JAC Advance Access originally published online on October 24, 2006
Journal of Antimicrobial Chemotherapy 2007 59(6):1216-1222; doi:10.1093/jac/dkl426
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Special section: Efflux |
Altered spectrum of multidrug resistance associated with a single point mutation in the Escherichia coli RND-type MDR efflux pump YhiV (MdtF)
1 Center for Infectious Diseases and Travel Medicine, University Hospital D-79106 Freiburg, Germany 2 Pharmacy Service, University Hospital D-79106 Freiburg, Germany 3 Department of Medicine, Albert-Ludwigs-University D-79106 Freiburg, Germany
*Correspondence address. Medizinische Universitätsklinik, Hugstetter Strasse 55, D-79106 Freiburg, Germany. Tel: +49-761-270-1819; Fax: +49-761-270-1820; E-mail: kern{at}if-freiburg.de
Received 12 July 2006; returned 12 September 2006; accepted 25 September 2006
| Abstract |
|---|
|
|
|---|
Objectives: YhiV (MdtF) is an resistance nodulation division (RND) type efflux pump in Escherichia coli with significant homology to AcrB but usually expressed at a low level in clinical isolates. When overexpressed the pump confers decreased susceptibility to a variety of substances including erythromycin and ethidium bromide (EtBr). We characterized two mutants of E. coli E12 (
acrB
acrF) overexpressing yhiV that showed surprising differences in their spectrum of multidrug resistance (MDR).
Methods: The two mutants obtained after repeated exposure of E. coli E12 to levofloxacin were tested for antimicrobial susceptibility to a variety of agents and for intracellular accumulation of selected pump substrates. Gene expression was studied by quantitative RTPCR, and yhiV was sequenced. Gene inactivation and replacement were done by phage
-based homologous recombination.
Results: Mutant DKO20/1 overexpressed yhiV, showed a wild-type yhiV sequence and had >2-fold increased MICs of fluoroquinolones, novobiocin, macrolides/ketolides, EtBr, oxacillin and Phe-Arg-ß-naphthylamide (PAßN, a putative efflux pump inhibitor) compared with the E12 parent. A second mutant, strain DKO1/17 that had the Val-610
Phe point mutation in YhiV differed from DKO20/1 by faster growth, >2-fold increased MICs of linezolid and tetracycline, but >2-fold decreased MICs of PAßN, azithromycin and telithromycin. Inactivation of yhiV in DKO1/17 and reintroduction of the wild-type and mutant yhiV sequence confirmed that the differing MICs of most of the drugs were associated with the observed single point mutation. Intracellular drug accumulation studies with linezolid and PAßN were consistent with the MIC results.
Conclusions: The region around amino acid Val-610 in YhiV appears to be involved in determining recognition and efficiency of export of a number of MDR efflux pump substrates. This single point mutation in the periplasmic loop of the pump can increase resistance to a given drug such as a fluoroquinolone while decreasing resistance to another one.
Keywords: E. coli , fluoroquinolones , nosocomial pathogens
| Introduction |
|---|
|
|
|---|
Virtually all Gram-negative bacteria harbour genes for efflux pumps that belong to the resistance nodulation division (RND) family. These pumps are very effective in generating resistance against a variety of chemically diverse compounds including antibiotics, dyes and other xenobiotics, and there are many examples of multidrug resistance (MDR) in clinical isolates of Enterobacteriaceae, Pseudomonas aeruginosa and other non-fermenters associated with overexpression of RND-type pumps.13
In Escherichia coli, seven homologous RND-type pumps are known. Five of these [AcrB, AcrF, MdtB (YegN), MdtC (YegO), YhiV (MdtF)] are known to expel a large number of chemically unrelated compounds, whereas CusA (YbdE) and AcrD appear to have smaller spectra of substrate recognition. Most are not expressed or expressed at low level in clinical isolates. Only the tripartite AcrABTolC complex appears to be expressed constitutively at higher levels and contributes significantly to the intrinsic resistance of E. coli to a number of antibiotics. Acquisition of an MDR phenotype in E. coli has often been linked to AcrAB overexpression.2,46 In an AcrAB knockout background, mutants can be selected that overexpress AcrEF. Thereby, an MDR phenotype is created that is similar to that seen with strains overexpressing AcrAB.79 Whether mutants with overexpression of other MDR efflux systems might be selected from AcrAB/AcrEF double knockout strains has not been investigated. One candidate among RND-type pumps is the transmembrane heteromultimer MdtB/MdtC that confers novobiocin and low-level norfloxacin resistance and is regulated by the response regulator BaeR which also up-regulates AcrD.1012 Another candidate, YhiUV, is regulated by the two-component system EvgAS.13 YhiUV cooperates with TolC and is able to expel mammalian steroid hormones, ethidium bromide (EtBr), doxorubicin and erythromycin, among others.11,1316 It has also been shown to be responsive to iron starvation.17
We performed mutant selection experiments with the E. coli
acrB
acrF strain E12 which is hypersusceptible to many drugs. After repeated exposure of E12 to levofloxacin we obtained two mutant strains that had increased yhiV expression but showed different MDR phenotypes. Here, we show that a point mutation in yhiV detected in one of the two mutants was associated with some of the differences in the MDR phenotypes of the two mutants. This mutation while conferring decreased susceptibility to a given drug led to increased susceptibility to others.
