JAC Advance Access originally published online on June 18, 2008
Journal of Antimicrobial Chemotherapy 2008 62(4):843-844; doi:10.1093/jac/dkn264
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research letters |
Description of an unusual class 2 integron in Shigella sonnei isolates in Senegal (sub-Saharan Africa)
1 Laboratoire de Bactériologie Expérimentale, Institut Pasteur, 220 Dakar, Sénégal 2 Université de Limoges, Faculté de Médecine, EA3175, Limoges 87000, France 3 INSERM, Equipe Avenir, Limoges 87000, France 4 Laboratoire de Bactériologie-Virologie-Hygiène, CHU Dupuytren, Limoges 87000, France
* Corresponding author. Tel: +221-33-839-92-35; Fax: +221-33-839-92-36; E-mail: gassama{at}pasteur.sn
Keywords: gene cassettes , IS911 , sat1 , S. sonnei
Integrons are genetic elements that acquire gene cassettes by integrase-catalysed site-specific recombination.1 Integrons contain various combinations of gene cassettes encoding antibiotic resistance determinants and are widespread among Gram-negative bacteria. Five classes of integrons have been described to date, based on the integrase coding sequence. Classes 1 and 2 are the most frequent. Class 2 was found in transposon Tn7 and its derivatives (Tn1825, Tn1826 and Tn4132), and its 3' segment contains five tns genes involved in transposon movements. The intI2 integrase gene of class 2 integrons contains a premature stop codon at position 179, rendering the integrase non-functional.2 Therefore, class 2 integrons usually contain the same array of four gene cassettes, three antibiotic resistance gene cassettes (dfrA1, sat and aadA1, conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin, respectively) and an orfX of unknown function. However, variations of the cassette contents have been described, resulting from Intl1 integrase-catalysed co-integrate formation between a class 1 and a class 2 integron, or from an RecA-dependent homologous recombination between two copies of the same cassette found in both classes of integron. Indeed, the dfrA1 and aadA1 cassettes, initially described in class 2 integrons, have also been found in class 1 integrons. Class 1 and 2 integrons have frequently been found in Shigella strains, and class 2 integrons predominate in Shigella sonnei and Shigella flexneri.3–5
We have previously described integron structures in S. sonnei strains isolated in Senegal; they included a class 2 integron of 
4 kb found in two epidemiologically related isolates.6 Here, we describe the organization of this class 2 integron.
The following primers were used for PCR mapping of the class 2 integron: hep74 in attI2,7 ORFX1 (CTCGTACTTGCGATGGCATC) in ORFX, and int2CS28 and int7S,6 both located in tnsE. Amplification was performed with the Expand Long Template PCR System (Roche Molecular Biochemicals, Roche Diagnostics GmbH, Germany). With primers hep74 and ORFX1, agarose gel electrophoresis identified a 4074 bp DNA fragment (data not shown) in both isolates, instead of the expected 3095 bp product. No PCR product was obtained with primers int2CS2 and int7S, suggesting a different arrangement in the 3' region of this class 2 integron. The entire class 2 integron was amplified with primer int2S8 in intI2 and with primer ORFX36 located in Tn7, downstream of the ORFX cassette. A PCR product of 4174 bp was purified with the QIAquick kit (Qiagen SA, Courtaboeuf, France), cloned with the pGEM-T vector system (Promega, Madison, WI, USA), transformed into XL1-Blue competent cells (Stratagene, Garden Grove, CA, USA) and sequenced. Sequence analysis of the 4174 bp insert of the recombinant plasmid showed that this integron harboured the four gene cassettes usually found in class 2 integrons, namely dfrA1, sat1, aadA1 and orfX (accession no. EU732664 [GenBank] ). However, the sat1 cassette was interrupted at position 186 by a complete copy of the insertion sequence IS911, a member of the IS3 family. IS911 was initially isolated from Shigella dysenteriae, but has since been detected (10–20 copies per cell) in the four Shigella species.9 As usually described for IS911, its insertion generated a 3 bp duplication (TAT) in the target sat1 sequence. To our knowledge, two ISs have previously been described in class 2 integrons, but not within the array of gene cassettes. Dubois et al.4 described a class 2 integron with an IS630 element in a strain of S. flexneri, and Biskri and Mazel10 described a class 2 integron with an IS1 in a strain of Escherichia coli. Both were located between intI2 and the first gene cassette.
