JAC Advance Access originally published online on January 29, 2007
Journal of Antimicrobial Chemotherapy 2007 59(3):441-450; doi:10.1093/jac/dkl521
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Biofilm formation by fluconazole-resistant Candida albicans strains is inhibited by fluconazole
1 Department of Molecular Biology and Microbiology, Tufts University, 136 Harrison Ave., Boston, MA 02111, USA 2 Tufts-New England Medical Center, 750 Washington Street, Boston, MA 02111, USA
* Corresponding author. Tel: +1-617-636-0404; Fax: +1-617-636-0211; E-mail: carol.kumamoto{at}tufts.edu
Received 24 August 2006; returned 22 October 2006; revised 3 November 2006; accepted 28 November 2006
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionTransparency declarationsReferences |
|---|
Objectives: The fungal pathogen Candida albicans forms biofilms on implanted medical devices, resulting in infections with high mortality. Fully developed biofilms, which are adherent communities of microorganisms, characteristically exhibit high resistance to antimicrobial drugs, making treatment of device-associated infection problematic. The aim of this study was to determine the effect of the addition of the azole antifungal fluconazole on the initiation of biofilm formation by both drug-susceptible and drug-resistant C. albicans strains.
Results: Our data reported here show that biofilm formation by both fluconazole-susceptible and fluconazole-resistant C. albicans strains was inhibited when fluconazole was present. For the fluconazole-susceptible strains, inhibition of growth due to the presence of the antifungal drug probably prevented the acquisition of high-level fluconazole resistance. However, for fluconazole-resistant strains, the inhibition of biofilm development was unexpected.
Conclusions: Unexpectedly, fluconazole inhibited biofilm formation by a variety of laboratory isolated and clinically isolated fluconazole-resistant strains.
Keywords: C. albicans , drug resistance , MDR1
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionTransparency declarationsReferences |
|---|
The yeast Candida albicans is a commensal of human mucosal surfaces and also an opportunistic pathogen. C. albicans causes a wide variety of diseases including oral thrush and disseminated candidiasis.1 C. albicans is also the major fungus that colonizes medical implants,2 causing device-associated infections with high mortality.3,4 Infections involving medical devices are notoriously difficult to eliminate and generally necessitate removal of the device.5,6
Medical device-associated infections involve biofilm formation in which microorganisms adhere to a device and produce a characteristic attached community.2,7 Mature C. albicans biofilms show a complex three-dimensional architecture with extensive spatial heterogeneity, and consist of a dense network of yeast, hyphae and pseudohyphae encased within a matrix of exopolymeric material.8,9
One of the most important characteristics of biofilms is their high level of resistance to antimicrobial drugs. In the case of C. albicans biofilms, resistance to azole drugs and amphotericin B has been demonstrated.10,11 Interestingly, biofilms retain susceptibility to echinocandins.12 Antifungal drug resistance in C. albicans biofilms seems to be the result of several factors.13 It has been reported that cells in biofilms have a reduced content of ergosterol compared with cells in liquid culture.14 In addition, cells in biofilms express genes encoding drug efflux determinants including CDR1 and CDR2 (Candida drug resistance; ATP binding cassette transporters).14,15 Transient expression of MDR1 (multidrug resistance; major facilitator family) has also been observed in adherent cells.14 All of these factors could contribute to the high levels of drug resistance exhibited by C. albicans cells in a biofilm.
In previous studies, experiments measuring drug resistance of cells in biofilms have been performed by first allowing the cells to initiate biofilm formation and then testing the levels of drug resistance.15,16 However, if fluconazole were added at the beginning of the experiment, the drug might act before the biofilm formed. In this situation, the inhibition of growth by fluconazole would prevent the cells from becoming highly drug-resistant. Consistent with this idea, Kuhn et al. showed that preincubation of cells in liquid culture with sub-inhibitory concentrations of different drugs affected biofilm formation in drug-susceptible strains.17,18 Therefore, in this study, the goal was to determine the effect of fluconazole on biofilm formation when the drug was added to the medium at the same time as the cells.
