Skip Navigation


JAC Advance Access originally published online on September 4, 2008
Journal of Antimicrobial Chemotherapy 2008 62(5):942-947; doi:10.1093/jac/dkn347
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
62/5/942    most recent
dkn347v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by García, N.
Right arrow Articles by Quesada, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by García, N.
Right arrow Articles by Quesada, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Original research

Genetic determinants for cfxA expression in Bacteroides strains isolated from human infections

Nuria García1, Gloria Gutiérrez2, María Lorenzo1, José E. García3, Segundo Píriz1 and Alberto Quesada2,*

1 Departamento de Medicina y Sanidad Animal, Facultad de Veterinaria, Universidad de Extremadura, Avda. de la Universidad s/n, 10071 Cáceres, Spain 2 Departamento de Bioquímica, Facultad de Veterinaria, Universidad de Extremadura, Avda. de la Universidad s/n, 10071 Cáceres, Spain 3 Departamento de Microbiología, Hospital Universitario, Universidad de Salamanca, Paseo San Vicente 58-182, 37007 Salamanca, Spain

* Corresponding author. Tel: +34-927257000, 1334; Fax: +34-927257110; E-mail: aquesada{at}unex.es

Received 29 April 2008; returned 18 July 2008; revised 31 July 2008; accepted 1 August 2008


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 Funding
 Transparency declarations
 Supplementary data
 References
 
Objectives: To identify genetic determinants that determine β-lactamase expression in Bacteroides strains isolated from human infections.

Methods: β-Lactam susceptibility and β-lactamase enzyme expression were characterized in selected strains. β-Lactamase genes and surrounding regions were analysed by PCR, inverse PCR and Southern hybridization.

Results: High resistance to penicillins and cephalosporins was found among most isolated strains, in which all known β-lactamase genes from Bacteroides are represented, but differences were found in their expression of enzyme activity. In contrast to the cepA gene, ubiquitously found but frequently inactive, or cfiA, which only confers carbapenem resistance in two strains, the detection of high β-lactamase expression correlates closely with the presence of cfxA genes. This genetic determinant shares variability of upstream regulatory elements, including sequence tags from Tn4555, Tn4351 and IS614B, and polymorphisms of encoded amino acid sequences at positions G57C and Y259C, which might determine enzyme expression characteristics.

Conclusions: The main determinant for β-lactamase expression in Bacteroides strains is the cfxA gene, in which IS614B integration upstream of the coding sequence represents a molecular marker for higher levels of enzyme activity.

Keywords: β-lactamases , enzyme expression , antibiotic resistance , mobile elements , up-regulation


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 Funding
 Transparency declarations
 Supplementary data
 References
 
Bacteroides are Gram-negative and anaerobic bacteria that represent a major fraction of intestinal microflora in animals and humans, in which they are frequently associated with nosocomial bacteraemia.1 The therapeutic arsenal that remains available to threaten post-surgical infections is limited because of resistance to β-lactam compounds among Bacteroides strains, a prevalent phenotype conferred by β-lactamase genes and/or overexpression of efflux pump genes.2,3 Three β-lactamase genes have been described in Bacteroides: the endogenous cephalosporinase encoded by cepA, a second and related class A cephalosporinase corresponding to cfxA and the class B metallo-β-lactamase that is encoded by the cfiA gene.4–6 These enzymes are active against a wide spectrum of substrates, including penicillins and cephalosporins, but only the metalloenzyme hydrolyses carbapenems.7

