JAC Advance Access originally published online on June 7, 2007
Journal of Antimicrobial Chemotherapy 2007 60(2):269-273; doi:10.1093/jac/dkm191
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Emergence and maintenance of resistance to fluoroquinolones and coumarins in Staphylococcus aureus: predictions from in vitro studies
Antimicrobial Research Centre and Research Institute of Molecular and Cellular Biology, University of Leeds, Leeds LS2 9JT, UK
* Corresponding author. Tel: +44-113-343-5604; Fax: +44-113-343-1407; E-mail: i.chopra{at}leeds.ac.uk
Received 19 January 2007; returned 16 April 2007; revised 28 April 2007; accepted 8 May 2007
| Abstract |
|---|
|
|
|---|
Objectives: Fluoroquinolones and coumarins interfere with the activity of bacterial type II topoisomerase enzymes. We examined the development of resistance to these agents in Staphylococcus aureus and determined the effect of simultaneous topoisomerase IV and DNA gyrase mutations on the biological fitness of the organism. This work aimed to gain insight into how such mutants might arise and survive in the clinical environment.
Methods: Spontaneous mutants resistant to fluoroquinolones and coumarins were selected in S. aureus. Resistance mutations were identified by DNA sequencing of PCR amplicons corresponding to the genes encoding topoisomerase IV and DNA gyrase. In vitro fitness of resistant mutants was compared with the antibiotic-susceptible progenitor strain using pair-wise competition assays.
Results: Mutants simultaneously resistant to both a fluoroquinolone and either of the coumarins, novobiocin or coumermycin A1, could not be recovered following a single-step selection. However, mutants concurrently resistant to both classes of antimicrobial could be generated by step-wise selections. These mutants demonstrated reductions in competitive fitness of up to 36%.
Conclusions: Dual-targeting of topoisomerase IV and DNA gyrase enzymes, for example with the combination of a fluoroquinolone and a coumarin agent, could minimize the emergence of resistance to these drugs in S. aureus. However, resistance-associated fitness costs may not be sufficient to limit the survival of mutants with dual resistance, if they arose in the clinical setting.
Keywords: antibacterial agents , mutation , fitness
| Introduction |
|---|
|
|
|---|
Fluoroquinolones interfere with the activity of the bacterial type II topoisomerase enzymes, DNA gyrase and topoisomerase IV (topo IV), with bactericidal consequences for the organism.1,2 In Staphylococcus aureus, fluoroquinolones act against both enzymes, although topo IV is usually the primary target.1,3 Coumarins, which are also bactericidal, disrupt the activity of DNA gyrase.4
Fluoroquinolones show good in vitro activity against S. aureus and are used clinically to treat staphylococcal infections.5 However, extensive use of these broad-spectrum agents has led to increased resistance in S. aureus.1 Nevertheless, it has been proposed that some of the newer fluoroquinolones could be useful in the treatment of infections caused by community-acquired methicillin-resistant S. aureus (CA-MRSA), since the causative strains are usually susceptible to these agents.6
The coumarins are a small group of antibiotics used in the treatment of some infections caused by staphylococci and in the elimination of methicillin-resistant staphylococci from nasal carriers.4,7 However, this class is relatively under-exploited and may have greater potential in the treatment of staphylococcal infections.
The treatment of infections caused by S. aureus, made increasingly difficult by resistance to antimicrobials, presents an enormous challenge and expense to healthcare systems throughout the world. Combination therapy is a well-recognized strategy for minimizing antibiotic resistance,8 effective because more than one mutational event is required to confer resistance. Increased use of agents in combination may be required in an attempt to delay emergence of antimicrobial resistance in S. aureus. Consequently, we have examined the development of resistance to DNA gyrase and topo IV inhibitors in S. aureus, effected by the combination of a fluoroquinolone and a coumarin agent.
