JAC Advance Access originally published online on March 1, 2007
Journal of Antimicrobial Chemotherapy 2007 59(5):841-847; doi:10.1093/jac/dkm030
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Interspecies spread of CTX-M-32 extended-spectrum ß-lactamase and the role of the insertion sequence IS1 in down-regulating blaCTX-M gene expression
1 Servicio de Microbiología-Unidad de Investigación, Complejo Hospitalario, Universitario Juan Canalejo, La Coruña, Spain 2 Laboratorio de Microbiología, Hospital S. Rafael, La Coruña, Spain
* Corresponding author. Tel: +34-981-178359; Fax: +34-981-178216; E-mail: germanbou{at}canalejo.org
Received 31 October 2006; returned 21 November 2006; revised 24 January 2007; accepted 24 January 2007
| Abstract |
|---|
|
|
|---|
Objectives: To characterize the extended-spectrum ß-lactamases (ESBLs) as well as their genetic environment in different isolates of Enterobacteriaceae from a patient with repeated urinary tract infections.
Methods: Two isolates of Escherichia coli and one Proteus mirabilis, all with ESBL phenotypes, were studied. Conjugation experiments and restriction fragment length polymorphisms (RFLPs) were performed. Cloning of the bla genes was by plasmid restriction and fragments ligation. Antibiotic susceptibility testing was by Etest. The genetic environment was analysed by direct sequencing of the DNA surrounding the bla gene. RTPCR was performed to study the differences in the blaCTX-M gene expression.
Results: The bla gene was transferred by conjugation from the three clinical isolates, which by RFLP showed the same plasmid. The bla gene and surrounding sequences were cloned, an
9 kbp AccI fragment was sequenced and the blaCTX-M-32 gene was identified. The MICs of ceftazidime for transconjugants and transformants bearing the blaCTX-M-32 gene were lower than those previously reported. Analysis of the DNA surrounding the ESBL gene revealed a new genetic structure with two insertion sequences, IS5 and IS1, located immediately upstream of the blaCTX-M-32 gene; IS1 was located between the bla gene and IS5, and within the 10 and 35 promoter boxes of the blaCTX-M-32 gene. Microbiological and biochemical studies revealed lower blaCTX-M-32 gene expression in bacterial isolates with IS1 between the promoter boxes.
Conclusions: Data suggest putative in vivo horizontal blaCTX-M-32 gene transfer between two different genera of Enterobacteriaceae. A new complex structure, IS5IS1, was detected upstream of the bla gene and IS1 negatively modulated expression of the blaCTX-M-32 gene because its location modified the bla promoter region.
Keywords: in vivo spreading , interspecies dissemination , ESBL expression
| Introduction |
|---|
|
|
|---|
The production of ß-lactamases is the predominant cause of resistance to ß-lactam antibiotics in Gram-negative bacteria.1 The ß-lactamases are classified, according to the scheme of Ambler,2 into four classes, designated A to D, on the basis of their amino acid sequences. Another classification scheme is that of Bush et al.,3 in which representative ß-lactamases belonging to all molecular classes are described with separation into groups primarily on the basis of published functional characteristics. According to this classification scheme, class A extended-spectrum ß-lactamases (ESBLs) are included in group 2be of the scheme of Bush et al.3 They are mainly encoded by transferable plasmids, exhibit extended-spectrum activities, are capable of hydrolysing some broad-spectrum cephalosporins and are susceptible to clavulanic acid.
The CTX-M-type ß-lactamases represent a rapidly emerging group with a typical phenotype of ESBL resistance, but are not TEM or SHV derivatives.4 The CTX-M ß-lactamases are probably the most widespread ESBLs at present.4 In the past few years, ESBLs of the CTX-M type have been increasingly reported in members of the family Enterobacteriaceae worldwide.412
Microbial drug resistance is an inescapable consequence of the use and overuse of antimicrobial agents in the treatment of patients.13 This is one of the most obvious risk factors for the dissemination of genes encoding ESBLs. Nevertheless, the investigation of other factors may be critical for predicting the potential spread and evolution of ESBL-producing strains. For example, analysis of the genetic environment of ESBLs may help to explain the dissemination of ESBLs.1417 Different elements may be involved in the mobilization and expression of blaCTX-M genes.4,1417 Insertion sequences (ISs) are also an important source of genetic plasticity.