Transference of β-lactamase genes among Bacteroides strains has been shown for cfxA, which has been found to be associated with the conjugative transposon Tn4555, a genetic element that drives, although non-autonomously, its own transference.8,9 Horizontal transmission of cfxA might explain the recent dissemination of closely related gene sequences among Bacteroides, Prevotella and Capnocytophaga species.8,10,11 In contrast, the other β-lactamase genes seem to be only vertically transferred, which leads to a sharp division between cfiA- and cepA-positive strains from Bacteroides fragilis.12,13 However, the presence of β-lactamase loci does not imply resistance to β-lactam agents, as susceptible strains might have developed under non-selective pressure, allowing gene inactivation and remaining as reservoirs of antibiotic resistance genes. These bacteria could become resistant again by enzyme overexpression upon mobilization of insertion sequences and integration upstream of their coding sequences, such as cepA activation by IS1224 and β-lactamase up-regulation from cfiA mediated by IS1186, IS942, IS4351, IS1187, IS1188, IS1169, IS613 and IS614B.14–17

This work shows the relevant role of cfxA in β-lactamase expression and β-lactam resistance in 44 Bacteroides strains isolated from human infections. Among the β-lactamase genes found in the collection, the main determinant for enzyme expression is cfxA, a locus that demonstrates genetic plasticity of regulatory, mobilization and coding sequences. Thus, cfxA alleles analysed in this study might present, besides different polymorphisms of encoded β-lactamase, their upstream sequences tagged by IS614B, a putative cis-acting element, Tn4351 or Tn4555, transposons that could be involved in the mobilization of the gene marker.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 Funding
 Transparency declarations
 Supplementary data
 References
 
Bacterial strains

The 44 Bacteroides strains used in this study were isolated in the Clinical Hospital of the University of Salamanca from a wide variety of biological fluids and wounds, including laparotomic and intra-abdominal ulcers and abscesses [Table S1, available as Supplementary data at JAC Online (http://jac.oxfordjournals.org/)]. Isolates were identified by means of the biochemical tests performed with the Api 20A system (bioMérieux), which allowed species identification within the 95% to 99% confidence interval.

Antimicrobial titrations

Standard compounds were obtained from the following sources: penicillin G, Antibióticos S.A.; ampicillin, Sigma; cefalexin, Bhom; cefadroxil, Bristol-Myers Squibb; cefuroxime, Glaxo Wellcome; cefoxitin, cefotaxime and cefpirome, Hoeschst Marion Roussel; ceftriaxone, Roche; imipenem, Merck, Sharp & Dohme.

MICs of different β-lactam antibiotics were determined by the agar dilution technique in Wilkins–Chalgren agar (Oxoid), following the proposed standard for antimicrobial susceptibility testing of anaerobic bacteria.18 Plates were incubated in Gas-Pak jars (Oxoid) at 37°C for 24–48 h. B. fragilis ATCC 25285 and Clostridium perfringens ATCC 13124 were included as controls in all MIC determinations. The MIC was interpreted as the lowest concentration of antimicrobial producing no growth, one discrete colony or a barely visible haze.

Determination of β-lactamase activities

Bacteroides strains were grown at 37°C in anaerobic cultures of Wilkins–Chalgren broth medium (Oxoid). At the end of the exponential phase of growth (1.0–1.5 OD600 U/mL), cells were collected by centrifugation (6000 g, 5 min, 4°C), washed in phosphate buffer (50 mM, pH 7.0), sonicated in ice by 60 s treatment (maximal strength, 33% efficiency) with a vibra-cell apparatus (Sonic-Materials), and cell-free extracts were obtained as the supernatant of a final centrifugation (10 000 g, 10 min, 4°C). β-Lactamase activities were determined as described previously.5,19

