JAC Advance Access originally published online on January 11, 2008
Journal of Antimicrobial Chemotherapy 2008 61(3):474-477; doi:10.1093/jac/dkm504
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Original research |
Helicobacter pylori amoxicillin heteroresistance due to point mutations in PBP-1A in isogenic isolates
1 Departamento de Microbiología, Parasitología e Inmunología, Facultad de Medicina, Universidad de Buenos Aires, Buenos Aires, Argentina 2 Servicio de Endoscopía, Hospital General de Agudos Juan A Fernández, Buenos Aires, Argentina 3 Servicio de Gastroenterología, Hospital Escuela ‘Don José de San Martín’ Facultad de Medicina, Buenos Aires, Argentina
* Correspondence address. Departamento de Microbiología, Facultad de Medicina, Universidad de Buenos Aires, Paraguay 2155, Piso 12 (1121), Buenos Aires, Argentina. Tel: +54-11-5950-9500-2181; E-mail: catalano{at}fmed.uba.ar
Received 19 September 2007; returned 27 November 2007; revised 8 October 2007; accepted 30 November 2007
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
Objectives: To investigate the Helicobacter pylori amoxicillin resistance rate, the occurrence of heteroresistance, and their related molecular mechanisms.
Methods: Eighty-seven H. pylori-positive patients were included: 45/87 with single biopsy and 42/87 with multiple biopsies. MICs were determined, and sequencing analysis of pbp1A gene and the variable regions of seven hop porins was performed in resistant and susceptible isolates. Clonal relationships were determined by lspA-glmM-RFLP and by random amplification of polymorphic DNA–PCR. An isogenic amoxicillin-susceptible isolate was transformed with pbp1A PCR products from the resistant isolates.
Results: Amoxicillin-resistant (MIC 2 mg/L) and amoxicillin-susceptible (MIC 0.06 mg/L) isolates, belonging to the same strain, were observed in different biopsies in one patient (inter-niche heteroresistance). Isolates from the remaining patients were amoxicillin-susceptible. Sequencing analysis of the pbp1A of two amoxicillin-resistant isolates and their susceptible partners revealed the same two point mutations: (i) in the third PBP motif of the resistant isolates (C1667G); (ii) a nonsense mutation at the 3' end of the gene. Replacement of pbp1A of a susceptible isolate by pbp1A from a resistant isolate increased the transformants MICs (2 mg/L). A similar MIC was observed when a pbp1A DNA fragment including both point mutations was transformed. Transfer of the smallest fragment (C1667G region only) yielded slightly lower MICs (0.5–1 mg/L). Identical hop gene sequences were observed in paired susceptible and resistant isolates.
Conclusions: A low resistance rate was observed. However, inter-niche heteroresistance could hinder amoxicillin resistance detection when only one biopsy is obtained. Alteration in PBP-1A seems to be enough to reach an MIC of 2 mg/L in our resistant isolates.