| Materials and methods |
|---|
|
|
|---|
Bacterial strains and growth conditions
E. coli strains were grown in LuriaBertani (LB) medium. The strains, derived from E. coli K-12 strain AG100 that were used in this study are listed in Table 1.5,18 The
acrB
acrF strain E12 was exposed to increasing concentrations of levofloxacin (Sanofi-Aventis, Berlin, Germany) in a stepwise manner. Two mutants, DKO1/17 and DKO20/1 that differed from each other in their MDR phenotype were isolated.
|
Susceptibility testing
The MICs of a panel of antimicrobial agents, dyes and the putative efflux pump inhibitors phenyl-arginine-ß-naphthylamide (PAßN) and 1-(1-naphthylmethyl)-piperazine (NMP) were determined in 96-well microtitre plates as described.18 Briefly, bacterial strains were incubated overnight at 37°C in a volume of 100 µL of LB broth at a final inoculum of 5 x 105 cfu/mL. Susceptibility tests with LB both gave similar results as those obtained with MuellerHinton broth (MHB) with the exception of MIC values for clarithromycin that were consistently one doubling dilution lower in MHB. The tests were done at least in triplicate and included in all runs E. coli ATCC 25922 as quality control strain.
Intracellular accumulation of PAßN and linezolid
The intracellular accumulation of PAßN was estimated by measuring ß-naphthylamine (ß-NA). PAßN is cleaved by intracellular esterases upon entering the cell to yield the highly fluorescent metabolite ß-NA, the production of which can be measured spectrofluorometrically. Cells were grown overnight on LB agar plates and were diluted in PBS/0.4% glucose (pH 7.4) solution to an OD600 of 1. The cells were placed on a 96-well plate in a Safire (Tecan, Crailsheim, Germany) fluorescence plate reader, and PAßN was added at a final concentration (unless otherwise indicated) of 200 µM. The relative fluorescence intensity (excitation, 320 nm; emission, 460 nm; bandwidth, 5 nm) was measured at 2 min intervals.
For the measurement of cell-associated linezolid we used an HPLC/MS assay. Briefly, cells were grown in 200 mL of LB broth at 37°C to an optical density (OD600 nm) of 0.5, centrifuged at 4000 rpm, washed twice in 50 mM PBS (pH 7.0) and resuspended in 7 mL of PBS/0.2% glucose to an OD600 of 1. After 10 min at 37°C, linezolid was added at a final concentration of 20 mg/L. At timed intervals, 1 mL samples were removed, centrifuged at 13 000 rpm for 5 min at 4°C through silicone oil and the pellet was resuspended in 0.1 M glycine hydrochloride (pH 3.0) in a volume of 300 µL. After overnight incubation at room temperature, samples were centrifuged at 13 000 rpm for 10 min at 4°C. Aliquots of supernatant were used to measure the amount of released linezolid by HPLC/MS as described previously.19 All experiments were done at least in duplicate.