Another plasmid-borne blaCTX-M-type gene, blaCTX-M-32, was recently detected in an Escherichia coli isolate from La Coruña, Spain.18 This gene, like blaCTX-M-15, blaCTX-M-16, blaCTX-M-19 and blaCTX-M-27,1922 codes for an ESBL that has the ability to hydrolyse ceftazidime, and, therefore, strains of E. coli harbouring the gene are resistant to this antibiotic. The CTX-M-15, CTX-M-16 and CTX-M-27 as well as CTX-M-32 genes harbour an Asp-240
Gly substitution. E. coli expressing CTX-M-32 shows ceftazidime MICs higher than 256 mg/L.18
The present study describes intra- and interspecies transmission of the blaCTX-M-32 gene as well as description of its genetic environment. In addition, the role of a specific IS in down-regulating blaCTX-M-32 gene expression, and therefore in altering ceftazidime MICs, is also reported.
| Materials and methods |
|---|
|
|
|---|
Bacterial strains and susceptibility testing
An ESBL-producing strain of E. coli (EC1) was isolated from a patient admitted to the Juan Canalejo Hospital (La Coruña, Spain) with urinary tract infection (UTI) and who was previously treated with amoxicillin/clavulanic acid. Two months later, an ESBL-producing strain of Proteus mirabilis (PM1) was isolated from the same patient in a new episode of UTI. An ESBL-producing strain of E. coli (EC2) was isolated at the same time from the skin of the same patient. The bacteria were identified with API-20 E systems (bioMérieux SA, Marcy l'Étoile, France).
The MICs of the ß-lactams amoxicillin, amoxicillin plus clavulanic acid, piperacillin, cefotaxime, cefotaxime plus clavulanic acid, ceftazidime, ceftazidime plus clavulanic acid, cefepime, aztreonam and imipenem were determined by Etest (AB Biodisk, Solna, Sweden), following the manufacturer's instructions. The ESBL phenotype was determined with the corresponding Etest strips; cefotaxime, ceftazidime and cefepime with clavulanic acid.
Bacterial chromosomal DNA was obtained with the MasterPureTM Genomic DNA Purification Kit Epicentre® (Biotechnologies, Madison, WI, USA) preparation kit. The purity and integrity of chromosomal DNA were checked by electrophoresis in 0.7% agarose gels in Tris/borate/EDTA (TBE) buffer prior to manipulation. Plasmid DNA was extracted from clinical strains, transconjugants and transformants with the High Pure plasmid isolation kit (Roche Diagnostics GmbH, Mannheim, Germany).
Conjugation experiments, cloning experiments and DNA sequencing
Transfer of resistance by conjugation was attempted with E. coli XL1-Blue MRF' Kan strain (Stratagene Europe, Amsterdam, The Netherlands) as recipient. Overnight mating experiments were performed at 37°C, and the transconjugants TEC1, TEC2 and TPM1, obtained from EC1, EC2 and PM1, respectively, were selected on MacConkey agar plates supplemented with ampicillin (50 mg/L) and kanamycin (50 mg/L).
Cloning procedures were performed as described by Sambrook et al.23 Restriction enzymes and T4 DNA ligase were purchased from Roche Diagnostics GmbH and were used as specified by the manufacturer.
For cloning the bla gene, plasmid DNA from transconjugant TPM1 was digested with AccI. The resulting fragments were ligated into pBGS18,24 and the ligation mixture was transformed into E. coli TG1 [D(lac-pro) supE thi hsdDS/F9 traD36 proA1B1 lacL lacZM15] made competent by the calcium chloride method. After transformation, a few clones grew on LuriaBertani (LB) agar plates supplemented with kanamycin (50 mg/L) and ampicillin (50 mg/L). These transformants harboured an identical plasmid (pAF-1) with an insert of
9 kbp. Double-stranded templates were subjected to nucleotide sequencing by the method of Sanger et al.25
The BLAST program on the National Center for Biotechnology Information web site (http://www.ncbi.nlm.nih.gov) was used for database searches.
Repetitive extragenic palindromic (REP)-PCR
Amplification reactions were performed in a final volume of 50 µL as previously reported.26 The previously described primer pairs26 were used to amplify putative REP-like elements in the genomic bacterial DNA.