To determine whether the resistance determinants carried by the integron were transferable, we performed a conjugation experiment on MH agar plates from S. sonnei to an E. coli strain resistant to nalidixic acid. We used a selective medium containing 50 mg/L nalidixic acid plus 100 mg/L trimethoprim. No transconjugants were obtained, suggesting the chromosomal location of this Tn7-containing class 2 integron as previously described in Shigella isolates.4,5 Pan et al.5 described a class 2 integron on transposon Tn7 inserted into the Tn7-specific target attTn7 of the S. sonnei chromosome downstream of the glmUS operon. Thus, to confirm the chromosomal insertion of Tn7, we successfully performed a PCR with primers Tn7R-F and glmS-R as described by Pan et al.5
Another feature of this atypical class 2 integron is the deletion of the tns genes, described in Tn7 and its derivatives. A class 2 integron lacking the tns genes has previously been described in Acinetobacter baumannii, but the 3' segment of the class 2 integron contained the ORFs found in the 3' segment of class 1 integrons (qacE
1, sul1 and ORF5).8 The PCR method previously used to detect such a chimeric integron with primers aadAL and ORFR8 was unsuccessful, suggesting that the class 2 integron that we describe here is not a hybrid class 2/class 1 integron.
In conclusion, we describe an unusual class 2 integron in a S. sonnei strain isolated in Africa. This new class 2 integron is characterized by the presence of one complete copy of the IS911 element inserted within the sat1 gene cassette.
 |
Funding |
|---|
 Top Funding Transparency declarationsReferences |
|---|
The work was supported by Institut Pasteur de Dakar, Sénégal, and by grants of the EA3175 from the Ministère de la Recherche and from the Conseil Régional du Limousin, France.
|
Transparency declarations |
|---|
|
TopFundingTransparency declarationsReferences |
|---|
None to declare.
|
References |
|---|
|
TopFundingTransparency declarationsReferences |
|---|
1 Mazel D. Integrons: agents of bacterial evolution. Nat Rev Microbiol (2006) 4:608–20.[CrossRef][Web of Science][Medline]
2
Hansson K, Sundström L, Pelletier A, et al. IntI2 integron integrase in Tn7. J Bacteriol (2002) 184:1712–21.
3
Ahmed AM, Furuta K, Shimomura K, et al. Genetic characterization of multidrug resistance in Shigella spp. from Japan. J Med Microbiol (2006) 55:1685–91.
4
Dubois V, Parizano MP, Arpin C, et al. High genetic stability of integrons in clinical isolates of Shigella spp. of worldwide origin. Antimicrob Agents Chemother (2007) 51:1333–407.
5
Pan JC, Ye R, Meng DM, et al. Molecular characteristics of class 1 and 2 integrons and their relationships to antibiotic resistance in clinical isolates of Shigella sonnei and Shigella flexneri. J Antimicrob Chemother (2006) 58:288–96.
6 Gassama Sow A, Diallo MH, Boye CS, et al. Class 2 integron-associated antibiotic resistance in Shigella sonnei isolates in Dakar, Senegal. Int J Antimicrob Agents (2006) 27:267–70.[CrossRef][Web of Science][Medline]
7
White P, McIver C, Rawlinson W. Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob Agents Chemother (2001) 45:2658–61.
8
Ploy MC, Denis F, Courvalin P, et al. Molecular characterization of integrons in Acinetobacter baumanii: description of a hybrid class 2 integron. Antimicrob Agents Chemother (2000) 44:2684–8.
9
Prère MF, Chandler M, Fayet O. Transposition in Shigella dysenteriae: isolation and analysis of IS911, a new member of the IS3 group of insertion sequences. J Bacteriol (1990) 172:4090–9.
10
Biskri L, Mazel D. Erythromycin esterase gene (ereA) is located in a functional gene cassette in an unusual class 2 integron. Antimicrob Agents Chemother (2003) 47:3326–31.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||