Mutation frequencies to antibiotic resistance and fitness costs associated with resistance genotypes are key parameters that determine the emergence and survival of resistant strains among bacterial populations.9,10 These parameters can be estimated for antibiotic-resistant strains in vitro and used to predict how resistance may arise and be maintained in the clinical setting.9
In this work we selected S. aureus mutants with a spectrum of fluoroquinolone and coumarin resistance genotypes. We examined the frequency with which these mutants arose and their fitness in vitro. Our data may be useful in assessing the potential of fluoroquinolones and coumarins in combination for antistaphylococcal therapy.
| Materials and methods |
|---|
|
|
|---|
Bacterial strains, growth conditions, antibacterial agents and reagents
The mutants described in this work are derivatives of S. aureus SH1000.11 Strains were cultured aerobically at 37°C in Iso-Sensitest broth (ISB) or Iso-Sensitest agar (ISA). All antibacterial agents were purchased from Sigma-Aldrich (Poole, UK), with the exception of ciprofloxacin, which was a gift from Bayer AG (Leverkusen, Germany) and rufloxacin, which was a gift from Professor B. Oliva (University of L'Aquila, Italy).
Antibacterial susceptibility testing
MIC determinations were carried out by agar dilution, using inocula of 106 cfu/spot. MICs were defined as the lowest antibiotic concentration preventing visible bacterial growth after 18 h of incubation at 37°C.
Selection of antibiotic-resistant mutants and determination of mutation frequencies to resistance
Bacterial cultures, grown to saturation, were plated onto ISA selection plates containing antibiotic at 4 x MIC to recover resistant mutants. To determine viable counts, aliquots of diluted culture were also plated onto non-selective ISA. Colony counts were made after 24 h of incubation on non-selective media and after 48 h of incubation on selective media. Mutation frequencies were expressed as the number of antibiotic-resistant mutants recovered, as a fraction of the viable count. Where appropriate, bacterial cultures were concentrated by centrifugation to facilitate the recovery of resistant mutants.8
Detection of resistance mutations
Portions of the genes grlA, gyrA and gyrB were amplified by PCR, using the following oligonucleotide primers: grlA forward, 5'- CAGTCGGTGATGTTATTGGT; grlA reverse, 5'-CCTTGAATAA TACCACCAGT; gyrA forward, 5'-ATGGCTGAATTACCTCAATC; gyrA reverse, 5'-GTGTGATTTTAGTCATACGC; gyrB forward, 5'- TCAGATGTAAACAACACGGATAATTATGGT; and gyrB reverse, 5'-ATTATCTTCTATAAATTGTCTACGG. PCR amplicons were subjected to DNA sequencing by Lark Technologies (Takeley, Essex, UK).
Determination of bacterial fitness
Fitness costs associated with resistance mutations were determined by pair-wise competition of the resistant mutant with the drug-susceptible progenitor strain (SH1000), as previously described.12 Competition assays were repeated until standard deviation values of
5% were achieved.
| Results and discussion |
|---|
|
|
|---|
Selection of fluoroquinolone/coumarin-resistant mutants
Resistance to fluoroquinolones in S. aureus arises primarily by acquisition of mutations in the topo IV subunits, GrlA and GrlB, and DNA gyrase subunits, GyrA and GyrB (encoded by grlA, grlB, gyrA and gyrB respectively).13,14 Resistance to coumarins is due to amino acid substitutions in the ATP-binding site of GyrB.15
To obtain a collection of fluoroquinolone/coumarin-resistant mutants with a diverse spectrum of genotypes, mutants were isolated from several independent cultures. Spontaneous mutants were derived following selections with the fluoroquinolones norfloxacin, ciprofloxacin, ofloxacin and rufloxacin, and resistance mutations identified by PCR amplification and sequencing (data not shown). Since mutants selected with norfloxacin displayed all of the resistance genotypes seen following selections with the other fluoroquinolones, work was continued using norfloxacin alone to represent a prototypical fluoroquinolone.
Table 1 displays the frequencies with which mutants were recovered with coumermycin A1, novobiocin or norfloxacin (at 4 x MIC) from S. aureus SH1000, or from successive fluoroquinolone/coumarin-resistant derivatives. Mutation frequencies at which single-step coumarin-resistant mutants arose were similar to those for single-step fluoroquinolone-resistant mutants (
108). Second-step norfloxacin-resistant mutants were selected from single-step norfloxacin-resistant mutants at frequencies of
108 to 1010. Mutants were isolated with coumarins from single-step norfloxacin-resistant strains at a frequency of
108 to 1010 and from single-step coumarin-resistant strains with norfloxacin at a frequency of
107 to 108.
|
Second-step mutants could not be recovered from single-step GyrB mutants by direct plating onto agar containing coumarins (frequencies of < 1010). However, mutants could be recovered by exposing mid-log phase cultures to novobiocin or coumermycin A1 at 1 x MIC prior to selective plating.