The results reported in this communication demonstrate that fluconazole treatment inhibits biofilm formation. Further, both fluconazole-susceptible and fluconazole-resistant strains were susceptible to this effect. When the cells were grown in liquid culture, growth inhibition was not as pronounced as during biofilm growth. Therefore, this effect seems to be biofilm-specific rather than a general effect of fluconazole.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionTransparency declarationsReferences |
|---|
Strains
Genotypes of all strains and fluconazole MICs are listed in Table 1. Two laboratory strains CAI4 (
ura3/ura3)19 and CAPR306 (ura3/ura3 crd1/crd1), both derived from the clinical isolate SC5314, were used as the fluconazole-susceptible parental strains. These strains carried deletions of URA3 or the copper pump CRD120 so that their fluconazole resistance mutations could be subjected to subsequent molecular genetic analysis (to be described elsewhere).
|
For selection of laboratory-derived fluconazole-resistant strains, CAI4 (
ura3/ura3) or CAPR306 (ura3/ura3 crd1/crd1) were grown in 2 mg/L fluconazole. After overnight growth, the cultures were diluted (1:1000) into fresh medium again containing 2 mg/L fluconazole. After overnight growth, these populations were diluted into fresh medium containing 4 mg/L fluconazole. This selection was repeated in 4 mg/L fluconazole, then 8 mg/L (twice), 16 mg/L (twice), 32 mg/L (twice) and 64 mg/L (once). After the drug selection, strains purified from these populations exhibited MICs of fluconazole > 64 mg/L, while parental populations cultured in the same manner except without drug exhibited an MIC of 
0.25 mg/L of fluconazole, identical with that of the original parental isolates. Strains CAPR507, CAPR510, CAPR514 and CAPR518 were purified from independent fluconazole-resistant populations. To complement the ura3 mutations in both parental and fluconazole-resistant strains, the URA3 gene was recombined into its native locus by transformation using the pET16 plasmid;21 these complemented strains are indicated by adding the letter A to the strain name (e.g. CAPR306A is Ura+). The clinical strains used in this study were collected from blood and oral mucosa specimens submitted to the clinical microbiology laboratories of Tufts-New England Medical Center, Beth Israel Deaconess Medical Center, and University of Alabama Medical Center (courtesy of John Baddley, MD), were subcultured at the Clinical Microbiology Laboratory, Tufts-New England Medical Center onto Sabouraud's Dextrose agar plates x 2 and stored in vials of sterile skimmed milk at – 70°C. All of the clinical strains used in this study had highly elevated fluconazole MICs (Table 1).
Susceptibility to fluconazole was analysed using the standard CLSI (formerly NCCLS) microdilution protocol M27-A. Briefly, cells at 1 x 103 to 5 x 103 cells/mL were incubated in increasing concentrations of fluconazole (0.0635–128 mg/L) in a 96-well plate. The plate was incubated for 46–50 h at 35°C without agitation. The MIC was determined by a lack of growth in the well at certain fluconazole concentrations.22 For clinical strains, fluconazole resistance was also confirmed by the semi-solid agar antifungal susceptibility (SAAS) screening method.23
Yeast extract/peptone/dextrose (YPD) medium, yeast extract/peptone/sucrose (YPS) medium, synthetic defined (SD) medium and complete medium (CM) were as described previously.24–26 RPMI medium 1640/20 mM MOPS (pH 7.0) was used for biofilm formation.27 For culture of Ura– strains, uridine was added to 60 mg/L. To test the effect of fluconazole, fluconazole was added to 8 mg/L final concentration. In some experiments, lower or higher concentrations of fluconazole were used.
The system described by Ramage et al. was used with minor modifications.27 Briefly, a cell suspension of 1 x 106 yeast cells per mL was prepared in RPMI medium 1640/20 mM MOPS (pH 7.0). This suspension was introduced into polystyrene wells or Petri dishes and incubated at 37°C without agitation, which allowed the cells to attach to the surface of the Petri dish and form the biofilm structure. For RNA extraction experiments, cells were plated at 3 x 106 cells per mL. Photography was performed with a Nikon Eclipse E400 dissecting microscope and a SPOT Insight camera with the 10 x objective.
Total RNA was extracted by mechanical disruption using glass beads and a Mini BeadBeater (BioSpecs Products, Inc., Bartsville, OK, USA) and the RNeasy Mini Kit (Qiagen Inc., Chatsworth, CA, USA) according to the manufacturers' protocols. Northern-blot hybridization was performed using previously described methods.28 Probes were amplified with the following primers: for HWP1, primers F: ACTCCATTAACTACTACTACTGAA and R: GAACATCTGATTTTGGAACAGCTG; for MDR1, primers F: CGGAATTCGGAAATTATATTATTCTTCATCGCTT and R: TGAATTCAATTGGGTTCACCTTGATTATCTAT; for CDR1, primers F: AAAGGCAATTAGTCAAGACTCTTCCTCAGAA and R: TCTTAATCTAGCGGCAAATTCCAAAGTATCA; and for ACT1, primers F: TATCATGGGTTGGTATGGG and R: TGTGGTGAACAATGGATG.
