Skip Navigation


JAC Advance Access originally published online on March 20, 2008
Journal of Antimicrobial Chemotherapy 2008 61(6):1201-1204; doi:10.1093/jac/dkn099
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
61/6/1201    most recent
dkn099v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Gonzalez, L. M. F.
Right arrow Articles by Soares, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gonzalez, L. M. F.
Right arrow Articles by Soares, M. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Original research

Impact of HIV-1 protease mutations A71V/T and T74S on M89I/V-mediated protease inhibitor resistance in subtype G isolates

Luis M. F. Gonzalez1, André F. Santos1, Ana B. Abecasis2,3, Kristel Van Laethem3, Esmeralda A. Soares1, Koen Deforche3, Amilcar Tanuri1, Ricardo Camacho2, Anne-Mieke Vandamme3 and Marcelo A. Soares1,4,*

1 Departamento de Genética, Universidade Federal do Rio de Janeiro, CCS—Bloco A, sala A2-120, Cidade Universitária—Ilha do Fundão, Rio de Janeiro RJ 21949-970, Brazil; 2 Hospital Egas Moniz, Lisbon, Portugal; 3 Rega Institute for Medical Research, Katholieke Universiteit Leuven, Leuven, Belgium 4 Divisão de Genética, Instituto Nacional de Câncer, Rio de Janeiro, RJ, Brazil


* Corresponding author. Tel: +55-21-2562-6383; Fax: +55-21-2562-6396; E-mail: masoares{at}biologia.ufrj.br

Received 21 November 2007; returned 20 January 2008; revised 1 February 2008; accepted 17 February 2008


    Abstract
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 Funding
 Transparency declarations
 References
 
Objectives: Non-B human immunodeficiency virus (HIV)-1 subtypes possess several amino acid signatures in the viral protease that distinguish them from subtype B, some of which are reported as secondary drug-related mutations. We have previously shown a strong statistical interdependency of residues 71, 89 and 90 in subtype G, but the impact of substitutions on protease inhibitor (PI) resistance is unknown.

Patients and methods: We selected subtype G viruses from patients with diverse amino acid combinations at codons 71 (A/T), 74 (T/S), 89 (I/L/M/V) and 90 (L/M). Viral protease genes were inserted into an HIV molecular clone (HXB2). PI drug susceptibilities of chimeric viruses were determined.

Results: In isolates displaying 89I/V in combination with A71 or T74, a reversal to subtype G wild-type 89M was observed after growth in the absence of PI. The presence of 71T in one isolate and 74S in another allowed the persistence of 89I. Mutation 90M conferred intermediate but significant degrees of drug resistance to ritonavir and nelfinavir in subtype G viruses. The combination of 71T or 74S, 89I and 90M resulted in higher levels of resistance to those PIs.

Conclusions: Our results point to the hypothesis that 71T or 74S stabilizes 89I in the protease of subtype G, whose association was previously seen by Bayesian network analyses. The association of 89I with 90M may further increase the PI resistance of subtype G viruses when compared with 90M alone, highlighting novel mutational profiles for drug resistance in this non-B subtype.

Keywords: PI , phenotype assay , accessory mutations


    Introduction
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 Funding
 Transparency declarations
 References
 
Group M of human immunodeficiency virus type 1 (HIV-1) can be divided into nine subtypes according to its genetic diversity: A–D, F–H, J and K.1 These subtypes are heterogeneously distributed worldwide. Although subtype B accounts for most infections in developed nations, other (non-B) subtypes are prevalent in different parts of the developing world.2 As a consequence of such diversity, differences in encoded amino acid residues of HIV proteins from distinct subtypes have been speculated to modulate their function, and this is of particular interest in the drug susceptibility profile of the virus protease (PR) and reverse transcriptase (RT). Recent studies have addressed this issue. Baseline susceptibility to protease inhibitors (PIs) of non-B subtypes has been shown to differ.3 Furthermore, non-B subtypes can accumulate the majority of known drug resistance mutations for subtype B in PR and RT,4 but the same work indicated new putative, subtype-specific treatment-related mutations, such as positions 6 and 64 in the PR for subtype C, position 15 in CRF02_AG and position 19 in subtype F.4