Molecular biology techniques
Standard techniques were used. PCR was performed with Taq DNA polymerase (Eppendorf, Hamburg, Germany). The TripleMaster PCR system (Eppendorf, Hamburg, Germany) was used for generating PCR products for homologous recombination. The BigDye version 2.0 Terminator kit (Applied Biosystems) was used for performing the sequencing reactions that were analysed with the MegaBACE500 sequencer (Amersham Biosciences, Freiburg, Germany). In all cases, two independent PCR products were sequenced on both strands. The entire yhiV nucleotide sequence of the original strain and the two mutants was determined. The quinolone-determining resistance regions of gyrA and parC were PCR amplified using previously described primers.20
Gene inactivation and allele replacement
Gene inactivation was done by the insertion of a spectinomycin resistance cassette into DKO1/17, employing a phage
-based homologous recombination system (GeneBridges, Dresden, Germany).21,22 Briefly, a spectinomycin resistance cassette (aad9 gene) from pEU32723 was introduced into the yhiV gene using pSC101-BAD-gbaA as supporting plasmid provided with the Red/ET counter selection kit, leading to the triple knockout (
acrB
acrF
yhiV ) strain TKO.
The cassette was replaced by an HPLC-purified oligonucleotide (Thermo Electron GmbH, Ulm, Germany) containing a point mutation G
T at nucleotide position 1828 of yhiV resulting in amino acid exchange of valine to phenylalanine. The sequence of the PCR product was as follows (part of homology arms given in boldface, exchanged nucleotide at position 1828 underlined): 5'-GTGACGGATTATTATCTGACTAAAGAGAAAGATAATGTCCAGTCGGTGTTTACCGTTGGCGGCTTTGGCTTCAGCGGTCAGGGGCAAAACAACGGCCTGGCGTTTATCAGTCTCAAGCCGTGGTCTGAA-3'. To reintroduce into DKO1/17 the wild-type yhiV sequence, a PCR product from yhiV of AG100 as template was used for homologous recombination. 5'-AGGTGACGGATTATTATCTGACT-3' served as forward and 5'-TTTTCCTCACCGACACGTTCAGAC-3' as reverse primer. The homologous recombination was confirmed by PCR and DNA sequencing of the yhiV gene.
RNA isolation, preparation of cDNA, and quantitative RTPCR
The level of gene expression was estimated by quantitative RTPCR (qRTPCR). Briefly, total RNA from late logarithmic growth phase cultures was obtained with the RNeasy mini kit (QIAGEN, Hilden, Germany). RNA concentration was determined photometrically. Purified RNA was then used for one-step reverse transcription and real-time PCR amplification using the QuantiTect SYBR green reverse transcription-PCR kit (QIAGEN, Hilden, Germany) in the LightCycler (Roche, Mannheim, Germany). gapA expression was used to normalize expression ratios that were calculated with the REST proGramme.24 In all cases, the mean values of mRNA expression obtained in two or three experiments with duplicate measurements each were considered. The primer sequences used in the gene expression studies are given in Table 2.
|
Protein modelling
The three-dimensional structure of YhiV was modelled by submitting the amino acid sequence of YhiV to the SWISS-MODEL server25 using the crystal structure of the homologous RND transporter AcrB26 as a template. The hypothetical YhiV structure was visualized using the PyMOL software available at http://pymol.sourceforge.net.
| Results |
|---|
|
|
|---|
Both mutants were obtained from E. coli E12 after several selection steps with increasing concentrations of levofloxacin. Both had identical QRDR mutations in gyrA and parC (data not shown) and showed greatly increased yhiUV expression according to qRTPCR when compared with E12 (Table 2), with expression ratios (mutant versus parent, normalized for gapA) of
500 (DKO1/17) or even higher (DKO20/1). The two clones differed in growth and MDR phenotype. DKO1/17 grew faster than DKO20/1 (data not shown) and was more resistant to linezolid (16-fold) and tetracycline (4-fold) but was less resistant to PAßN, azithromycin and telithromycin (all 4-fold) when compared with DKO20/1 (Table 3). Intracellular drug accumulation studies with PAßN (increased in DKO1/17) were consistent with the results for the differing MICs of PAßN (Figure 1) while the accumulation of linezolid was only minimally decreased in DKO1/17 (Figure 2) despite MICs of linezolid differing between the two clones by 16-fold.