Detection of β-lactamase genes and upstream regions by PCR

Primers cepA1 (AGCGAYAAYAAYGCNTGYGA) and cepA2 (GAAGATCCNGTYTTRTGNCC), which include cepA-specific determinants at their 3'-ends, were designed considering cepA and cfxA sequences from Bacteroides.4 PCR conditions were 3 min at 94°C; followed by 35 cycles of 1 min at 94°C, 30 s at 50°C and 1 min at 72°C; and a final extension of 10 min at 72°C. Primers cfiAP1 and cfiAP2 have been described previously.20 The primer pair specific for the amplification of cfxA alleles, cfxA1 (ATCGTAGTTTTGAGTATAGCT) and cfxA2 (TAAAAGCACTCCGATAACGAT), was used with the following PCR conditions: 3 min at 94°C; followed by 30 cycles of 1 min at 94°C, 30 s at 57°C and 2 min at 72°C; and a final extension of 10 min at 72°C.21 The primer pair cfxAIU (TGACCCAAAGACTTGGAGTCCT) and cfxAIL (TGCGCTATCTTTTGTCGCTGAT) was used for inverse PCR (iPCR), with the following conditions: 20 cycles of 30 s at 94°C, 30 s at 60°C and 6 min at 72°C; followed by 15 cycles of 30 s at 94°C, 30 s at 60°C and 6 min at 72°C, with an increase of 20 s per cycle in the extension time. DNA samples for iPCR were prepared as described previously.22 The triple-master polymerase (Eppendorf) was used, instead of standard Taq DNA polymerase, for cloning and/or sequencing purposes.

Nucleic acid manipulation

Genomic DNA was purified from overnight cultures by using the Gnome DNA Isolation Kit (Q·BIOgene). The pGem-T easy vector (Promega) and plasmid purification system (High Pure Plasmid Isolation Kit, Roche), Escherichia coli XL1 Blue MRF' strain (Stratagene) and the electroporation devise Gene Pulser II (Bio-Rad) were used for cloning recombinant DNA.22 Restriction and modifying enzymes (Invitrogen), and the Southern hybridization system (DIG-High Prime Labelling and Detection Kit and Nylon Membranes, Roche), were used following the manufacturers' instructions. DNA synthesis and sequencing reactions were performed by Stab Vida (Oeiras, Portugal).

Bioinformatic tools

Programs used are available at http://bioinfo.hku.hk/services/menuserv.html and http://www.ncbi.nlm.nih.gov. Primers were designed by Oligo Software version 6.57.

Nucleotide sequence accession numbers

Accession numbers (EMBL) for sequences described in this work are AM940009 [GenBank] to AM940017.


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 Funding
 Transparency declarations
 Supplementary data
 References
 
Antimicrobial susceptibility

The test for β-lactam resistance of Bacteroides strains includes penicillins, first-, second-, third- and fourth-generation cephalosporins, and a carbapenem (Table S1). According to the MIC values, the bacterial collection is highly resistant to penicillins (MIC greater than or equal to breakpoint; 86.0% for penicillin G and 90.9% for ampicillin) and first-generation cephalosporins (93.0% for cefalexin and 75.0% for cefadroxil), moderately resistant to second- and third-generation cephalosporins (69.8% for cefuroxime, 34.9% for cefoxitin and 53.5% for cefotaxime) and highly resistant to a fourth-generation cephalosporin (90.7% for cefpirome).18 In contrast, growth inhibition by imipenem was very effective, as only two strains showed resistance to this carbapenem (4.5%).

Expression of β-lactamase and identification of β-lactamase genes

The determination of β-lactamase activity allowed classification of Bacteroides strains into three categories: high β-lactamase strains, for those expressing more than 100 mU/mg of protein (Figure 1b); low/medium β-lactamase strains, with <100 mU/mg of protein (Figure 1a); and non-expressing strains, for those lacking detectable activity or expressing it under the sensitivity threshold of 1 mU/mg of protein (Figure 1c). Among 18 strains with detectable activity, enzyme sensitivity to clavulanic acid or EDTA was tested for functional identification of class A and B enzymes.7 Only two strains from the low/medium β-lactamase group expressed enzyme activities that were inhibited by EDTA, corresponding to putative metallo-β-lactamases of class B, whereas class A enzymes were detected in strains from the two categories expressing β-lactamase activity.


