JAC Advance Access published online on September 21, 2007
Journal of Antimicrobial Chemotherapy, doi:10.1093/jac/dkm361
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Susceptibilities of healthcare- and community-associated methicillin-resistant staphylococci to the novel des-F(6)-quinolone DX-619
1 Department of Infection Control Science, Graduate School of Medicine, Juntendo University, 2-1-1 Hongo, Bunkyo-ku, Tokyo, Japan 2 Department of Bacteriology, School of Medicine, Juntendo University, 2-1-1 Hongo, Bunkyo-ku, Tokyo, Japan
* Corresponding author. Tel: +81-3-5802-1041; Fax: +81-3-5684-7830; E-mail: teruybac{at}med.juntendo.ac.jp
Received 1 May 2007; returned 28 June 2007; revised 23 August 2007; accepted 24 August 2007
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
Objectives: The aim of the study was to test in vitro activities of the novel des-F(6)-quinolone DX-619 against methicillin-resistant staphylococci (MRS) isolated in hospitals and communities and to compare its activity with other quinolones, sitafloxacin and levofloxacin, and antibiotics used for the treatment of methicillin-resistant Staphylococcus aureus infection, including vancomycin, teicoplanin, arbekacin, linezolid and quinupristin/dalfopristin.
Methods: MICs were determined by the agar dilution method using healthcare-associated MRS (S. aureus including strains with reduced susceptibility to vancomycin, 103; coagulase-negative staphylococci, 87) and community-associated MRS (S. aureus including non-multiresistant oxacillin-resistant strains, 37; coagulase-negative staphylococci, 92). The quinolone resistance-determining regions of gyrA, gyrB, grlA and grlB genes from six strains with reduced susceptibility to DX-619 were sequenced.
Results: DX-619 showed the lowest MIC90 values for all categories of strains tested, irrespective of the degree of glycopeptide resistance. The six strains with MIC values of >128 mg/L of levofloxacin commonly carried two mutations in gyrA and two mutations in grlA. DX-619 showed potent activity against strains with MIC values of 2 mg/L.
Conclusions: DX-619 was potent against all MRS tested, suggesting that it would be a promising candidate for the treatment of methicillin-resistant S. aureus infection if sufficient in vivo concentrations were safely attained.
Key Words: Staphylococcus aureus , coagulase-negative staphylococci , antimicrobial activity , gyrA , grlA
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
Methicillin-resistant staphylococci (MRS) represented by methicillin-resistant Staphylococcus aureus (MRSA) have become major nosocomial pathogens worldwide. Strains are commonly resistant to most of the clinically available antimicrobial agents and highly resistant to ß-lactams.1 Glycopeptides, vancomycin and teicoplanin, have been used for the treatment of infections caused by these multiresistant MRS. However, susceptibility of MRS to glycopeptides has been changing. Vancomycin-intermediate S. aureus (VISA) strains2 or glycopeptide-intermediate S. aureus strains and vancomycin-resistant MRSA strains3 have been reported. An oxazolidinone antibiotic, linezolid, has been introduced as a new therapeutic agent. However, linezolid-resistant S. aureus first emerged in 2001.4 The development of other novel antistaphylococcal agents has been actively pursued.
DX-619 was developed as a drug used for the treatment of infections caused by multidrug-resistant Gram-positive organisms. In this study, we tested the in vitro activity of DX-619 in comparison with seven reference compounds. As the epidemiology of MRS has been changing and MRS have frequently become isolated from community-associated infections,5 we tested susceptibilities of isolates from both hospitals and the community to DX-619.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
DX-619, sitafloxacin and levofloxacin were supplied by Daiichi Sankyo Co. Ltd, Tokyo, Japan. Vancomycin was purchased from Sigma Chemical Co., St Louis, MO, USA. Teicoplanin and quinupristin/dalfopristin were supplied by Aventis Pharma Ltd, Strasbourg, France. Arbekacin was supplied by Meiji Seika Kaisha, Tokyo, Japan. Linezolid was supplied by Pfizer, New York, USA.