Keywords: beta-lactams , resistance , Gram-negative , bacilli
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
Amoxicillin is one of the first-line antimicrobial agents used for Helicobacter pylori eradication, and the emergence of resistant isolates may be related to treatment failure.1 The prevalence of H. pylori resistance to amoxicillin is very low (0.8% to 1.4%),1 except in Taiwan and Brazil, where 20% to 30% resistance has been reported.2,3 The investigation of amoxicillin resistance mechanisms has been frequently performed by transformation of susceptible strains with: (i) genomic DNA of clinical resistant isolates; (ii) PCR products of putative related genes of mutants generated in vitro by successive passage on plates containing amoxicillin.4,5 Resistance has been attributed to alterations in the penicillin-binding protein 1A (pbp1A) gene, even though the role of other genes cannot be excluded.4–6 It has also been demonstrated that amoxicillin-resistant isolates accumulated
40% less 14C-labelled penicillin G than equal numbers of amoxicillin-susceptible isolates, suggesting that porins such as HopA, HopB, HopC, HopD and HopE could be involved in the resistance.5 Comparison of the amino acid substitutions in PBP-1A and the Hop porin family between in vitro amoxicillin-resistant isolates and their susceptible parental counterparts suggested that changes in PBP-1A, HopB and HopC accounted for all the resistance mechanisms found.5 These results were confirmed by transformation analysis with the construction of a triple mutant possessing altered pbp1A and hop genes showing an amoxicillin MIC of 4 mg/L.5 Heteroresistance, defined as the co-existence of susceptible and resistant isolates in the same patient for the same antimicrobial agent, is a common phenomenon in the H. pylori population. Heteroresistance can be explained by: (i) mixed infection (unrelated isolates); or (ii) susceptible and resistant variants of the same strain. Heteroresistance in clonally related isolates has been described as either intra-niche (susceptible and resistant isolates are present in the same site of gastric mucosa) or inter-niche (susceptible and resistant isolates are located in different anatomic sites within the stomach).7 Inter-niche heteroresistance can lead to the underestimation of antimicrobial resistance because it is more difficult to detect resistance when it is not uniformly distributed in the stomach mucosa. It has been reported that the H. pylori population in a patient can be heterogeneous with respect to metronidazole, clarithromycin, tetracycline and ciprofloxacin susceptibility.7 To the best of our knowledge, amoxicillin heteroresistance has not been described in vivo. In this study, we investigated the amoxicillin resistance rate and the probable existence of heteroresistance in H. pylori-positive patients, with the aim to find susceptible and resistant isogenic isolates in order to analyse resistance mechanisms found in vivo.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
The study included 87 H. pylori-positive patients. By upper endoscopy, antral biopsies were obtained from 45 of 87 patients and multiple simultaneous biopsies (three from antrum and three from corpus) from the remaining 42 of 87 patients. All patients provided written consent and Human Research Committees of both participating hospitals approved this study. Biopsies were cultured as previously described.8 Amoxicillin resistance was identified by subculturing swabs of bacteria from isolation plates to horse blood agar plates with and without 0.5 mg/L amoxicillin. When growth was observed in amoxicillin-containing plates, intra-niche heteroresistance was investigated by expansion of single colonies from the whole population present in the plate without amoxicillin. MICs were determined as described by the CLSI.9 Antibiotic range was 0.015–64 mg/L, and 0.5 mg/L was considered as the MIC breakpoint. H. pylori ATCC 43504 was used as a quality control organism (MIC 0.03 mg/L).
DNA extraction and lspA-glmM-RFLP and random amplification of polymorphic DNA (RAPD)–PCR were performed, as described previously.8 For sequencing, the whole pbp1A gene was amplified using the following pairs of overlapping primers: (i) PBP-1F: TAGCCATTCTTATCGCTC and PBP-1R: CGACTAGCATGGTGATTT; (ii) PBP-2F: AACCGCAAGTTTAGGGTA and PBP-2R: GATCATGCTAGCGTTTAAGT; (iii) PBP-3F: ACGCGTCTAATGAAGATG and PBP-3R: GTGATGCTTTCAATGAGC; (iv) PBP-4F: GGGAGCTTTGCTATCTCA and PBP-4R: GTTCCTCGCTATCGTCTG. The variable regions of Hop family porin genes (hopA, hopB, hopC, hopD, hopE, hopV and hopX) were also amplified. The following primers were used, respectively: (i) HopA-F: AACAAACGGCCTCTAACAC and HopA-R: ATAGCTAGACCGGCTCACC; (ii) HopB-F: GCCGGCTTGTTAAACTCT and HopB-R: CTAGTGAATTCCTTAGCGCTC; (iii) HopC-F: GGCGTATCCCACGAAACT and HopC-R: TTGCACAGCGTTAGCTTGGTT; (iv) HopD-F: ATCAATAACGCAAGGG and HopD-R: CGATCTTGGATTGCTCTACG; (v) HopE-F: GGAGTGTTGTAGGTTGCCC and HopE-R: GCGAATAATCCCGTTTCA; (vi) HopV-F: TGGTGAATGACAACGGC TTG and HopV-R: CGCACATCAGCCTGTAAGGTG; (vii) HopX-F: GCAAACTTCTGCCATTCCCTT and HopX-R: AAACAAGACGATGCACCGC. All PCRs was carried out on paired susceptible and resistant isolates. Cycling comprised an initial denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 1 min, an annealing temperature of 53°C for 1 min (pbp1A, hopC, hopV and hopX) or 58°C for 1 min (hopA, hopB, hopD and hopE) and 72°C for 1 min, and a final extension of 72°C for 7 min. Amplified DNA was purified using Wizard-PCR Preps (Promega, Madison, WI, USA), according to the manufacturer's instructions. Sequencing was performed on both DNA strands, using an ABI 373 DNA sequencer (Applied Biosystems, SA, Argentina). The nucleotide sequences were analysed by BioEdit version 5.0.9 and the Blast program at the National Center for Biotechnology Information. The amino acid sequences were analysed by GeneDoc version 2.6.002. GenBank accession numbers for pbp-1A gene are EF583173–EF583174 and for the variable regions of the seven hop genes are EU146280–EU146293.