Figure 1
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1. β-Lactamase activity (nitrocefin) and β-lactamase gene content in the Bacteroides strains. β-Lactamase activity in the absence (black bars) or in the presence of clavulanic acid (4 mg/L; white bars) or EDTA (2 mM; grey bars). According to the enzyme activities, the strains were classified as low-expressing strains (a, <100 mU/mg of protein), high-expressing strains (b, >100 mU/mg of protein) and non-expressing strains (c, <1 mU/mg of protein). The bars represent the average of three independent experiments. β-Lactamase genes were identified by PCR and Southern hybridizations (plus, positive identification; minus, negative identification) to probes corresponding to previously sequenced PCR fragments of β-lactamase genes amplified from MN4 (cfxA), MN6 (cepA) and MN11 (cfiA) strains.

 
β-Lactamase genes were detected by PCR with a set of three primer pairs, including primers specific for cfxA and cfiA genes and degenerate primers for cepA and orthologous genes (see the Materials and methods section).4–6 The identification of β-lactamase genes in 41 of the 44 Bacteroides strains and deduced genotypes are indicated in Figure 1 (a–c). Among the three β-lactamase genes described in Bacteroides, the cepA, cfxA and cfiA genes were found in 26, 12 and 6 strains, respectively. Nevertheless, their relative abundances in each β-lactamase expression group were different. Although the maximal activity was detected in MN1, which lacks any detectable gene marker, it can be proposed that cfxA has a predominant role as a determinant for β-lactamase expression. Moreover, the detection of its sequence in 11 strains correlates with low/medium or high β-lactamase activity, and only one cfxA-positive strain lacked enzymatic activity. The endogenous cephalosporinase encoded by cepA and its orthologous genes seem to be the less-relevant determinant of β-lactamase expression in the Bacteroides collection, as it is ubiquitously present in non-expressing strains (20/26 strains, Figure 1c). However, the gene was detected in the low/medium-expressing group (2/7 strains, Figure 1a) and also among some high-expressing strains (4/11 strains, Figure 1b), although the gene cfxA was simultaneously detected in two of the cepA- positive strains (MN6 and MN23). In contrast, the metallo-β- lactamase-encoding gene cfiA was only expressed in strains MN11 and MN32, which are included in the low/medium- expressing group.

Upstream regulatory sequences for cfxA

The gene dosage of cfxA in the Bacteroides collection was analysed by Southern hybridization of genomic DNA digested by ClaI (Figure 2), which presents a restriction target site within the gene sequence. The detection of two bands (cfxA single copy) in strains MN6, MN12, MN17, MN18 and MN21 contrasts with hybridization to more than four bands (at least two gene copies) in strains MN4, MN7, MN9, MN13, MN23 and MN44, most of which belong to the high β-lactamase group. However, additional factors, in addition to copy number, might determine gene expression from cfxA, as strain MN13 (two copies) lacks enzyme expression and strains MN6, MN17 and MN18 (single copy) are also high β-lactamase-expressing strains.


Figure 2
View larger version (77K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2. Genomic hybridization of cfxA gene sequences from Bacteroides strains. Genomic DNA (1 µg) from each strain was digested with the ClaI enzyme, separated on a 0.8% agarose and 0.5x TBE gel, and Southern blotting was performed by hybridization to a previously sequenced PCR fragment of the cfxA gene amplified from MN4.