High-level resistance to both fluoroquinolone and coumarin antimicrobials requires co-existent mutations in GrlA, GyrA and GyrB. The chance of mutants resistant to both agents arising in a parent population, in a single step, is extremely low; such mutants would be expected to occur at frequencies that are a product of the individual mutation frequencies to resistance (Table 1). Consequently, a combination of these drugs could be effective in preventing the emergence of resistance from fluoroquinolone- and coumarin-susceptible strains in the clinical setting. Indeed, no mutants were recovered (i.e. frequencies < 1011) when cultures of SH1000 or a clinical strain (CA-MRSA clone ST80-IV16,17) were plated onto media containing combinations of either coumermycin A1 and norfloxacin, or novobiocin and norfloxacin (both drugs present at selective concentrations of four times their respective MICs).
Characterization of fluoroquinolone/coumarin resistance genotypes
All mutants selected with coumermycin A1 or novobiocin carried GyrB mutations at amino acid residues (Table 2) that have been shown previously to participate in coumarin resistance (G85, D89, I102, R144 and T173).14,18 All single-step coumarin-resistant mutants generated in this study carried single amino acid changes in GyrB, which conferred
60-fold increases in resistance to the selecting coumarin. Two-step mutants carried two GyrB substitutions, which conferred further 48-fold increases in resistance. Mutants selected with coumermycin A1 generally carried GyrB mutations distinct from those found following selections with novobiocin (Table 2), an observation that is consistent with the findings of Fujimoto-Nakamura et al.14 This is likely to be due to differences in the molecular interactions between these drugs and the GyrB subunit.14
|
All GrlA and GyrA mutations observed in this work have previously been reported to confer quinolone resistance,19 with the exception of the GrlA A116V mutation seen in strain AV-34 (Table 2). First-step norfloxacin resistance-conferring mutations occurred exclusively in grlA and gave rise to 8-fold increases in norfloxacin resistance. Second-step mutations always occurred in gyrA and rendered the mutants a further 816 times more resistant to norfloxacin. These mutations reflect the spectrum of genetic polymorphisms described in quinolone-resistant clinical isolates of S. aureus, where grlA mutations are associated with low- and high-level quinolone resistance and combinations of grlA and gyrA mutations are associated with high-level quinolone resistance.1 The predominance of mutations at GrlA S80 and GyrA S84 in the mutants selected with norfloxacin is also reflective of quinolone resistance in the clinic.1
In vitro fitness of fluoroquinolone/coumarin-resistant mutants
Results reported above indicate that the probability of mutants simultaneously resistant to both fluoroquinolone and coumarin agents arising in a single step is low. Nevertheless, such mutants might occur in the clinical setting by step-wise mutation, particularly from strains already resistant to either class of agent. We therefore examined the in vitro fitness of the fluoroquinolone- and coumarin-resistant mutants described above, in order to predict how these resistance genotypes might survive in the clinical environment.
First-step norfloxacin-resistant mutants with grlA mutations (strains AV-1 to AV-4) did not exhibit significant fitness costs in vitro (Table 2); this may help to explain the prevalence of these resistance genotypes among clinical strains. Single coumarin resistance-determining gyrB mutations (strains AV-5 to AV-7) were similarly not associated with substantial reductions in fitness (Table 2). However, these single no-cost coumarin resistance mutations may be of little relevance in the clinical setting, as the resistance levels they conferred were below reported achievable drug serum concentrations (coumermycin A1: 1824 mg/L after a 100 mg dose given intravenously; novobiocin: 11 mg/L after a 250 mg oral dose).7,20
Two-step norfloxacin-resistant mutants (AV-8 to AV-10) carrying mutations in both grlA and gyrA did not show reductions in fitness (Table 2). This is consistent with the predominance of these mutational combinations in clinical isolates exhibiting high-level fluoroquinolone resistance.1 In contrast, strain AV-14, a two-step mutant selected with coumermycin A1, showed a considerable reduction in fitness (37%; Table 2). Two-step mutants selected with novobiocin (AV-11 to AV-13) did not display such marked decreases in fitness (Table 2). The double GyrB mutations involved in coumermycin A1 resistance may have a greater impact on ATP binding or on GyrB ATPase activity than those conferring resistance to novobiocin.