Plasmid restriction fragment length polymorphisms (RFLPs)
Plasmid DNA from E. coli XL1-Blue MRF' Kan transconjugants, TEC1, TEC2 and TPM1 was isolated. The DNA was then independently digested with HindIII, HincII, BamHI and AccI restriction enzymes, and the resulting fragments separated by electrophoresis on a 0.8% agarose gel. The DNA fragments were then visualized by staining with ethidium bromide (50 mg/L).
Isoelectric focusing (IEF) assay and ß-lactamase detection
ß-Lactamases were characterized by IEF27 of ultrasonicated bacterial extracts. Cultures of strains grown on LB medium were harvested and cell extracts were prepared by sonication. The ß-lactamases were analysed by IEF of cell extracts on polyacrylamide gels containing ampholytes (range of pH 39) (PhastGel; Amersham Pharmacia Biotech, Piscataway, NJ, USA) in a PhastSystem apparatus (Amersham Pharmacia Biotech). The focused ß-lactamases were detected by overlaying the gel with nitrocefin (0.5 mg/mL) in 100 mM phosphate buffer (pH 7.0). ß-Lactamases with a known pI (CTX-M-8, 8.9; VIM-2, 5.1; and SHV-1, 7.6) were electrophoresed in parallel as controls.
For biochemical experiments to assess activity towards nitrocefin, protein extracts were obtained as described earlier for IEF assays, but with the presence of protease inhibitors aprotinin, pepstatin and leupeptin (20 mg/L final concentration each). Results were the mean value of three independent experiments.
Detection of ESBL genes by PCR
To confirm the presence of the blaCTX-M-32 gene in the clinical isolates (EC1, EC2 and PM1) as well as their transconjugants (TEC1 and TEC2), a PCR assay was performed with CTX-M group 1 specific primers TestF (5'-ATGGTTAAAAAATCACTGCG-3') and TestR (5'-TTACAAACCGTTGGTGAC-3'), using standard conditions. An amplicon band of 876 bp was considered as a positive result.
The products from TEC1 and TEC2 were sequenced to confirm the precise blaCTX-M-32 gene.
Promoter analysis of the blaCTX-M-32 gene
To confirm the functionality of the blaCTX-M-32 promoter and the role of the IS1 insertion in separating 35 and 10 regions and, therefore, in reducing bla gene expression, a set of experiments was performed with the blaCTX-M-32 gene as gene reporter. For this, a PCR assay was carried out with the oligonucleotides Primer1 (5'-AAAGGATCCGCTGAATTCACTATCGGCG) and Primer2(5'- AAAGAATTCCCGTTTCCGCTATTACAAAC), which amplify a DNA region including promoter and the whole blaCTX-M-32 gene. Plasmid pMC-218 (Figure 1), which harbours the originally described blaCTX-M-32 gene, and plasmid pAF-1 reported here were used as templates. Amplicons from pMC-2 and pAF-1 (1245 and 2022 bp, respectively) were then digested with BamHI and EcoRI, ligated into pBGS18, transformed into E. coli TG1 and the transformants were selected on LB plates with 50 mg/L kanamycin and 50 mg/L ampicillin. The resulting recombinant plasmids, containing amplicons from pMC-2 and pAF-1, were designated as pAF-2 and pAF-3, respectively (Figure 1). The MICs of ß-lactams for E. coli TG1 harbouring pAF-2 and pAF-3 were determined, as was the specific activity towards 100 µM nitrocefin with protein extracts from these transformants.
|
Real-time RTPCR was also performed to determine the expression of the blaCTX-M-32 gene. Total RNA was isolated using TRIZOL® Reagent (Invitrogen) according to the manufacturer's instructions and treated with RNase-free DNase I. The concentration of RNA was determined spectrophotometrically and 1 µg of RNA was reverse transcribed into single-stranded cDNA using a Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics GmbH), according to the manufacturer's instructions. The cDNAs were quantified by real-time PCR amplification with specific primers (CTX-M-32-F 5'-TATAATCCGATTGCGGAAAAG and CTX-M-32-R 5'-CGGTACGGTCGAGACGGAA, GapA-F 5'-GTCCGTCAAAGACAACACTCCG and GapA-R 5'-CGATGATGCCGAAGTTATCG) using the Light Cycler® 480 (Roche Diagnostics GmbH), with initial incubation at 95°C for 10 min, followed by 45 cycles of 10 s at 95°C, 10 s at 60°C and 10 s at 72°C. The expression levels were normalized against the gapA housekeeping gene (coding for glyceraldehyde-3-phosphate dehydrogenase A).