 
The upstream regions for cfxA alleles from strains MN6, MN9, MN12, MN13, MN17, MN18, MN21 and MN23 were isolated by iPCR between the TaqI restriction site that overlaps the internal target for ClaI and the closest TaqI restriction target found upstream of the coding sequence. The eight strains displayed iPCR fragments belonging to one or two of three size types: 0.85 kb fragments were amplified from MN6, MN9, MN12, MN13 and MN21; 0.65 kb fragments were amplified from MN9, MN17 and MN18; and a 0.55 kb fragment was amplified from MN23 (Figure 3a). The digestion of iPCR fragments by TaqI restriction enzyme revealed that size polymorphism corresponds to different types of cfxA upstream sequences, which could be defined by their restriction fragment length polymorphism (RFLP) patterns (Figure 3b). Sequencing and comparison with genetic databases of one fragment representing each group demonstrated that the differences found were associated with the integration of different mobile elements in the vicinity of the β-lactamase gene. Indeed, the iPCR fragments from MN21, MN9 and MN23 presented Tn4555-, IS614B- and Tn4351-related sequences, respectively, among which only Tn4555 has been previously identified in the genetic context of cfxA.23 Tn4555-cfxA and Tn4351-cfxA share an identical 29 bp sequence upstream of the start codon of the β-lactamase gene, whereas the first 13 bp is also maintained in the IS614B-cfxA element (data not shown). Although more than one band from iPCR could be detected only in the MN9 strain, the close relationships existing between Southern hybridization and iPCR polymorphisms allowed assignment of the double genotype Tn4555-cfxA/IS614B-cfxA to MN4, MN7, MN9 and MN44, whereas MN17 and MN18 might share a single IS614B-cfxA element (Figure 4). Interestingly, all of these are the cfxA-positive strains expressing the highest β-lactamase activity from the Bacteroides collection (Figure 1). The presence of Tn4555 in the vicinity of cfxA in MN6, MN12, MN13 and MN21 strains does not correlate so well, as the group includes low/medium β-lactamase-expressing strains, MN12 and MN21, and the MN13 strain that lacks detectable activity (Figure 1). The role of the Tn4351-cfxA gene marker in gene expression remains unclear; although strain MN23 belongs to the high β-lactamase-expressing group, it shares with strain MN6 the double cepA/cfxA genotype (Figures 1 and 4).


Figure 3
View larger version (65K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3. iPCR for upstream of the cfxA gene from Bacteroides strains. (a) iPCR fragments displayed by electrophoresis in a 1% agarose gel. (b) RFLP analysis of iPCR fragments performed by TaqI enzyme digestion and electrophoresis in a 1.5% agarose gel. PCR fragments corresponding to lower (9a) and higher (9b) molecular weight bands from the strain MN9 were digested separately.

 


Figure 4
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4. Genomic context deduced for cfxA from Bacteroides strains. Upstream sequences were identified by analysis of sequence tags obtained by iPCR and correspond to IS614B, Tn4555 or Tn4351 (Figure 3). Further identification of genotypes was deduced by the clustering of band-profile signatures detected by Southern hybridization of genomic DNAs digested by the ClaI enzyme (Figure 2).

 
Allelic polymorphisms of cfxA

The coding sequences of cfxA genes from MN4, MN7, MN12, MN13 and MN17 strains were determined, and only two nucleotide polymorphisms were detected. Substitutions G169GC->TGC in strain MN17 and TA776T->TGT in strains MN4, MN12 and MN7 (data not shown) produce polymorphic CfxA proteins with residues G57C and Y259C, respectively, or G42C and Y239C following the Ambler numbering scheme for the class A β-lactamases.24 Heterozygosis for both polymorphisms of CfxA, Y239 and C239, was found in strain MN7. In addition, sequence comparison with CfxA from Bacteroides vulgatus demonstrated that all genes from the Bacteroides strains present the substitution A986AA->GAA, which produces the variant K296E (K272E).5 Thus, sequenced alleles of cfxA correspond with phenotypes: G42/C239/E272 for strains MN4 and MN12; G42/Y239/E272 for MN13; G42/Y239/E272 and G42/C239/E272 for MN7; and C42/Y239/E272 for MN17. Among them, only K272E and Y239C had been previously described as CfxA2 and CfxA5, respectively, and a distinct polymorphism of residue 239 (D239Y) of CfxA had also been described in some Prevotella and Capnocytophaga strains, but distinct phenotypes were not detected among strains that present the different alleles.5,10,11,21,25


   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
Funding
 Transparency declarations
 Supplementary data
 References
 
The regulation of β-lactamase genes is responsible for β-lactamase expression and β-lactam resistance in Bacteroides strains.17 Therefore, the identification of its control mechanisms might contribute to the diagnosis of antimicrobial activities in clinical isolates.