Transformation analyses were performed by natural competence and electroporation, as described by Wang et al.10 An amoxicillin-susceptible isogenic isolate was transformed with 200 ng of whole pbp1A gene amplified from a resistant isolate, or with 100–200 ng of DNA fragment amplified with primers PBP-4F and PBP-4R including the third pbp1A conserved motif region, or with 200 ng of the smallest DNA fragment of this conserved motif region, amplified with PBP-4F primer and PBP-4TR (TGAAATACGAATACACAGGCG). Transformants were selected on blood agar plates with 0.5 mg/L amoxicillin. As controls, bacteria were transformed with DNA from another amoxicillin-susceptible isolate, or TE (10 mM Tris–HCl, 1 mM EDTA) without DNA. MICs of transformants were determined, as described earlier.
|
Results and discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
In agreement with the low amoxicillin resistance observed worldwide, <1% of our patients showed amoxicillin resistance (1/87). Resistant isolates were recovered in 1 of the 42 patients with multiple biopsies, a 73-year-old male patient with peptic ulcer and failure of eradication treatment with clarithromycin/amoxicillin/omeprazole. In addition, resistance was not homogeneously found in the multiple biopsies; resistant isolates were only obtained from one of three antrum and from one of three corpus biopsies (MIC 2 mg/L). Instead, all isolates obtained from expanded single colonies of the remaining four biopsies showed an MIC of 0.06 mg/L. lspA-glmM and RAPD fingerprints demonstrated that resistant and susceptible isolates belonged to the same strain (Figure 1). Comparing the whole pbp1A sequence of two amoxicillin-resistant isolates with their susceptible partners, the same two differences were found. One of them was located in the third conserved penicillin-binding protein motif, where resistant isolates showed one point mutation (C1667G) resulting in a T556S shift (Figure 2). Gerrits et al.4 demonstrated that the replacement of the wild-type pbp1A gene of reference strain 26695 by the pbp1A gene of amoxicillin-resistant clinical isolates resulted in an increased MIC (<0.125 to 0.5–1 mg/L). Sequence analysis indicated that amino acid substitutions in or adjacent to the second (SKN402-404) and third (KTG555-557) conserved PBP-1A motifs mediated the resistance. Therefore, the KTG
KSG substitution in our isolates might be the cause of resistance. The other difference found between amoxicillin-susceptible and -resistant paired isolates was located at the 3' end of the gene representing a nonsense mutation (T1911G), which generated a stop codon resulting in a modified PBP-1A lacking the last 24 amino acids.
|
|
Co and Schiller5 suggested that high-level amoxicillin resistance (>0.5 mg/L) can be due to a combination of amino acid substitutions in PBP-1A and in porin proteins, because MICs of 4–8 mg/L were only observed in a triple mutant pbp1A/hopB/hopC obtained by transforming an amoxicillin-susceptible strain (MIC 0.06 mg/L). The analysis of variable regions of seven hop family porin genes in our paired amoxicillin-susceptible and -resistant isolates demonstrated that all sequences were identical. Additionally, HopD was shown to be a truncated protein in both isolates (GenBank accession numbers: EU146287 and EU146286). These results suggested that an altered PBP-1A may be the predominant cause of amoxicillin resistance in our isolates. Transformants with whole pbp1A replacement showed MIC increases from 0.06 to 2 mg/L. A similar increase was observed with the transfer of the DNA fragment from the third pbp1A-conserved motif region amplified with primers PBP-4F and PBP-4R. Transfer of the smallest DNA fragment containing point mutation C1667G only yielded transformants with slightly lower MICs (0.5–1 mg/L). Therefore, point mutation C1667G seems to be the principal cause of resistance. The nonsense mutation T1911G that creates a truncated PBP-1A might affect protein folding with an additional increase in MIC value.