| Results |
|---|
|
|
|---|
Antimicrobial susceptibilities
The antibiotic susceptibility profiles of E. coli isolates EC1 and EC2 and P. mirabilis isolate PM1 and of their ESBL-producing transconjugants showed resistance to most of the ß-lactam antibiotics tested, with the exception of ß-lactam/ß-lactamase inhibitor combinations and imipenem (Table 1). A moderate degree of resistance to ceftazidime, aztreonam and cefepime was also observed. For these bacterial strains, the MIC of cefotaxime was higher than that of ceftazidime, suggesting the presence of a CTX-M-type enzyme.
|
Detection of the CTX-32 ESBL gene in TEC1, TEC2 and TPM1
A bla gene was detected by PCR with specific oligonucleotides of group 1 CTX-M enzymes, in clinical strains EC1, EC2 and PM1, as well as with their transconjugants TEC1, TEC2 and TPM1. Sequencing of the amplicons obtained from TEC1, TEC2 and TPM1 revealed the presence of the blaCTX-M-32 gene in all cases. IEF showed that all three clinical strains and their transconjugants had a unique major ß-lactamase band of pI 9.0, corresponding to CTX-M-32 enzyme.
A REP-PCR assay was carried out to discount any epidemiological relationship between clinical E. coli strains EC1 and EC2. More than two band differences were detected between EC1 and EC2, therefore suggesting that there was no genetic relationship between them (data not shown).
RFLP analysis of ESBL-encoding plasmids
As the blaCTX-M-32 gene was demonstrated to be encoded by conjugative plasmids in the clinical strains of E. coli (EC1 and EC2) and P. mirabilis (PM1), an attempt was then made to assess whether or not these plasmids were genetically related, thus raising the possibility of intra- and interspecies transmission in the patient.
The restriction patterns with BamHI, AccI, HindIII or HincII of the three plasmids obtained from transconjugants TEC1, TEC2 and TPM1 were very similar (data not shown), which provides strong evidence that the same plasmid (
20 kbp) was present in different strains of Enterobacteriaceae isolated from the same patient.
Identification of the genetic structures surrounding the CTX-M-32 ESBL gene
As several ESBL genes may be transposon- or integron-borne,1417 the surrounding sequences of the blaCTX-M-32 gene were explored to detect any potential genetic structures able to mobilize the ESBL gene. For this, the AccI fragment of
9 kbp cloned from TPM1 (pAF-1 plasmid) was used as template for nucleotide sequencing of the surrounding region of the blaCTX-M-32 gene. The full sequence of
5 kbp is shown in Figure 2.
|
There are some interesting features worthy of mention: as previously reported,18 the inverted repeat right (IRR) sequence of ISEcp1B was detected 80 bp upstream of the ATG start codon of blaCTX-M-32 (Figure 2); in this fragment, the 35 and 10 promoter sequences provided by this IRR were physically separated and therefore modified by the presence of the IS IS124 (Figure 2a and b); IS1 was bracketed by a 5 bp duplicated target site of the putative insertion site for the DNA fragment resulting from an IS1-mediated transposition process. IS1 also contained two imperfect 18 bp inverted-repeat sequences (four mismatches), inverted repeat left (IRL) (left) and IRR (right) surrounding an InsAInsB protein that encoded a putative transposase, the integrity of which is essential for transposition;28,29 no putative promoter sequences were found in the 80 bp sequence that separated the IRR of ISEcp1B from the ATG site of the blaCTX-M-32 gene. Our research team18 and others17 have previously demonstrated that this IRR provided 35 and 10 promoter sequences for the expression of blaCTX-M genes. However, in the bacterial strains under study, the IS IS1 is located between the 10 and 35 promoter sequences, and it is therefore plausible that this genetic event is responsible for the reduced blaCTX-M-32 gene expression. This hypothesis is supported by the fact that MICs of ceftazidime were lower than for previously reported bacterial strains bearing blaCTX-M-32 (>256 mg/L when compared with 832 mg/L for the strains reported here); the IS1 was downstream of a tnpA gene that encoded the transposase of IS5, which we have previously reported to be associated with blaCTX-M-32;18 a truncated ORF-477 was found downstream of the blaCTX-M-32 gene.