The first approach of this work was to detect the relationships existing among β-lactamase expression, β-lactam resistance and β-lactamase gene content (Table S1 and Figure 1). The detection of β-lactamase activity in 18 strains by the nitrocefin enzymatic assay can be considered a true marker for β-lactam resistance in the collection of 44 Bacteroides strains, as it is closely related to maximal MICs (>256 mg/L) of cephalosporins and/or penicillins. Inversely, among the 14 strains that presented susceptibility to more than two compounds (cephalosporins or cephalosporins plus penicillins), only MN44 expressed β-lactamase activity, although this strain was highly resistant to both penicillins tested. β-Lactamase genes were only undetected in three strains (Figure 1), but the screening cannot be considered determinant for MN1 and MN15 as both strains express β-lactamase and β-lactam resistance. In addition, enzymatic activity was not detectable in 12 strains that, having β-lactamase genes, were resistant to more than two antimicrobials. Thus, although other β-lactam resistance determinants cannot be excluded for these strains, their β-lactamase activity might be expressed under the detection limit of the enzymatic assay.

The genetic background of Bacteroides strains is related to their β-lactamase gene content.12,13 The 24 B. fragilis strains from the collection presented cepA or cfiA genes, and only strain MN6 was positive for cfxA, in addition to cepA. The second species in the collection, Bacteroides ovatus (12 strains), is prevalent in the high β-lactamase expression group (Table S1 and Figure 1). Indeed, 58% of the cfxA-positive strains (7 of 12) correspond to this species, although four additional B. ovatus strains were positive for cepA, in addition to MN23 that also presented cfxA, and one strain, MN30, which lacked any detectable gene marker. cfxA and cepA genes were also identified in Bacteroides thetaiotaomicron (two positive strains for each) and Bacteroides distasonis [two and one strain(s), respectively].

The β-lactamase genes that have been described in Bacteroides have different degrees of sequence diversity, which could be related to their transference pathways. cepA and orthologous genes from Bacteroides species share low levels of sequence identity, which suggests that they have been transmitted vertically to actual strains.4,26,27 In contrast, all cfiA genes share closely related DNA sequences, but their limited distribution might indicate their horizontal transference by mechanisms restricted to a subgroup of B. fragilis strains.12 The third β-lactamase gene from Bacteroides, cfxA, is frequently associated with Tn4555, a non-autonomous conjugative transposon that is potentially involved in the horizontal transfer of the β-lactamase gene, which is widely distributed among different species of Bacteroides, Prevotella and Capnocytophaga (Figure 4).8,10,21,23,25 In addition, the detection in this work of a sequence tag from Tn4351 in the genomic context upstream of cfxA suggests that other genetic elements can contribute to the transposition of the β-lactamase gene. Tn4351 is associated with erythromycin resistance genes in Bacteroides and, although it is non-mobilizable, the element is involved in the evolution of the mosaic structure of the conjugative and autonomous transposon CTnDOT.28,29

Previous works have shown that the presence of insertion sequences in the vicinity of the β-lactamase genes cepA and cfiA of Bacteroides determines a high level of enzyme expression that enhances β-lactam resistance.14–16,17 In this work, we describe the identification of sequences from IS614B, a common activation element for the metallo-β-lactamase gene cfiA, in the vicinity of cfxA (Figure 4). Indeed, the detection of the regulatory element and its linked β-lactamase gene correlates with the high-level expression from cfxA in Bacteroides strains, which suggests that it can constitute a genetic marker for enzyme expression. Future work is required to fully understand the relevance to enzyme expression of the new genetic variability detected in cfxA.


   Funding
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
Transparency declarations
 Supplementary data
 References
 
This work was supported by grants SCSS0459, SCSS0506 and SCSS0629 (Consejería de Salud y Consumo, Junta de Extremadura, España) and AGL2005-02416 (Ministerio de Educación y Ciencia, España).


   Transparency declarations
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 Transparency declarations
Supplementary data
 References
 
None to declare.