Tested strains were as follows: 103 healthcare-associated MRSA (HA-MRSA) strains, which were classified into two categories, 80 vancomycin-susceptible MRSA strains [65 from 11 Asian countries (Japan, Korea, China, Thailand, India, Indonesia, Philippines, Saudi Arabia, Singapore, Sri Lanka and Vietnam) isolated in 1998–99, 7 from Australia isolated in 1996–2000, 4 from France isolated in 1996 and 4 type strains for SCCmec typing, NCTC 10442, N315, MRSA and 85/2082] and 23 MRSA strains with reduced susceptibility to vancomycin [isolated as VISA from 7 countries (Japan, USA, South Korea, UK, France, Brazil and Taiwan) in 1996–2002]; 37 community-associated MRSA (CA-MRSA)/non-multiresistant oxacillin-resistant S. aureus (NORSA) strains (25 well-defined CA-MRSA strains isolated from the USA and Australia and 12 NORSA strains isolated from Australia6); 87 healthcare-associated methicillin-resistant coagulase-negative staphylococci (HA-MRCoNS) strains (21 from Juntendo Hospital in 2002 and 66 from Tokyo University Hospital in Japan in 2002–03) [Staphylococcus auricularis (n = 3), Staphylococcus capitis (n = 12), Staphylococcus caprae (n = 2), Staphylococcus epidermidis (n = 56), Staphylococcus haemolyticus (n = 3), Staphylococcus hominis (n = 10) and Staphylococcus warneri (n = 1)]; 92 community-associated methicillin-resistant coagulase-negative staphylococci (CA-MRCoNS) strains isolated from infants of Japanese kindergarten or nursery school in 2001–02 [S. auricularis (n = 1), S. caprae (n = 3), Staphylococcus cohnii (n = 2), S. epidermidis (n = 43), S. haemolyticus (n = 12), S. hominis (n = 4), Staphylococcus saprophyticus (n = 6), Staphylococcus simulans (n = 6), S. warneri (n = 14) and Staphylococcus xylosus (n = 1)]. All tested strains carried mecA, which was confirmed by PCR as described previously.6
MICs were determined by the agar dilution method as recommended by the CLSI (formerly NCCLS) using S. aureus FDA 209-P and S. aureus ATCC 29213 as reference strains.
The nucleotide sequences of the quinolone resistance-determining regions (QRDRs) of gyrA, gyrB, grlA and grlB genes in the six MRSA strains (four from Korea, JCSC108, JCSC116, JCSC129 and JCSC133, and two from Japan, JCSC378 and JCSC1111) with the highest MIC value (2 mg/L) of DX-619 were determined by amplifying DNA fragments by PCR as described previously7 with primer pairs as follows: gyrA, gyrA-up, TGGCTGAATTACCTCAATCAAG and gyrA-down, CTTCAATAACTGCACGAGAACG; gyrB, gyrB-up, ATACACGTGAAGGTATGACAGC and gyrB-down, TCCAAGACCTTTGTATCGTGCA; grlA, grlA-up, TTAGGTGATCGCTTTGGAAGAT and grlA-down, TACCTGTAGAACCATTCACTAG and grlB, grlB-up, ACTTCTGAAGCTAGAAGTGCTG and grlB-down, TTTCTGGGTTCATCGTCGTTTC. Nucleotide sequencing was carried out using a BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) and 3730 DNA Analyzer (Applied Biosystems and Hitachi, Ltd, Tokyo Japan), according to manufacturers' instructions.
|
Results and discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
We tested the in vitro activities of DX-619 and seven reference compounds against different categories of MRS (Table 1). In the case of vancomycin-susceptible HA-MRSA strains, the proportions of susceptible strains to four antibiotics, vancomycin, teicoplanin, linezolid and quinupristin/dalfopristin, were judged to be
98.8% based on the criteria of the CLSI, but only 21.3% of strains were susceptible to levofloxacin (Table 1B). Linezolid and quinupristin/dalfopristin were effective against VISA strains that showed reduced susceptibility to vancomycin (MIC = 2–8 mg/L) and teicoplanin (MIC = 4–32 mg/L) (Table 1C). All these strains were resistant to levofloxacin. DX-619 showed the lowest MIC50 and MIC90 values (0.06 and 0.25 mg/L) for 103 HA-MRSA strains, irrespective of the susceptibility to glycopeptides (Table 1A).
|
CA-MRSA/NORSA strains were susceptible to all eight tested compounds (Table 1D).