To confirm that IS1 was interrupting the 10 and 35 regions of the blaCTX-M-32 promoter and therefore modulating blaCTX-M-32 gene expression, the MICs were determined for E. coli TG1 harbouring pAF-2 and pAF-3 (Figure 1). The MICs of ceftazidime for pAF-2 and pAF-3 transformants were >256 and 4 mg/L, respectively (Table 1). The MICs of aztreonam and cefepime for pAF-3 transformants were also lower. Moreover, specific activity towards nitrocefin was 1.9 ± 0.05 x 104 and 8.9 ± 2.2 x 106 µmol/s · µg of protein with cell extract from transformants pAF-2 and pAF-3, respectively. There were no differences between pAF-2 and pAF-3 plasmids in terms of the sequence of nucleotides in blaCTX-M-32 or additional regulatory sequences (data not shown). RTPCR analysis showed
10 times higher expression of blaCTX-M-32 in E. coli TG1 expressing the bla gene with its intact promoter (pAF-2 plasmid) with respect to that with IS1 modifying the promoter region (pAF-3 plasmid).
These results were further supported by cloning the blaCTX-M-32 gene under the control of the previously described CTX-M-14 gene promoter (positions 15021740 of the sequence with EMBL database accession no. AF252622 [GenBank] , which have been demonstrated to drive high levels of gene transcription) into pBGS18 to obtain full ESBL expression. After transformation of different clones harbouring blaCTX-M-32 under the CTX-M-14 gene promoter into E. coli TG1, the resulting MICs of ceftazidime were >256 mg/L (data not shown).
| Discussion |
|---|
|
|
|---|
We report the identification of the blaCTX-M-32 gene in two different Enterobacteriaceae species (E. coli and P. mirabilis) as well as in a genetically unrelated strain of E. coli isolated from the same patient. The patient had a history of recurrent UTIs and kidney stones, which may have favoured in vivo transmission of the plasmid harbouring the blaCTX-M-32 gene between E. coli and P. mirabilis. The presence of bacteria within the stones suggests that the infecting bacteria play a major role in the structure of the stones. Growth of biofilm may provide organisms with survival advantages and increase their virulence as well as facilitating horizontal gene transfer (i.e. ESBL).30,31
There are few examples showing putative in vivo transmission of ESBL genes. Mugnaioli et al.32 reported a putative in vivo transmission of CTX-M-1 between E. coli and Citrobacter amalonaticus and Morganella morganii, which highlights the ability of CTX-M-type ESBL genes to spread among different species of Enterobacteriaceae.
Analysis of the surrounding sequence of blaCTX-M-32 in the clinical strains under study revealed different ISs. The first was a partially truncated fragment of ISEcp1 tnpA transposase. The next IS found was the complete IS5, which has previously been detected upstream of blaCTX-M-32.18 The IS1 IS was found between the IS5 and blaCTX-M-32 and it appeared to be complete, with all elements required for its function. The IS1 IS has also previously been detected upstream of the blaCTX-M genes and found to disrupt the ISEcp1 element.14 The ISs, such as IS1, are an important source of genetic plasticity in prokaryotes.28,29 This is the first description of the presence of ISs ISEcp1 (truncated), IS5 and IS1 together in the same plasmid, upstream of a blaCTX-M gene. A 281 bp sequence was detected downstream of the bla gene and corresponded to a truncated part of ORF-477, which has previously been found in genetic structures surrounding plasmid-borne blaCTX-M genes in bacterial clinical isolates and described downstream of the blaCTX-M-3 gene of Kluyvera ascorbata.4,14
The MICs of ceftazidime for transconjugants and transformants harbouring blaCTX-M-32 were not as high as those expected for the CTX-M-32 enzyme,18 which has been attributed to resistance resulting from ceftazidime hydrolysis.4,18 A detailed analysis of the upstream sequence surrounding the blaCTX-M-32 genes reported here showed that the IS IS1 was located between the 35 and 10 promoter boxes, thereby separating and breaking the functionality of the blaCTX-M-32 promoter region,18 results that were further confirmed in this work. Indeed, the ratio of the relative specific activity against nitrocefin of protein extracts from pAF-2 and pAF-3 transformants (that expressed the originally reported blaCTX-M-32 promoter and that IS1 truncated, respectively) was
20 times higher, which may account for differences in ß-lactamase expression, and therefore in the MICs of ceftazidime and other broad-spectrum ß-lactams. Therefore, as well as contributing to high-level expression of bla genes, e.g. blaCTX-M-19 17 and also blaCTX-M-32,18 ISs may also reduce or eliminate ß-lactamase gene expression by interrupting a specific promoter region.33
In summary, putative transmission of a plasmid carrying blaCTX-M-32 between two different genera of Enterobacteriaceae is described in a patient who suffered from repeated UTI. Analysis of the DNA sequence surrounding this blaCTX-M-32 gene revealed a new composite structure formed by ISEcp-1, IS5 and IS1. The IS1 element was inserted within the promoter region of blaCTX-M-32, thereby reducing ESBL production, modulating antibiotic resistance and resulting in low ceftazidime MICs. These structures may complicate the detection of these ceftazidime-hydrolysing CTX-M-type enzymes.
