained by the deletion of the antibiotic-resistant cassette.10
Antimicrobial susceptibility test
The MICs of QACs and other antimicrobial agents for each bacterial strain were determined by microdilution in liquid medium as recommended by the CLSI,11 with modifications. Briefly, bacteria were grown overnight in M9 glucose medium, diluted 5000-fold in fresh M9 glucose medium and aliquotted (100 µL) into the wells of sterile microtitre plates. A series of 2-fold dilutions was made along the columns of one or more microtitre dishes, and microtitre dishes were incubated at 37°C for 24 h. The lowest concentration of antimicrobial agents that inhibited growth (measured as the optical density at 640 nm) by >50% relative to growth in the absence of antimicrobial agents, respectively, was defined as the MIC.
|
Results and discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
To compare the relative roles of the SmvA and AcrB pumps in the efflux of antimicrobial agents from Salmonella Typhimurium, we first performed a quick, qualitative screening to determine the susceptibility of the wild-type and smvA mutant strains to a variety of toxic agents. To do this, both the smvA mutant and the wild-type strains were spread onto LB agar plates and allowed to dry. Then, crystals of various QACs (standardized by weight) were spotted on the bacterial lawns. In all cases, the dissolution and diffusion of the QACs analysed in the agar were easy to follow as most of them are coloured substances. Zones of bacterial growth inhibition were observed and compared by visual inspection after overnight incubation at 37°C.
Among the QACs tested, we found that acriflavine, ethidium bromide, malachite green, methyl viologen and pyronin B inhibit the growth of the smvA mutant more than its wild-type parent. To quantify these apparent differences, we then performed MIC assays. Because E. coli acrB mutants have been shown to be more susceptible to nalidixic acid,8 we included this antibiotic in our assays. In addition, since the TolC protein functions together with the AcrAB proteins and other pumps in E. coli,12 we also tested mutant strains of Salmonella Typhimurium with inactivations of tolC as well as tolC–smvA and tolC–acrB double mutants.
The Salmonella Typhimurium smvA–acrB double mutant was not tested because it grew extremely poorly, suggesting that these pumps are important in the efflux of toxic metabolic products generated in the bacterial cell.
As observed in Table 2, we can divide the substrates tested into three different classes, depending on the susceptibilities of single and double mutants to each substrate. One class, represented by methyl viologen, appears to be exported only by the SmvA and not by the AcrAB–TolC pump, since only smvA mutants display increased susceptibility to methyl viologen in comparison with the wild-type strain (0.12 versus 0. 98 µM). A tolC mutant was more resistant to methyl viologen than the wild-type strain (1.96 versus 0.98 µM), as described previously. The simplest interpretation for this observation is that TolC facilitates the import of methyl viologen.9
|
Another class, represented by nalidixic acid (which is not a QAC), appears to be exported only by the AcrAB–TolC and not by the SmvA pump. A tolC mutant was slightly more susceptible than an acrB mutant to this substrate (2.3 versus 4.7 mg/L), and the tolC–acrB double mutant was as susceptible as the tolC single mutant (1.17 versus 2.3 mg/L). There are two possibilities why a tolC mutant was more susceptible to these agents than an acrB mutant. Either TolC functions together with other efflux pumps in the export of these substrates or tolC mutations have a pleiotropic effect on membrane integrity. Thus, tolC mutants will always be more susceptible to substrates exported solely by the AcrAB–TolC pump than acrB mutants.
Finally, the class represented by acriflavine, ethidium bromide, malachite green and pyronin B appears to be exported by both the SmvA and AcrAB–TolC pump systems. A tolC mutant was more susceptible than an acrB mutant to each of these substrates, and the tolC–acrB double mutant was as susceptible as or slightly more susceptible than the single tolC mutant. The smvA mutant was more susceptible than an acrB mutant, but was less susceptible than the tolC mutant to QACs. A tolC–smvA double mutant was always more susceptible than either of its single mutant parents. These results indicate that acriflavine, ethidium bromide, malachite green and pyronin B are substrates for both efflux systems, but the SmvA pump plays the major role in the efflux of QACs.
One striking observation is that the tolC–smvA double mutant (3.9 mg/L) was approximately 10 times more susceptible to acriflavine than either smvA (31.3 mg/L) or tolC (31.3 mg/L) single mutants and 4 times more susceptible than the tolC–acrB double mutant (15.6 mg/L). Based on our observations, we propose that tolC and smvA encode components that function in two different efflux systems with overlapping specificities to work in parallel to export acriflavine and other QACs.
|
Funding |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
This work was supported in part by FONDECYT (Chile) grant 1060999 and Universidad Andrés Bello grant DI-UNAB 04-04 to G. C. M., and by Programa Bicentenario de Ciencia y Tecnologia (PBCT)—The World Bank grant ACT-08/2006.
|
Transparency declarations |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
None to declare.
|
Footnotes |
|---|
Present address. Department of Biochemistry, School of Medicine and Biomedical Sciences, State University of New York at Buffalo, Buffalo, NY, USA. 
|
Acknowledgements |
|---|
We thank Linda Kenney for critical reading of the manuscript prior to submission.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
1 . Scherer CA, Miller SI. Molecular pathogenesis of Salmonella. In: Principles of Bacterial Pathogenesis—Groisman EA, ed. (2001) New York: Academic Press. 266–333.
2 . Piddock LJ. Fluoroquinolone resistance in Salmonella serovars isolated from humans and food animals. FEMS Microbiol Rev (2002) 26:3–16.[Web of Science][Medline]
3 . Helms M, Vastrup P, Gerner-Smidt P, et al. Excess mortality associated with antimicrobial drug-resistant Salmonella Typhimurium. Emerg Infect Dis (2002) 8:490–5.[Web of Science][Medline]
4
.
Putman M, van Veen HW, Konings WN, et al. Molecular properties of bacterial multidrug transporters. Microbiol Mol Biol Rev (2000) 64:672–93.
5 . Nikaido H, Zgurskaya HI. Antibiotic efflux mechanisms. Curr Opin Infect Dis (1999) 12:529–36.[Web of Science][Medline]
6 . Lacroix F, Cloeckaert A, Pardon P, et al. Salmonella Typhimurium acrB-like gene: identification and role in resistance to biliary salts and detergents and in murine infection. FEMS Microbiol Lett (1996) 135:161–7.[CrossRef][Web of Science][Medline]
7
.
Giraud E, Cloeckaert A, Kerboeuf D, et al. Evidence for active efflux as the primary mechanism of resistance to ciprofloxacin in Salmonella enterica serovar Typhimurium. Antimicrob Agents Chemother (2000) 44:1223–8.
8
.
Piddock LJ, White DG, Gensberg K, et al. Evidence for an efflux pump mediating multiple antibiotic resistance in Salmonella enterica serovar Typhimurium. Antimicrob Agents Chemother (2000) 44:3118–21.
9 . Santiviago CA, Fuentes JA, Bueno SM, et al. The Salmonella enterica sv. Typhimurium smvA, yddG and ompD (porin) genes are required for the efficient efflux of methyl viologen. Mol Microbiol (2002) 46:687–98.[CrossRef][Web of Science][Medline]
10
.
Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA (2000) 97:6640–5.
11 . Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Test for Bacteria That Grow Aerobically—Seventh Edition: Approved Standard M7-A7 (2006) Wayne, PA, USA: CLSI.
12
.
Fralick JA. Evidence that TolC is required for functioning of the Mar/AcrAB efflux pump of Escherichia coli. J Bacteriol (1996) 178:5803–5.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||