Mutants with concurrent resistance to norfloxacin and either coumarin agent showed some degree of impaired fitness in vitro (Table 2). Among these strains, AV-18 was the most fit (1% reduction in competitive fitness) and AV-32 was the least fit (36% reduction). Mutants with high-level resistance to both fluoroquinolones and coumarins, which could be relevant to therapeutic outcome (strains AV-25 to AV-27, AV-33 to AV-36; Table 2), showed reduced fitness (reductions of 9% to 23%). Other studies investigating fitness costs associated with antimicrobial resistance, although conducted with a different antibiotic class, suggest that resistant mutants exhibiting reductions in competitive fitness of 30% to 50% can arise and survive in the clinical environment.21,22 Hence the fitness costs that we observed in strains that were resistant to both fluoroquinolones and coumarins (
36%) may not be sufficient to diminish their persistence in the absence of antibiotic selection pressure.
Mutants simultaneously resistant to both fluoroquinolones and coumarins at high levels arise at very low frequencies in vitro and therefore might not be selected if these agents were used as combination therapy for infections caused by fluoroquinolone- and coumarin-susceptible S. aureus. However, selection of double mutants might be favoured in vivo if the pharmacokinetic behaviour of the two antimicrobial classes differed substantially.
Pharmacokinetic data for the two classes are broadly similar.7,20,23,24 Thus the two classes display comparable oral bioavailability, serum Cmax levels, plasma protein binding and plasma half-lives, and can be administered as twice-daily products. Consequently, simultaneous administration of both drug classes would likely result in the maintenance of balanced in vivo concentrations of both agents, thereby limiting selection of double mutants. Nevertheless, resistance-associated fitness costs might not be sufficient to limit the survival of mutants with dual resistance if they did arise in the clinical setting.
| Transparency declarations |
|---|
|
|
|---|
None to declare.
| Acknowledgements |
|---|
This work was supported by project grant number: GA483, awarded to I. Chopra by The British Society for Antimicrobial Chemotherapy.
| References |
|---|
|
|
|---|
1 Wang T, Tanaka M, Sato K. Detection of grlA and gyrA mutations in 344 Staphylococcus aureus strains. Antimicrob Agents Chemother (1998) 42:23640.
2 Drlica K, Hooper DC. Mechanisms of quinolone action. In: Quinolone Antimicrobial AgentsHooper DC, Rubinstein E, eds. (2003) ASM Press. 1940.
3
Takei M, Fukuda H, Kishii R, et al. Target preference of 15 quinolones against Staphylococcus aureus, based on antibacterial activities and target inhibition. Antimicrob Agents Chemother (2001) 45:35447.
4 Galm U, Dessoy MA, Schmidt J, et al. In vitro and in vivo production of new aminocoumarins by a combined biochemical, genetic, and synthetic approach. Chem Biol (2004) 11:17383.[CrossRef][ISI][Medline]
5
Trong HN, Prunier AL, Leclercq R. Hypermutable and fluoroquinolone-resistant clinical isolates of Staphylococcus aureus. Antimicrob Agents Chemother (2005) 49:2098101.
6 Shopsin B, Zhao X, Kreiswirth BN, et al. Are the new quinolones appropriate treatment for community-acquired methicillin-resistant Staphylococcus aureus? Int J Antimicrob Agents (2004) 24:324.[ISI][Medline]
7 Greenwood D. Miscellaneous antibacterial agents. In: Antibiotic and ChemotherapyFinch R, Greenwood D, Norby S, et al, eds. (2003) London: Churchill Livingstone. 40713.
8
O'Neill AJ, Cove JH, Chopra I. Mutation frequencies for resistance to fusidic acid and rifampicin in Staphylococcus aureus. J Antimicrob Chemother (2001) 47:64750.
9 Andersson DI. The biological cost of mutational antibiotic resistance: any practical conclusions? Curr Opin Microbiol (2006) 9:4615.[CrossRef][ISI][Medline]
10
Nilsson AI, Berg OG, Aspevall O, et al. Biological costs and mechanisms of fosfomycin resistance in Escherichia coli. Antimicrob Agents Chemother (2003) 47:28508.