Analysis of pbp1A and hop gene sequences in our paired susceptible and resistant isolates revealed that, except for the point mutations mentioned above, they were absolutely identical. This supports the results of lspA-glmM and RAPD and allows us to assert that the isolates are isogenic, indicating an inter-niche amoxicillin heteroresistance.
The presence of isogenic isolates implies that amoxicillin resistance emerged in vivo due to point mutations, probably through exposure to subinhibitory amoxicillin concentrations during eradication treatment.
In conclusion, our results indicated that pbp-1A point mutations are responsible for amoxicillin resistance. However, mutations in porin genes could contribute to MIC increases in other resistant isolates. In vivo inter-niche heteroresistance adds a new complexity in the detection of amoxicillin resistance when only one biopsy is obtained.
|
Funding |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
This study was supported by grants from UBACyT M016-Universidad de Buenos Aires.
|
Transparency declarations |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
None to declare.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionFundingTransparency declarationsReferences |
|---|
1 Megraud F, Lehours P. Helicobacter pylori detection and antimicrobial susceptibility testing. Clin Microbiol Rev (2007) 20:280–322.
2 Hu CT, Wu CC, Lin CY, et al. Resistance rate to antibiotics of Helicobacter pylori isolates in eastern Taiwan. J Gastroenterol Hepatol (2007) 22:720–3.[Web of Science][Medline]
3 Mendonca S, Ecclissato C, Sartori MS, et al. Prevalence of Helicobacter pylori resistance to metronidazole, clarithromycin, amoxicillin, tetracycline, and furazolidone in Brazil. Helicobacter (2000) 5:79–83.[CrossRef][Web of Science][Medline]
4 Gerrits MM, Godoy AP, Kuipers EJ, et al. Multiple mutations in or adjacent to the conserved penicillin-binding protein motifs of the penicillin-binding protein 1A confer amoxicillin resistance to Helicobacter pylori. Helicobacter (2006) 11:181–7.[CrossRef][Web of Science][Medline]
5
Co EM, Schiller NL. Resistance mechanisms in an in vitro-selected amoxicillin-resistant strain of Helicobacter pylori. Antimicrob Agents Chemother (2006) 50:4174–6.
6
Okamoto T, Yoshiyama H, Nakazawa T, et al. A change in PBP1 is involved in amoxicillin resistance of clinical isolates of Helicobacter pylori. J Antimicrob Chemother (2002) 50:849–56.
7 Kim JJ, Kim JG, Kwon DH. Mixed-infection of antibiotic susceptible and resistant Helicobacter pylori isolates in a single patient and underestimation of antimicrobial susceptibility testing. Helicobacter (2003) 8:202–6.[CrossRef][Web of Science][Medline]
8
Matteo MJ, Granados G, Perez CV, et al. Helicobacter pylori cag pathogenicity island genotype diversity within the gastric niche of a single host. J Med Microbiol (2007) 56:664–9.
9 Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Fifteenth Informational Supplement M100-S15 (2005) Wayne, PA, USA: CLSI.
10
Wang Y, Roos KP, Taylor DE. Transformation of Helicobacter pylori by chromosomal metronidazole resistance and by a plasmid with a selectable chloramphenicol resistance marker. J Gen Microbiol (1993) 139:2485–93.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  V. De Francesco, A. Zullo, E. Ierardi, F. Giorgio, F. Perna, C. Hassan, S. Morini, C. Panella, and D. Vaira Phenotypic and genotypic Helicobacter pylori clarithromycin resistance and therapeutic outcome: benefits and limits J. Antimicrob. Chemother., February 1, 2010; 65(2): 327 - 332. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||