Recently, a new mutational resistance profile for PIs has been proposed by Bayesian network analysis for some non-B subtypes such as C, F and G. This pathway involves the PR mutations A71V/T, T74S, M89I/V and L90M.5,6 Abecasis et al.5 showed that mutation M89I alone did not confer primary resistance to PIs, but in viral isolates that displayed M89I/V and L90M together, the loss of susceptibility to nelfinavir was significantly higher than in isolates with L90M alone. However, the role of mutations A71V/T and T74S in PI resistance still remained unknown. More recently, the same group demonstrated that the mutation M89I/V was associated with nelfinavir, indinavir and saquinavir exposure.6 In the present work, we evaluated the phenotypic role and the inter-correlation among mutations A71V/T, T74S, M89I and L90M in this new resistance pathway in subtype G viruses from HIV-infected patients failing nelfinavir-containing regimens.


    Patients and methods
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 Funding
 Transparency declarations
 References
 
Patients and virus sequencing

In this study, six HIV-1-infected patients harbouring subtype G viruses and regularly followed at the Hospital Egas Moniz (Lisbon, Portugal) were selected. A control subtype B virus with the PI mutations M46I and L90M was obtained from the University Hospitals Leuven (Leuven, Belgium) and used in the PI susceptibility assays. The antiretroviral treatment histories of the isolates studied are listed in Table 1. Viral PR and RT genomic regions were sequenced with the ViroSeq genotyping kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions. Viruses were subtyped by phylogenetic analysis with the use of subtype reference sequences and were chosen on the basis of their distinct patterns of combinations at PR codons 71, 74, 89 and 90 (see Table 1 for specific mutation patterns).


View this table:
[in this window]
[in a new window]

 
Table 1. Viral PR genotypes from patients' isolates before and after the RVA

 
PR phenotyping

The 50% inhibitory concentration (IC50) of PR from each virus isolate, including a wild-type control (pNL4-3 PR), was measured against the most common FDA-approved PI compounds (indinavir, ritonavir, saquinavir, nelfinavir, amprenavir and lopinavir). To perform this, the recombinant virus assay (RVA) technique was used to clone each PR into an HXB2-{Delta}PR vector, as described previously.7 In brief, the PCR products generated in the ViroSeq genotyping assay were used as templates to amplify a 481 bp fragment spanning the entire PR and flanking viral sequences with primers K1 (5'CAGAGCCAACAGCCCCACCA3') and MOP-R2 (5'AAATTTTCCCTTCCTTT3'). Only the PR cleavage site between p6 and PR is included in the replaced fragment. PCR products were co-transfected with the pGEM-T3/HXB2/{Delta}PR BstEII-linearized plasmid7 into the CD4+ T cell line MT4. Recombinant viruses were collected and titrated and had their IC50 against the aforementioned PI compounds determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-based cell viability assay in MT-4 cells, as described previously.8 Biological cut-offs for resistance to PIs tested were considered, as described by Vermeiren et al.9 Hypersusceptibility was defined as having a fold change (FC) value of <0.4 (2.5 times lower compared with the wild-type reference strain HXB2/NL4-3 PR) and having IC50 values significantly lower than the reference strain (P < 0.01) through Student's t-test.


    Results
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 Funding
 Transparency declarations
 References
 
The six original subtype G patient isolates displayed variations at position 89 (Table 1). Three viruses (isolates 56, 65 and 78) displayed 89I, one (isolate 68) displayed a mixture of 89M/V and the remaining two (66 and 84) displayed the wild-type codon 89M. Interestingly, when sequencing of these viral isolates was performed after the RVA (in the absence of drug selective pressure), isolates 68 and 78 had reverted their mutations at position 89 (V and I, respectively) to wild-type 89M. Alternatively, the wild-type variants could have been selected from viral mixtures containing both variants, becoming the prevalent variant in the mixture. Only viral isolates harbouring mutations A71T or T74S retained mutation 89I as a major variant after the RVA.