11
Horsburgh MJ, Aish JL, White IJ, et al.
B modulates virulence determinant expression and stress resistance: characterization of a functional rsbU strain derived from Staphylococcus aureus 8325-4. J Bacteriol (2002) 184:545767.
12
Hurdle JG, O'Neill AJ, Chopra I. The isoleucyl-tRNA synthetase mutation V588F conferring mupirocin resistance in glycopeptide-intermediate Staphylococcus aureus is not associated with a significant fitness burden. J Antimicrob Chemother (2004) 53:1024.
13 Deplano A, Zekhnini A, Allali N, et al. Association of mutations in grlA and gyrA topoisomerase genes with resistance to ciprofloxacin in epidemic and sporadic isolates of methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother (1997) 41:20235.[Abstract]
14
Fujimoto-Nakamura M, Ito H, Oyamada Y, et al. Accumulation of mutations in both gyrB and parE genes is associated with high-level resistance to novobiocin in Staphylococcus aureus. Antimicrob Agents Chemother (2005) 49:38105.
15
Fournier B, Hooper DC. Mutations in topoisomerase IV and DNA gyrase of Staphylococcus aureus: novel pleiotropic effects on quinolone and coumarin activity. Antimicrob Agents Chemother (1998) 42:1218.
16
Faria NA, Oliveira DC, Westh H, et al. Epidemiology of emerging methicillin-resistant Staphylococcus aureus (MRSA) in Denmark: a nationwide study in a country with low prevalence of MRSA infection. J Clin Microbiol (2005) 43:183642.
17 Vandenesch F, Naimi T, Enright MC, et al. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg Infect Dis (2003) 9:97884.[ISI][Medline]
18 Stieger M, Angehrn P, Wohlgensinger B, et al. GyrB mutations in Staphylococcus aureus strains resistant to cyclothialidine, coumermycin, and novobiocin. Antimicrob Agents Chemother (1996) 40:10602.[Abstract]
19 Hooper DC. Mechanisms of quinolone resistance. In: Quinolone Antimicrobial AgentsHooper DC, Rubinstein E, eds. (2003) Washington: ASM Press. 4167.
20
Guillemin MN, Miles HM, McDonald MI. Activity of coumermycin against clinical isolates of staphylococci. Antimicrob Agents Chemother (1986) 29:60810.
21
Gagneux S, Long CD, Small PM, et al. The competitive cost of antibiotic resistance in Mycobacterium tuberculosis. Science (2006) 312:19446.
22
O'Neill AJ, Huovinen T, Fishwick CW, et al. Molecular genetic and structural modeling studies of Staphylococcus aureus RNA polymerase and the fitness of rifampin resistance genotypes in relation to clinical prevalence. Antimicrob Agents Chemother (2006) 50:298309.
23 Andriole VT. Quinolones. In: Antibiotic and ChemotherapyFinch R, Greenwood D, Norby S, et al, eds. (2003) London: Churchill Livingstone. 34973.
24 Dudley M. Pharmacokinetics of fluoroquinolones. In: Quinolone Antimicrobial AgentsHooper DC, Rubinstein E, eds. (2003) Washington: ASM Press. 11555.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Descloux, A. Rossano, and V. Perreten Characterization of New Staphylococcal Cassette Chromosome mec (SCCmec) and Topoisomerase Genes in Fluoroquinolone- and Methicillin-Resistant Staphylococcus pseudintermedius J. Clin. Microbiol., May 1, 2008; 46(5): 1818 - 1823. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Takano, W. Higuchi, T. Otsuka, T. Baranovich, S. Enany, K. Saito, H. Isobe, S. Dohmae, K. Ozaki, M. Takano, et al. Novel Characteristics of Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains Belonging to Multilocus Sequence Type 59 in Taiwan Antimicrob. Agents Chemother., March 1, 2008; 52(3): 837 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Vickers, I. Chopra, and A. J. O'Neill Intrinsic Novobiocin Resistance in Staphylococcus saprophyticus Antimicrob. Agents Chemother., December 1, 2007; 51(12): 4484 - 4485. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

