Skip Navigation


JAC Advance Access originally published online on February 28, 2007
Journal of Antimicrobial Chemotherapy 2007 59(5):1038-1039; doi:10.1093/jac/dkm034
This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
59/5/1038    most recent
dkm034v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Chang, L.-L.
Right arrow Articles by Lu, P.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, L.-L.
Right arrow Articles by Lu, P.-L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Correspondence

Increased incidence of class 1 integrons in trimethoprim/sulfamethoxazole-resistant clinical isolates of Stenotrophomonas maltophilia

Lin-Li Chang1,*, Hui-Hui Lin1, Chung-Yu Chang1 and Po-Liang Lu2

1 Faculty of Medicine, Department of Microbiology, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan, Republic of China 2 Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan, Republic of China


* Corresponding author. Tel: +886-7-3121101 ext. 2150; Fax: +886-7-3218309; E-mail: m725006{at}kmu.edu.tw

Keywords: quaternary ammonium compounds , sul1 , S. maltophilia

Sir,

This study found that 21% of Stenotrophomonas maltophilia carry a class 1 integron when integrase-specific primers for intI1 or intI21 were used.

S. maltophilia is a non-fermentative, Gram-negative bacillus, increasingly identified as a nosocomial pathogen in compromised patients. Trimethoprim/sulfamethoxazole is one of the most potent agents for treating S. maltophilia infection. However, resistance to trimethoprim/sulfamethoxazole is apparently increasing.2

Integrons capture genes as part of a genetic element known as a gene cassette.3 Most cassettes within integrons with known functions confer antibiotic or quaternary ammonium compound (QAC) resistance. In an Argentinian study on the correlation between class 1 integrons and increasing MICs of trimethoprim/sulfamethoxazole for S. maltophilia isolates, Barbolla et al.4 reported that only 0.9% of S. maltophilia harboured class 1 integrons.

In contrast, a higher prevalence of class 1 integrons was revealed in the present study. We decided to look at the relationship between the high prevalence of class 1 integrons and trimethoprim/sulfamethoxazole resistance in S. maltophilia.

One hundred and three clinical S. maltophilia isolates were collected from different patients at a southern Taiwan medical centre in 2003. During the isolation period, no infectious outbreaks occurred. Identification was performed with API 20E (bioMerieux, La Balme, France) or the Vitek automated system (bioMerieux, Vitek, Hazelwood, MO, USA). Random amplified polymorphic DNA markers (Operon Technologies, Inc., Alameda, CA, USA) were used to clarify the relationships between isolates. Antimicrobial susceptibility to trimethoprim/sulfamethoxazole was determined by an agar dilution method. S. maltophilia ATCC 13637 was used as a wild-type control strain.

All gene cassettes within integrons were amplified with primers specific for the integron 5' and 3' conserved segments1 and then sequenced. Sequences were compared using the BLAST search programme. Sulfamethoxazole resistance determinants were detected with specific primers for sul1 (F, GGATTTTTCTTGAGCCCCGC; R, CATTGCCGATCGCGTGAAGT) and sul2 (F, CCTGTTTCGTCCGACACAGA; R, GAAGCGCAGCCGCAATTCAT). Statistical calculations included {chi}2 test and Fisher's exact test.

Twenty-six (25%) isolates revealed resistance to trimethoprim/sulfamethoxazole. The trimethoprim/sulfamethoxazole-resistant isolates harboured a significantly higher (69%) proportion of class 1 integrons than trimethoprim/sulfamethoxazole-susceptible isolates (P < 0.001, Table 1). Twenty-one of 26 trimethoprim/sulfamethoxazole-resistant isolates had the sul1 gene and 81% were associated with class 1 integrons, which was significantly higher than sul1-negative isolates (P = 0.0192).


View this table:
[in this window]
[in a new window]

 
Table 1.. Incidence of trimethoprim/sulfamethoxazole resistance in S. maltophilia and relation to class 1 integrons, sul1 and QAC

 
The identified gene cassettes within class 1 integrons included aminoglycoside resistance genes aacA4, aadA2, aadB and aac(6)-Ib'; chloramphenicol resistance gene cmlA and QAC resistance genes smr, qacF and qacH. Two isolates carried multigene cassettes: qacH-aadB-cmlA-aadA2 and aac(6)-Ib'/aacA4, respectively. The incidence of trimethoprim/sulfamethoxazole resistance was significantly associated with the presence of QAC resistance genes, e.g. smr, qacF and qacH, carried on class 1 integrons (P < 0.001, Table 1).