The susceptibility assay in the presence of PIs allowed the division of the six isolates of subtype G into three groups according to the observed results (Table 2). Group I was composed of isolates that retained mutation 89I in association with L90M. These isolates displayed borderline resistance to amprenavir, saquinavir or indinavir. The highest FCs were observed for ritonavir (8–10x), nelfinavir (17x for isolate 56 and 43x for isolate 65) and lopinavir (6–7x). Group II viruses, containing the wild-type 89M and the primary resistance mutation L90M, were four to six times more resistant to ritonavir and nelfinavir than the wild-type control. Additionally, one isolate of this group (78) also displayed borderline resistance to amprenavir. Group III viruses, harbouring 89M and no primary PI resistance mutations, were susceptible to all tested PIs. Hypersusceptibility to lopinavir was observed in isolates from groups II and III. These isolates were at least 10 times more susceptible than the wild-type control (Table 2). Subtype B isolate 273, harbouring major mutations M46I and L90M, was included as a positive control and presented the highest levels of resistance to all PIs.


View this table:
[in this window]
[in a new window]

 
Table 2. Susceptibility towards PI of PR-recombinant viruses

 

    Discussion
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 Funding
 Transparency declarations
 References
 
In the present study, we have shown phenotypic evidence for an alternative resistance profile to PIs for subtype G of HIV-1. Here, we have shown for the first time the reversion of mutation M89I/V or, alternatively, the selection of the wild-type virus from patients’ isolates in culture in the absence of PI drugs (Table 1). Interestingly, two isolates retained mutation M89I as the major variant. The genotype of these isolates showed A71T (for isolate 56) or T74S (for isolate 65). Both mutations have been recently correlated with resistance mutations M89I/V and L90M in subtypes C, F and G through Bayesian network analysis.5,6 On the basis of our results, we believe that the mutation 89I/V requires accessory mutations A71T and/or T74S for its stabilization in the viral genome, thereby confirming the Bayesian network results with in vitro phenotypic data.

A recent study by Abecasis et al.5 has shown the phenotypic role of mutation M89I/V in PI resistance for three non-B subtypes (C, F and G). Isolates of these subtypes were analysed together, describing mutation M89I/V as an accessory mutation of L90M in nelfinavir resistance. In our analyses, mutation L90M caused resistance to both nelfinavir and ritonavir in subtype G isolates. The presence of M89I together with L90M increased the resistance to both PIs and conferred resistance to other PI compounds (Table 2). A more detailed analysis of the isolates characterized in the work described by Abecasis et al.5 showed that subtype G isolates carrying 89I and 90L presented standard susceptibility levels to all PIs, evidencing that M89I is incapable of conferring resistance per se. Isolates containing 90M and wild-type 89M presented an average FC of 2.9 to ritonavir and 5.8 to nelfinavir, which corroborate our findings. Finally, isolates with 89I and 90M genotype presented increased resistance to ritonavir and nelfinavir and also to lopinavir.5 Resistance to nelfinavir (average FC of 15) was higher in those with 89I and 90M than in isolates with 90M alone, in agreement with our data. Finally, the acquisition of resistance to lopinavir was also evidenced in isolates with 89I and 90M (average FC of 3.3x) when compared with isolates with 90M alone (average FC of 1.3x). Additionally, we have observed hypersusceptibility to lopinavir in subtype G isolates, independent of mutation 90M. The hypersusceptible phenotype appears to be lost in the presence of 89I. The explanation for this natural hypersusceptibility remains unknown and needs to be further assessed, particularly because 89M is considered a resistance mutation for subtype B.10

With the dissemination of HAART around the developing world, drug resistance in non-B subtypes is a major concern and focus of study. We believe that the acquisition of the pathway M89I/L90M should be considered as primary resistance to ritonavir, nelfinavir and lopinavir for subtype G. Additionally, mutations 71V/T and 74S may stabilize the former mutations. Our results also confirm in vitro previous in silico observations of a connection between mutations 89I/V, A71T and T74S. Although nelfinavir is a first-generation PI compound and its use is increasingly reduced in Europe and worldwide, this study highlights the impact of HIV-1 genetic variability on susceptibility response to specific antiretrovirals.