   Supplementary data
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 Transparency declarations
 Supplementary data
References
 
Table S1 is available as Supplementary data at JAC Online (http://jac.oxfordjournals.org/).


   Acknowledgements
 
We wish to thank Dr R. Blasco for critical reading of the manuscript.


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 Transparency declarations
 Supplementary data
 References
 
1 Nagy E, Urbán E, Sóki J, et al. The place of molecular genetic methods in the diagnostics of human pathogenic anaerobic bacteria. A minireview. Acta Microbiol Immunol Hung (2006) 53:183–94.[CrossRef][Medline]

2 Falagas ME, Siakavellas E. Bacteroides, Prevotella, and Porphyromonas species: a review of antibiotic resistance and therapeutic options. Int J Antimicrob Agents (2000) 15:1–9.[CrossRef][Web of Science][Medline]

3 Pumbwe L, Chang A, Smith RL, et al. Clinical significance of overexpression of multiple RND-family efflux pumps in Bacteroides fragilis isolates. J Antimicrob Chemother (2006) 58:543–8.[Abstract/Free Full Text]

4 Rogers MB, Parker AC, Smith CJ. Cloning and characterization of the endogenous cephalosporinase gene, cepA, from Bacteroides fragilis reveals a new subgroup of Ambler class A β-lactamases. Antimicrob Agents Chemother (1993) 37:2391–400.[Abstract/Free Full Text]

5 Parker AC, Smith CJ. Genetic and biochemical analysis of a novel Ambler class A β-lactamase responsible for cefoxitin resistance in Bacteroides species. Antimicrob Agents Chemother (1993) 37:1028–36.[Abstract/Free Full Text]

6 Thompson JS, Malamy MH. Sequencing the gene for an imipenem-cefoxitin-hydrolyzing enzyme (CfiA) from Bacteroides fragilis TAL2480 reveals strong similarity between CfiA and Bacillus cereus β-lactamase II. J Bacteriol (1990) 172:2584–93.[Abstract/Free Full Text]

7 Bush K, Jacoby GA, Medeiros AA. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother (1995) 39:1211–33.[Web of Science][Medline]

8 Ferreira LQ, Avelar KE, Vieira JM, et al. Association between the cfxA gene and transposon Tn4555 in Bacteroides distasonis strains and other Bacteroides species. Curr Microbiol (2007) 54:348–53.[CrossRef][Web of Science][Medline]

9 Tribble GD, Parker AC, Smith CJ. Genetic structure and transcriptional analysis of a mobilizable, antibiotic resistance transposon from Bacteroides. Plasmid (1999) 42:1–12.[CrossRef][Web of Science][Medline]

10 Jolivet-Gougeon A, Tamanai-Shacoor Z, Desbordes L, et al. Genetic analysis of an Ambler class A extended-spectrum β-lactamase from Capnocytophaga ochracea. J Clin Microbiol (2004) 42:888–90.[Abstract/Free Full Text]

11 Madinier I, Fosse T, Giudicelli J, et al. Cloning and biochemical characterization of a class A β-lactamase from Prevotella intermedia. Antimicrob Agents Chemother (2001) 45:2386–9.[Abstract/Free Full Text]

12 Gutacker M, Valsangiacomo C, Piffaretti JC. Identification of two genetic groups in Bacteroides fragilis by multilocus enzyme electrophoresis: distribution of antibiotic resistance (cfiA, cepA) and enterotoxin (bft) encoding genes. Microbiology (2000) 146:1241–54.[Abstract/Free Full Text]

13 Podglajen I, Breuil J, Casin I, et al. Genotypic identification of two groups within the species Bacteroides fragilis by ribotyping and by analysis of PCR-generated fragment patterns and insertion sequence content. J Bacteriol (1995) 177:5270–5.[Abstract/Free Full Text]