Increasing proportions of isolates containing class 1 integrons were detected in S. maltophilia. However, no class 2 integrons were found. Although trimethoprim/sulfamethoxazole resistance was significantly associated with class 1 integrons, the trimethoprim resistance gene was not encoded by integrons. Recent studies indicate that resistance genes are linked to insertion sequence common region (ISCR) elements, which are DNA sequences found beyond and close to the 3' conserved sequences of class 1 integrons.5 These ISCR elements have been identified in numerous Gram-negative bacteria and a few Gram-positive bacteria5 and are responsible for the mobility and dissemination of many antibiotic resistance genes, including extended-spectrum ß-lactamase and carbapenemase genes and aminoglycoside, chloramphenicol, quinolone as well as trimethoprim resistance genes.5 A previous study by Toleman et al.5 examined the association of trimethoprim/sulfamethoxazole resistance with ISCR elements in S. maltophilia. Therefore, the possibility of trimethoprim resistance genes located on ISCR elements beyond class 1 integrons in clinical isolates in the present study merits further elucidation. However, chromosome-mediated trimethoprim resistance cannot be ruled out.

Furthermore, selection of QAC resistance in the natural environment has the potential to co-select for antibiotic resistance.6 In this study, the incidence of trimethoprim/sulfamethoxazole resistance was significantly associated with the presence of QAC resistance genes carried on integrons. Therefore, it is possible that introduction of QAC into hospital settings to prevent bacterial infection might enhance the selection of trimethoprim/sulfamethoxazole-resistant isolates.

In conclusion, this study indicates that isolates with resistance to trimethoprim/sulfamethoxazole are associated with the presence of class 1 integrons and QAC resistance genes located on integrons.

Transparency declarations

None to declare.

Acknowledgements

This work was supported by a National Science Council grant (94-2320-B-037-022).

References

1 Chang LL, Chen HF, Chang CY, et al. (2004) Contribution of integrons, and SmeABC and SmeDEF efflux pumps to multidrug resistance in clinical isolates of Stenotrophomonas maltophilia. J Antimicrob Chemother 53:518–21.[Abstract/Free Full Text]

2 Valdezate S, Vindel A, Loza E, et al. (2001) Antimicrobial susceptibilities of unique Stenotrophomonas maltophilia clinical strains. Antimicrob Agents Chemother 45:1581–4.[Abstract/Free Full Text]

3 Recchia GD and Hall RM. (1995) Gene cassettes: a new class of mobile element. Microbiology 141:3015–27.[Free Full Text]

4 Barbolla R, Catalano M, Orman BE, et al. (2004) Class 1 integrons increase trimethoprim–sulfamethoxazole MICs against epidemiologically unrelated Stenotrophomonas maltophilia isolates. Antimicrob Agents Chemother 48:666–9.[Abstract/Free Full Text]

5 Toleman MA, Bennett PM, Walsh TR. (2006) ISCR elements: novel gene-capturing systems of the 21st century? Microbiol Mol Biol Rev 70:296–316.[Abstract/Free Full Text]

6 Gaze WH, Abdouslam N, Hawkey PM, et al. (2005) Incidence of class 1 integrons in a quaternary ammonium compound-polluted environment. Antimicrob Agents Chemother 49:1802–7.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Antimicrob ChemotherHome page
M. E. Falagas, P.-E. Valkimadi, Y.-T. Huang, D. K. Matthaiou, and P.-R. Hsueh
Therapeutic options for Stenotrophomonas maltophilia infections beyond co-trimoxazole: a systematic review
J. Antimicrob. Chemother., November 1, 2008; 62(5): 889 - 894.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
59/5/1038    most recent
dkm034v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Chang, L.-L.
Right arrow Articles by Lu, P.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, L.-L.
Right arrow Articles by Lu, P.-L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?