|
|
|
We determined the expression of a number of genes other than yhiUV. As shown in Table 2 evgA expression in the two strains was higher than in the parental strain E12, which is consistent with earlier reports showing that YhiUV is under the control of the EvgAS two component signal system.13,15,16 Other minor differences between the two strains were noted. For example, expression of soxS, the activator of the superoxide SoxRS regulon,27 was higher in DKO1/17 than in DKO20/1, and emrAB was more down-regulated in DKO20/1 than in DKO1/17. However, by this limited screening no differences in gene expression were found between the two mutant strains that could easily explain the observed differences in drug susceptibility. Sequencing of the whole yhiV gene revealed a point mutation (G
T) at nucleotide position 1828 resulting in an amino acid residue exchange from valine to phenylalanine at position 610. According to a search in the GenBank nucleotide database residue Val-610 appears to be conserved among many RND-type pumps (data not shown), and is situated in a depression area of the periplasmic loop of YhiV. AcrB template-based modelling indicated a pocket-like structure around residue Val-610 (Figure 3). This suggested that this amino acid residue may be part of a putative substrate binding site and that some of the differences in the MDR phenotype in the two clones might be related to this mutation in the YhiV pump.
|
To test this hypothesis we inactivated YhiV in DKO1/17 to obtain strain TKO, which was hypersusceptible to many test drugs (Table 3) but showed the same growth rate as DKO1/17 (data not shown). We then reintroduced into TKO both wild-type and mutant sequences of yhiV and obtained strains TKORYWT and TKORYMUT, respectively. Drug susceptibility studies confirmed that the YhiV point mutation Val-610
Phe in TKORYMUT conferred increased resistance against linezolid (16-fold increased MIC), tetracycline and some fluoroquinolones (4-fold) and decreased resistance to PAßN, azithromycin and clarithromycin (all 4-fold), but not telithromycin (Table 3). Addition of PAßN or NMP restored the susceptibility of both strains to the level of TKO with the exception of NMP, oxacillin and clarithromycin (Table 3). YhiV, thus, was susceptible to inhibition by both compounds, similar to AcrAB and AcrEF.28 Some other differences in drug susceptibility between TKORYWT and mutant strain TKORYMUT were noted but these were small (2-fold) (Table 3). Although their significance is uncertain they were reproducible, and the observed tendency (regarding, for example, erythromycin and the fluoroquinolones) was consistent with the (larger) differences between the two strains noted for other members of the same drug classes.
The finding of increased resistance of TKORYMUT against linezolid and decreased resistance to PAßN associated with the Val-610
Phe mutation was corroborated by the results of the drug accumulation studies in the two strains. TKORYMUT accumulated more PAßN (Figure 1) but less linezolid (Figure 2) than TKORYWT. The fact that TKO accumulated more linezolid than DKO20/1 and TKORYWT indicated that the YhiUV system may provide some basic linezolid binding but no transport sufficient to significantly alter the MIC of the drug.
| Discussion |
|---|
|
|
|---|
The YhiUV/TolC efflux system has been reported to confer decreased susceptibility to steroids including deoxycholate, to acriflavin, rhodamine G, SDS, EtBr and to erythromycin.13,14,29 We have shown that this list also now includes PAßN, novobiocin, clindamycin, chloramphenicol, pyronin Y, newer macrolides and fluoroquinolones, and to some extent linezolid, but not NMP. The Val-610
Phe mutation of YhiV identified in the mutant strain DKO1/17 and obtained after repeated exposure to a fluoroquinolone was associated with enhanced resistance against linezolid and newer fluoroquinolones presumably through more efficient efflux of these substances out of the bacterial cell. Whilst the
acrB
acrF background is somewhat artificial the observation of fluoroquinolone exposure linked not only with pump overexpression but also with a gain-of-function pump mutation is intriguing, as pump mutations that improve drug efflux could also occur in commonly expressed pumps such as AcrB among clinical isolates. Notably, the relatively small reductions in fluoroquinolone susceptibility linked to the mutation in the periplasmic loop of the pump were associated with more pronounced and opposite changes in the MICs of several non-fluoroquinolone substances. Single mutations in an efflux pump and associated changes in pump substrate profiles have been reported previously for other multidrug transporters.3034 Mutations affecting substrate specificity of RND-type multidrug efflux pumps have been studied in some detail. There is evidence from crystal structure analysis,26 mutational analysis and co-crystallization studies that substrates bind in the central cavity,35,36 and mutations apparently determining substrate specificity of RND-type multidrug efflux pumps have also been mapped to the periplasmic loop of AcrB, MexB and MexD (P. aeruginosa), and EmhABC (P. fluorescens), similar to the mutation in YhiV described here.3641 Some of these mutations possibly affect the tertiary structure or proteinprotein interactions within the efflux complex and thereby modulated the substrate profile. Other mutations are thought to provide additional substrate binding sites relevant for recognition of a substrate, capture and passing it on to the central cavity. Indeed, it is likely that the periplasmic domain contains multiple sites of interaction for structurally dissimilar compounds, and therefore, single mutations may not necessarily have large effects on resistance.