| Nucleotide sequence accession number |
|---|
|
|
|---|
The GenBank accession number for the nucleotide sequence reported here is AM420303 [GenBank] .
| Transparency declarations |
|---|
|
|
|---|
None to declare.
| Acknowledgements |
|---|
We thank Dr Martínez-Beltrán for critical reading and Christine Francis for correction of the English style and grammar of the text. A. B. and M. C. are in receipt of a scholarship from SEIMC. M. M. T. is in receipt of a post-MIR research contract from the Instituto de Salud Carlos III. The study was partly financed by the Consellería de Innovación, Industria y Comercio, Xunta de Galicia (PGIDIT04BTF916028PR), Fondo de Investigaciones Sanitarias (PI040514 and PI061368) and also supported by Ministerio de Sanidad y Consumo, ISCIII, Spanish Network for the Research in Infectious Diseases (REIPI RD06/0008).
| References |
|---|
|
|
|---|
1 Bradford PA. (2001) Extended-spectrum ß-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev 14:93351.
2
Ambler RP. (1980) The structure of ß-lactamases. Philos Trans R Soc Lond B Biol Sci 289:32131.
3 Bush K, Jacoby GA, Meideiros AA. (1995) A functional classification scheme for ß-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother 39:121133.[Web of Science][Medline]
4
Bonnet R. (2004) Minireview: growing group of extended-spectrum ß-lactamases: the CTX-M enzymes. Antimicrob Agents Chemother 48:114.
5
Chanawong A, M'Zali FH, Heritage J, et al. (2002) Three cefotaximases, CTX-M-9, CTX-M-13, and CTX-M-14, among Enterobacteriaceae in the People's Republic of China. Antimicrob Agents Chemother 46:6307.
6 Hoffmann H, Stürenburg E, Heesemann J, et al. (2006) Prevalence of extended-spectrum ß-lactamases in isolates of the Enterobacter cloacae complex from German hospitals. Clin Microbiol Infect 12:32230.[CrossRef][Web of Science][Medline]
7
Chmelnitsky I, Carmeli Y, Leavitt A, et al. (2005) CTX-M-2 and a new CTX-M-39 enzyme are the major extended-spectrum ß-lactamases in mulitple Escherichia coli clones isolated in Tel Aviv, Israel. Antimicrob Agents Chemother 49:474550.
8
Bou G, Cartelle M, Tomás M, et al. (2002) Identification and broad dissemination of the CTX-M-14 ß-lactamase in different Escherichia coli strains in the northwest area of Spain. J Clin Microbiol 40:40306.
9
Hernández JR, Martínez-Martínez L, Cantón R, et al. (2005) Nationwide study of Escherichia coli and Klebsiella pneumoniae producing extended-spectrum ß-lactamases in Spain. Antimicrob Agents Chemother 49:21225.
10
Gangoue-Pieboji J, Miriagou V, Vourli S, et al. (2005) Emergence of CTX-M-15-producing enterobacteria in Cameroon and characterization of a blaCTX-M-15-carrying element. Antimicrob Agents Chemother 49:4413.
11
Sabate M, Tarrago R, Navarro F, et al. (2000) Cloning and sequence of the gene encoding a novel cefotaxime-hydrolyzing ß-lactamase (CTX-M-9) from Escherichia coli in Spain. Antimicrob Agents Chemother 44:19703.
12
Eckert C, Gautier V, Saladin-Allard M, et al. (2004) Dissemination of CTX-M-type ß-lactamases among clinical isolates of Enterobacteriaceae in Paris, France. Antimicrob Agents Chemother 48:124955.
13 Sanders CC and Sanders WE. (1992) ß-Lactam resistance in Gram-negative bacteria: global trends and clinical impact. Clin Infect Dis 15:82439.[Web of Science][Medline]
14
Eckert C, Gautier V, Arlet G. (2006) DNA sequence analysis of the genetic environment of various blaCTX-M genes. J Antimicrob Chemother 57:1423.