14 Rogers MB, Bennett TK, Payne CM, et al. Insertional activation of cepA leads to high-level β-lactamase expression in Bacteroides fragilis clinical isolates. J Bacteriol (1994) 176:4376–84.[Abstract/Free Full Text]

15 Podglajen I, Breuil J, Rohaut A, et al. Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis. J Bacteriol (2001) 183:3531–5.[Abstract/Free Full Text]

16 Soki J, Fodor E, Hecht DW, et al. Molecular characterization of imipenem-resistant, cfiA-positive Bacteroides fragilis isolates from the USA, Hungary and Kuwait. J Med Microbiol (2004) 53:413–9.[Abstract/Free Full Text]

17 Depardieu F, Podglajen I, Leclercq R, et al. Modes and modulation of antibiotic resistance gene expression. Clin Microbiol Rev (2007) 20:79–114.[Abstract/Free Full Text]

18 National Committee for Clinical Laboratory Standards. Methods for Antimicrobial Susceptibility Testing of Anaerobic Bacteria: Approved Standard M11-A6 (2004) Wayne, PA, USA: NCCLS.

19 The Merck Index (2006) 14th edn. Whitehouse Station, NJ, USA: Merck Research Laboratories, Merck & Co. Inc.

20 Fang H, Hedberg M, Edlund C, et al. Identification of the metallo-β-lactamase gene from clinical isolates of Bacteroides fragilis. Anaerobe (1999) 5:431–4.[CrossRef][Web of Science]

21 Giraud-Morin C, Madinier I, Fosse T. Sequence analysis of cfxA2-like β-lactamases in Prevotella species. J Antimicrob Chemother (2003) 51:1293–6.[Abstract/Free Full Text]

22 Sambrook J, Rusell DW. Molecular Cloning: A Laboratory Manual (2001) Cold Spring Harbor, New York, USA: Cold Spring Harbor Laboratory Press.

23 Smith CJ, Parker AC. Identification of a circular intermediate in the transfer and transposition of Tn4555, a mobilizable transposon from Bacteroides spp. J Bacteriol (1993) 175:2682–91.[Abstract/Free Full Text]

24 Ambler RP, Coulson AF, Frère JM, et al. A standard numbering scheme for the class A β-lactamases. Biochem J (1991) 15:269–70.

25 Handal T, Giraud-Morin C, Caugant DA, et al. Chromosome- and plasmid-encoded β-lactamases in Capnocytophaga spp. Antimicrob Agents Chemother (2005) 49:3940–3.[Abstract/Free Full Text]

26 Smith CJ, Bennett TK, Parker AC. Molecular and genetic analysis of the Bacteroides uniformis cephalosporinase gene, cblA, encoding the species-specific β-lactamase. Antimicrob Agents Chemother (1994) 38:1711–5.[Abstract/Free Full Text]

27 Xu JM, Bjursell K, Himrod J, et al. A genomic view of the human- Bacteroides thetaiotaomicron symbiosis. Science (2003) 299:2074–6.[Abstract/Free Full Text]

28 Rasmussen JL, Odelson DA, Macrina FL. Complete nucleotide sequence and transcription of ermF, a macrolide–lincosamide–streptogramin B resistance determinant from Bacteroides fragilis. J Bacteriol (1986) 168:523–33.[Abstract/Free Full Text]

29 Whittle G, Hund BD, Shoemaker NB, et al. Characterization of the 13-kilobase ermF region of the Bacteroides conjugative transposon CTnDOT. Appl Environ Microbiol (2001) 67:3488–95.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Antimicrob. Agents Chemother.Home page
N. Garcia, G. Gutierrez, M. Lorenzo, S. Vadillo, S. Piriz, and A. Quesada
Gene Context and DNA Rearrangements in the Carbapenemase Locus of Division II Strains of Bacteroides fragilis
Antimicrob. Agents Chemother., June 1, 2009; 53(6): 2677 - 2678.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
62/5/942    most recent
dkn347v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by García, N.
Right arrow Articles by Quesada, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by García, N.
Right arrow Articles by Quesada, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?