Single mutations leading to a loss of substrate recognition on one hand and leading to improved binding and transport of another substrate on the other hand is unusual. Such opposite effects associated with a single mutation were first reported for the Bacillus subtilis transporter BmrR.32 More recently, Mao et al.39 analysed mutations in MexD of P. aeruginosa resulting from exposure to carbenicillin. One of the described mutations, Glu-89
Lys mapping to the periplasmic loop, was associated with a 16-fold increased MIC of carbenicillin, but an 8-fold decreased MIC of azithromycin and a negative impact on the transport of EtBr and pyronin Y. Our report of a mutation in the periplasmic loop of YhiV is the second one describing such a phenomenon in an RND-type MDR efflux pump. Interestingly, macrolides were the drug class affected in the opposite direction in both our work and the study by Mao et al.39
The pocket-like structure around residue Val-610 that was predicted by protein modelling is surrounded by several phenylalanine residues (Figure 3) that could be responsible for hydrophobic interactions with substrates on the pocket walls while interactions with polar or charged amino acids could occur with residues located just outside this pocket. The pocket-like structure appears to be connected through a small opening to a neighbouring cavity that, interestingly, has been recently described by crystallography as the binding pocket of PAßN in AcrB.36 It is conceivable that the latter pocket provides binding sites for other substrates, and that both pockets provide consecutive binding and enable moving of a given substrate. How exactly the change in selected substrate recognition and/or transport efficiency associated with the Val-610
Phe mutation is caused is unknown. A possible explanation may be increased hydrophobic interactions or increased steric hindrance since this residue forms part of the roof in the back of the pocket. It will be interesting and necessary to study the effects of a similar mutation in AcrB or AcrF. We hope that this will improve our understanding of where and how various substrates interact with RND pump protein complexes.
| Transparency declarations |
|---|
|
|
|---|
None to declare.
| Acknowledgements |
|---|
This study was supported by grant BMBF 01KI9951 from the German Federal Ministry of Education and Research.
| References |
|---|
|
|
|---|
1 Li XZ, Nikaido H. Efflux-mediated drug resistance in bacteria. Drugs (2004) 64:159204.[CrossRef][Web of Science][Medline]
2
Piddock LJ. Clinically relevant chromosomally encoded multidrug resistance efflux pumps in bacteria. Clin Microbiol Rev (2006) 19:382402.
3
Poole K. Efflux-mediated antimicrobial resistance. J Antimicrob Chemother (2005) 56:2051.
4
Kern WV, Oethinger M, Jellen-Ritter AS, et al. Non-target gene mutations in the development of fluoroquinolone resistance in Escherichia coli. Antimicrob Agents Chemother (2000) 44:81420.
5
Mazzariol A, Tokue Y, Kanegawa TM, et al. High-level fluoroquinolone-resistant clinical isolates of Escherichia coli overproduce multidrug efflux protein AcrA. Antimicrob Agents Chemother (2000) 44:34413.
6
Wang H, Dzink-Fox JL, Chen M, et al. Genetic characterization of highly fluoroquinolone-resistant clinical Escherichia coli strains from China: role of acrR mutations. Antimicrob Agents Chemother (2001) 45:151521.