15 Lartigue MF, Poirel L, Nordmann P. (2004) Diversity of genetic environment of blaCTX-M genes. FEMS Microbiol Lett 234:2017.[CrossRef][Web of Science][Medline]
16 Saladin M, Bao Cao VT, Lambert T, et al. (2002) Diversity of CTX-M ß-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol Lett 209:1618.[Web of Science][Medline]
17
Poirel L, Decousser JW, Nordmann P. (2003) Insertion sequence ISEcp1B is involved in expression and mobilization of a blaCTX-M ß-lactamase gene. Antimicrob Agents Chemother 47:293845.
18
Cartelle M, Tomas MM, Molina F, et al. (2004) High-level resistance to ceftazidime conferred by a novel enzyme, CTX-M-32, derived from CTX-M-1 through a single Asp240-Gly substitution. Antimicrob Agents Chemother 48:230813.
19 Karim A, Poirel L, Nagarajan S, et al. (2001) Plasmid-mediated extended-spectrum ß-lactamase (CTX-M-3 like) from India and gene association with insertion sequence ISEcp1. FEMS Microbiol Lett 201:23741.[Web of Science][Medline]
20
Bonnet R, Dutour C, Sampaio JLM, et al. (2001) Novel cefotaximase (CTX-M-16) with increased catalytic efficiency due to substitution Asp-240
Gly. Antimicrob Agents Chemother 45:226975.
21
Poirel L, Naas T, Le Thomas I, et al. (2001) CTX-M-type extended-spectrum ß-lactamase that hydrolyzes ceftazidime through a single amino acid substitution in the omega loop. Antimicrob Agents Chemother 45:335561.
22 Bonnet R, Recule C, Baraduc R, et al. (2002) Effect of D240G substitution in a novel ESBL CTX-M-27. J Antimicrob Chemother 52:2935.[CrossRef][Web of Science]
23 Sambrook J, Fritsch EF, Maniatis T. (1989) Molecular Cloning: A Laboratory Manual Second Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).
24 Spratt B, Hedge PJ, Te Heesen S, et al. (1986) Kanamycin-resistant vectors that are analogues of plasmids pUC8, pUC9, pEMBL8 and pEMBL9. Gene 41:33742.[CrossRef][Web of Science][Medline]
25
Sanger F, Nicklen S, Coulson AR. (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:54637.
26 Bou G, Cerveró G, Domínguez MA, et al. (2000) PCR-based DNA fingerprinting (REP-PCR, AP-PCR) and pulsed-field gel electrophoresis characterization of a nosocomial outbreak caused by imipenem- and meropenem-resistant Acinetobacter baumannii.. Clin Microb Infect 6:63543.[CrossRef][Web of Science][Medline]
27 Mathew M, Harris A, Marshall MJ, et al. (1975) The use of analytical isoelectric focusing for detection and identification of ß-lactamases. J Gen Microbiol 88:16978.[Medline]
28 Sekino N, Sekine Y, Ohtsubo E. (1995) IS1-encoded proteins, InsA and the InsA-B'-InsB transframe protein (transposase): functions deduced from their DNA-binding ability. Adv Biophys 31:20922.[CrossRef][Web of Science][Medline]
29 Machida Y, Machida C, Ohtsubo E. (1984) Insertion element IS1 encodes two structural genes required for its transposition. J Mol Biol 177:22945.[CrossRef][Web of Science][Medline]
30
McLean RJC, Curtis Nickel J, Noakes VC, et al. (1985) An in vitro ultrastructural study of infectious kidney stone genesis. Infect Immun 49:80511.
31 Parsek MR and Singh PK. (2003) Bacterial biofilms: an emerging link to disease pathogenesis. Ann Rev Microbiol 57:677701.[CrossRef][Web of Science][Medline]
32
Mugnaioli C, Luzzaro F, De Luca F, et al. (2005) Dissemination of CTX-M-type extended-spectrum ß-lactamase genes to unusual hosts. J Clin Microb 43:41835.
33
Woodford N, Ward ME, Kaufmann ME, et al. (2004) Community and hospital spread of Escherichia coli producing CTX-M extended-spectrum ß-lactamases in the UK. J Antimicrob Chemother 54:73543.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