    Funding
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 Funding
 Transparency declarations
 References
 
This work was supported by the Brazilian Research Council (grant 403589/2004-5), the Rio de Janeiro State Science Foundation (grant E-26/170-545/2004), the FWO-Vlaanderen (grant G.0266.04) and the Katholieke Universiteit Leuven (grant OT/04/43).


    Transparency declarations
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 Funding
 Transparency declarations
 References
 
None to declare.


    Acknowledgements
 
We are in debt to Thatiana M. Sousa (UFRJ) for technical assistance.


    References
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 Funding
 Transparency declarations
 References
 
1 Robertson DL, Anderson JP, Bradac JA, et al. HIV-1 nomenclature proposal. Science (2000) 288:55–6.[Medline]

2 Hemelaar J, Gouws E, Ghys PD, et al. Global and regional distribution of HIV-1 genetic subtypes and recombinants in 2004. AIDS (2006) 20:W13–23.[Web of Science][Medline]

3 Abecasis AB, Deforche K, Bacheler LT, et al. Investigation of baseline susceptibility to protease inhibitors in HIV-1 subtypes C, F, G and CRF02_AG. Antivir Ther (2006) 11:581–9.[Web of Science][Medline]

4 Kantor R, Katzenstein DA, Efron B, et al. Impact of HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype: results of a global collaboration. PLoS Med (2005) 2:e112.[CrossRef][Medline]

5 Abecasis AB, Deforche K, Snoeck J, et al. Protease mutation M89I/V is linked to therapy failure in patients infected with the HIV-1 non-B subtypes C, F or G. AIDS (2005) 19:1799–806.[Web of Science][Medline]

6 Deforche K, Camacho R, Grossman Z, et al. Bayesian network analysis of resistance pathways against HIV-1 protease inhibitors. Infect Genet Evol (2007) 7:382–90.[CrossRef][Web of Science][Medline]

7 Maschera B, Furfine E, Blair ED. Analysis of resistance to human immunodeficiency virus type 1 protease inhibitors by using matched bacterial expression and proviral infection vectors. J Virol (1995) 69:5431–6.[Abstract]

8 Hertogs K, De Bethune MP, Miller V, et al. A rapid method for simultaneous detection of phenotypic resistance to inhibitors of protease and reverse transcriptase in recombinant human immunodeficiency virus type 1 isolates from patients treated with antiretroviral drugs. Antimicrob Agents Chemother (1998) 42:269–76.[Abstract/Free Full Text]

9 Vermeiren H, Van Craenenbroeck E, Alen P, et al. Prediction of HIV-1 drug susceptibility phenotype from the viral genotype using linear regression modeling. J Virol Methods (2007) 145:47–55.[CrossRef][Web of Science][Medline]

10 Johnson VA, Brun-Vezinét F, Clotet B, et al. Update of the drug resistance mutations in HIV-1: Fall 2006. Top HIV Med (2006) 14:125–30.[Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Antimicrob ChemotherHome page
A. F. Santos, A. B. Abecasis, A.-M. Vandamme, R. J. Camacho, and M. A. Soares
Discordant genotypic interpretation and phenotypic role of protease mutations in HIV-1 subtypes B and G
J. Antimicrob. Chemother., March 1, 2009; 63(3): 593 - 599.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
61/6/1201    most recent
dkn099v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Gonzalez, L. M. F.
Right arrow Articles by Soares, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gonzalez, L. M. F.
Right arrow Articles by Soares, M. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?