7
Jellen-Ritter AS, Kern WV. Enhanced expression of the multidrug efflux pumps AcrAB and AcrEF associated with insertion element transposition in Escherichia coli mutants selected with a fluoroquinolone. Antimicrob Agents Chemother (2001) 45:146772.
8
Webber MA, Talukder A, Piddock LJ. Contribution of mutation at amino acid 45 of AcrR to acrB expression and ciprofloxacin resistance in clinical and veterinary Escherichia coli isolates. Antimicrob Agents Chemother (2005) 49:43902.
9
Lau SY, Zgurskaya HI. Cell division defects in Escherichia coli deficient in the multidrug efflux transporter AcrEF-TolC. J Bacteriol (2005) 187:781525.
10
Baranova N, Nikaido H. The baeSR two-component regulatory system activates transcription of the yegMNOB (mdtABCD) transporter gene cluster in Escherichia coli and increases its resistance to novobiocin and deoxycholate. J Bacteriol (2002) 184:416876.
11
Hirakawa H, Nishino K, Yamada J, et al. Beta-lactam resistance modulated by the overexpression of response regulators of two-component signal transduction systems in Escherichia coli. J Antimicrob Chemother (2003) 52:57682.
12
Nagakubo S, Nishino K, Hirata T, et al. The putative response regulator BaeR stimulates multidrug resistance of Escherichia coli via a novel multidrug exporter system, MdtABC. J Bacteriol (2002) 184:41617.
13
Nishino K, Yamaguchi A. EvgA of the two-component signal transduction system modulates production of the YhiUV multidrug transporter in Escherichia coli. J Bacteriol (2002) 184:231923.
14
Elkins CA, Mullis LB. Mammalian steroid hormones are substrates for the major RND- and MFS-type tripartite multidrug efflux pumps of Escherichia coli. J Bacteriol (2006) 188:11915.
15
Masuda N, Church GM. Escherichia coli gene expression responsive to levels of the response regulator EvgA. J Bacteriol (2002) 184:622534.
16
Nishino K, Inazumi Y, Yamaguchi A. Global analysis of genes regulated by EvgA of the two-component regulatory system in Escherichia coli. J Bacteriol (2003) 185:266772.
17
Bleuel C, Grosse C, Taudte N, et al. TolC is involved in enterobactin efflux across the outer membrane of Escherichia coli. J Bacteriol (2005) 187:67017.
18
Kern WV, Steinke P, Schumacher A, et al. Effect of 1-(1-naphthylmethyl)-piperazine, a novel putative efflux pump inhibitor, on antimicrobial drug susceptibility in clinical isolates of Escherichia coli. J Antimicrob Chemother (2006) 57:33943.
19 Ehrlich M, Trittler R, Daschner FD, et al. A new and rapid method for monitoring the new oxazolidinone antibiotic linezolid in serum and urine by high performance liquid chromatography-integrated sample preparation. J Chromatogr B Biomed Sci Appl (2001) 755:3737.[CrossRef][Medline]
20
Oethinger M, Kern WV, Jellen-Ritter AS, et al. Ineffectiveness of topoisomerase mutations in mediating clinically significant fluoroquinolone resistance in Escherichia coli in the absence of the AcrAB efflux pump. Antimicrob Agents Chemother (2000) 44:103.
21
Muyrers JP, Zhang Y, Testa G, et al. Rapid modification of bacterial artificial chromosomes by ET-recombination. Nucleic Acids Res (1999) 27:15557.
22 Zhang Y, Buchholz F, Muyrers JP, et al. A new logic for DNA engineering using recombination in Escherichia coli. Nature Genet (1998) 20:1238.[CrossRef][Web of Science][Medline]
23
Eichenbaum Z, Federle MJ, Marra D, et al. Use of the lactococcal nisA promoter to regulate gene expression in Gram-positive bacteria: comparison of induction level and promoter strength. Appl Environ Microbiol (1998) 64:27639.
24
Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res (2002) 30:e36.
25
Schwede T, Kopp J, Guex N, et al. SWISS-MODEL: An automated protein homology-modeling server. Nucleic Acids Res (2003) 31:33815.