Susceptibilities of MRCoNS strains are similar to those of MRSA (Table 1E–J). MIC50 and MIC90 values of DX-619 for both HA-MRCoNS and CA-MRCoNS strains were very low. MIC90 values for HA-MRCoNS strains of the eight antibiotics were equal to or 2–8-fold lower than those for HA-MRSA strains. Levofloxacin was not as effective against HA-MRCoNS as against HA-MRSA. Some HA-MRCoNS strains (S. capitis and S. auricularis) showed MIC values of levofloxacin 64 mg/L. Almost all CA-MRCoNS strains were susceptible to all eight tested compounds. However, 5.4% of them were resistant to teicoplanin and 12% to levofloxacin. Among the tested compounds, DX-619 again showed the highest activity against all tested MRCoNS.
It is well known that quinolone resistance can occur as a result of mutation in DNA gyrase and topoisomerase IV, which are the targets for this class of antimicrobial. Among the tested strains, six HA-MRSA strains showed MIC values of 2 mg/L of DX-619, which is the highest reported from previous clinical staphylococcal isolates.8,9 These strains were highly resistant to the other quinolones tested with MIC values of 32 mg/L for sitafloxacin and >128 mg/L for levofloxacin. To determine the molecular basis for quinolone resistance in these strains, we determined the nucleotide sequences of the QRDRs of gyrAB and grlAB of these six strains. Interestingly, all six strains isolated from two countries, Korea and Japan, shared identical mutations within gyrA and grlA. There were four point mutations in QRDRs of gyrA and grlA genes, whereas no mutation was found in QRDRs of gyrB and grlB genes. The four mutations were located in 
4 domains of GyrA and GrlA: in GyrA, at codon 84 Ser (TCA) to Leu (TTA) and at codon 85 Ser (TCT) to Pro (CCT); and in GrlA, at codon 80 Ser (TCC) to Phe (TTC) and at codon 84 Glu (GAA) to Lys (GAA).
Des-F(6)-quinolone DX-619 showed extremely low MIC values for two reference S. aureus strains, FDA 209-P and ATCC 29213, with MICs of 0.008 and 0.016 mg/L, respectively. Although MIC values for clinical isolates increased at most 32-fold, it was still potent against all categories of MRS including strains resistant to clinically available quinolones with MICs ranging from 0.008 to 2 mg/L. This good activity could be a function of a high affinity for target enzymes and/or a structure favourable for accumulation within the cell.
DX-619 may become a useful alternative for the treatment of MRS infection. Preliminary studies by Daiichi Sankyo Co. Ltd have suggested that DX-619 has a promising safety profile. Further studies on toxicity, pharmacokinetics and pharmacodynamics of DX-619 are awaited.
|
Funding |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
This work was supported by a grant from Juntendo University.
|
Transparency declarations |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
None to declare.
|
Acknowledgements |
|---|
We are grateful to Dr T. Oguri (Juntendo Hospital) and Ms K. Kishii (Juntendo University) for kindly providing MRCoNS strains.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
1 . Deresinski S. Methicillin-resistant Staphylococcus aureus: an evolutionary, epidemiologic, and therapeutic odyssey. Clin Infect Dis (2005) 40:562–73.[CrossRef][Web of Science][Medline]
2
.
Hiramatsu K, Hanaki H, Ito T, et al. Methicillin-resistant Staphylococcus aureus clinical strain with reduced vancomycin susceptibility. J Antimicrobial Chemother (1997) 40:135–46.
3 . CDC. Staphylococcus aureus resistant to vancomycin—United States, 2002. MMWR Morb Mortal Wkly Rep (2002) 51:565–7.[Medline]
4 . Tsiodras S, Gold HS, Sakoulas G, et al. Linezolid resistance in a clinical isolate of Staphylococcus aureus. Lancet (2001) 358:207–8.[CrossRef][Web of Science][Medline]
5 . Chambers HF. The changing epidemiology of Staphylococcus aureus. Emerg Infect Dis (2001) 7:178–82.[Web of Science][Medline]
6
.
Okuma K, Iwakawa K, Turnidge JD, et al. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. J Clin Microbiol (2002) 40:4289–94.
7
.
Watanabe S, Ito T, Takeuchi F, et al. Structural comparison of ten serotypes of staphylocoagulases in Staphylococcus aureus. J Bacteriol (2005) 187:3698–707.
8
.
Bogdanovich T, Esel D, Kelly L, et al. Antistaphylococcal activity of DX-619, a new des-F(6)-quinolone, compared to those of other agents. Antimicrob Agents Chemother (2005) 49:3325–33.
9
.
Fujikawa K, Chiba M, Tanaka M, et al. In vitro antibacterial activity of DX-619, a novel des-fluoro(6) quinolone. Antimicrob Agents Chemother (2005) 49:3040–5.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||