26 Murakami S, Nakashima R, Yamashita E, et al. Crystal structure of the bacterial multidrug efflux transporter AcrB. Nature (2002) 419:58793.[CrossRef][Medline]
27
Amabile-Cuevas CF, Demple B. Molecular characterization of the soxRS genes of Escherichia coli: two genes control a superoxide stress regulon. Nucleic Acids Res (1991) 19:447984.
28
Bohnert JA, Kern WV. Selected arylpiperazines are capable of reversing multidrug resistance in Escherichia coli overexpressing RND efflux pumps. Antimicrob Agents Chemother (2005) 49:84952.
29
Nishino K, Yamaguchi A. Analysis of a complete library of putative drug transporter genes in Escherichia coli. J Bacteriol (2001) 183:580312.
30 Frelet A, Klein M. Insight in eukaryotic ABC transporter function by mutation analysis. FEBS Lett (2006) 580:106484.[CrossRef][Web of Science][Medline]
31
Paulsen IT, Brown MH, Skurray RA. Characterization of the earliest known Staphylococcus aureus plasmid encoding a multidrug efflux system. J Bacteriol (1998) 180:34779.
32
Klyachko KA, Schuldiner S, Neyfakh AA. Mutations affecting substrate specificity of the Bacillus subtilis multidrug transporter Bmr. J Bacteriol (1997) 179:218993.
33
Adler J, Bibi E. Determinants of substrate recognition by the Escherichia coli multidrug transporter MdfA identified on both sides of the membrane. J Biol Chem (2004) 279:895765.
34 Mazurkiewicz P, Driessen AJ, Konings WN. Energetics of wild-type and mutant multidrug resistance secondary transporter LmrP of Lactococcus lactis. Biochim Biophys Acta (2004) 1658:25261.[Medline]
35
Yu EW, McDermott G, Zgurskaya HI, et al. Structural basis of multiple drug-binding capacity of the AcrB multidrug efflux pump. Science (2003) 300:97680.
36
Yu EW, Aires JR, McDermott G, et al. A periplasmic drug-binding site of the AcrB multidrug efflux pump: a crystallographic and site-directed mutagenesis study. J Bacteriol (2005) 187:680415.
37
Fujihira E, Tamura N, Yamaguchi A. Membrane topology of a multidrug efflux transporter, AcrB, in Escherichia coli. J Biochem (Tokyo) (2002) 131:14551.
38
Hearn EM, Gray MR, Foght JM. Mutations in the central cavity and periplasmic domain affect efflux activity of the resistance-nodulation-division pump EmhB from Pseudomonas fluorescens cLP6a. J Bacteriol (2006) 188:11523.
39 Mao W, Warren MS, Black DS, et al. On the mechanism of substrate specificity by resistance nodulation division (RND)-type multidrug resistance pumps: the large periplasmic loops of MexD from Pseudomonas aeruginosa are involved in substrate recognition. Mol Microbiol (2002) 46:889901.[CrossRef][Web of Science][Medline]
40
Middlemiss JK, Poole K. Differential impact of MexB mutations on substrate selectivity of the MexAB-OprM multidrug efflux pump of Pseudomonas aeruginosa. J Bacteriol (2004) 186:125869.
41
Murakami S, Tamura N, Saito A, et al. Extramembrane central pore of multidrug exporter AcrB in Escherichia coli plays an important role in drug transport. J Biol Chem (2004) 279:37438.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. Wehmeier, S. Schuster, E. Fahnrich, W. V. Kern, and J. A. Bohnert Site-Directed Mutagenesis Reveals Amino Acid Residues in the Escherichia coli RND Efflux Pump AcrB That Confer Macrolide Resistance Antimicrob. Agents Chemother., January 1, 2009; 53(1): 329 - 330. [Full Text] [PDF] |
||||
![]() |
J. A. Bohnert, S. Schuster, M. A. Seeger, E. Fahnrich, K. M. Pos, and W. V. Kern Site-Directed Mutagenesis Reveals Putative Substrate Binding Residues in the Escherichia coli RND Efflux Pump AcrB J. Bacteriol., December 15, 2008; 190(24): 8225 - 8229. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