Signals were recorded by PhosphorImager scanning (Amersham).
The metabolic activity of sessile cells was measured by assaying 2,3-bis(2-methoxy-4-nitro-5-sulfo-phenyl)-2H-tetrazolium-5-carboxanilide (XTT) reduction, a reaction catalysed by mitochondrial dehydrogenases.29 Briefly, for the XTT reduction assay in biofilm conditions, adherent cells were washed twice with PBS and then incubated with 0.5 mg/mL XTT and 1 µM menadione in PBS at 37°C for 90 min. A490 was determined using a microtitre plate reader. For the XTT reduction assay with cells grown in liquid culture, the cells were collected by filtration (Millipore filters 0.45 µm), washed twice with PBS and then incubated with 0.5 mg/mL XTT and 1 µM menadione in PBS at 37°C for 90 min. A490 was determined using a microtitre plate reader. All the assays were done in triplicate.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionTransparency declarationsReferences |
|---|
Antifungal azole fluconazole inhibits biofilm formation by both fluconazole-susceptible and fluconazole-resistant strains
To determine whether biofilm formation would occur in the presence of fluconazole, the fluconazole-susceptible C. albicans strain CAPR306A was incubated on polystyrene surfaces in RPMI medium, as previously described.27 When fluconazole was absent, the cells in the wells adhered to the plastic surface (Figure 1h, 3 i of incubation), proliferated and produced hyphae (Figure 1b and c, 6 and 9 h of incubation) and ultimately produced a three-dimensional biofilm structure (Figure 1d, e and f, up to 96 h of incubation). These stages of biofilm development have been well described previously.27,30
|
In other wells, fluconazole was added to a final concentration of 8 mg/L at the same time that the cells were added. This moderate concentration of fluconazole was well above the fluconazole MIC for this strain (0.25 mg/L) and was chosen because this concentration is readily achievable in the bloodstream of patients who are undergoing treatment with fluconazole.31,32
After 3 h of incubation in the presence of drug, cells adhered to the plastic surface, as in the absence of drug (Figure 1 g, 3 h of incubation). However, proliferation of the cells was reduced (Figure 1h and i, 6 and 9 h of incubation). Even after 96 h of incubation, the three-dimensional structure typical of a mature biofilm did not form (Figure 1 h–l). Therefore, a fluconazole-susceptible strain failed to form a normal biofilm when grown in the presence of fluconazole. Fluconazole probably reduced the growth of the cells and prevented them from acquiring typical biofilm-associated resistance.
The ability of fluconazole to inhibit biofilm development by a fluconazole-susceptible strain was not surprising. To determine whether drug resistance would allow a strain to resist the inhibitory effects of fluconazole on biofilm formation, laboratory-selected drug-resistant strains were studied. As shown in Table 1, the fluconazole MICs measured with the standard CLSI protocol for strains CAPR514, CAPR514A (CAPR514 Ura+), CAPR518 and CAPR518A (CAPR518 Ura+) were greater than 64 mg/L.
Drug resistance in these strains was associated with overexpression of efflux determinants. Strain CAPR514 expressed the MDR1 gene at high levels following growth in liquid medium either in the presence (not shown) or absence of fluconazole (Figure 2, lane 3). In strain CAPR518, elevated expression of CDR1 was detected following growth in liquid medium with (not shown) or without fluconazole (Figure 2, lane 2). Therefore, these strains and their Ura+ derivatives constitutively expressed efflux determinants during liquid growth.
|
Strain CAPR514A [MDR1 overexpressing (OE)] formed a normal biofilm structure when grown in the absence of fluconazole. At early time points, many of the cells switched to filamentous forms (Figure 3a), after 25 h, a three-dimensional biofilm structure had developed (Figure 3b), and at 96 h the biofilm structure was still observed (Figure 3c). Similarly, CAPR518A (CDR1 OE) cells grown without fluconazole formed a biofilm (Figure 3g, h and i).
|
However, when biofilm development by these fluconazole-resistant strains was initiated in the presence of 8 mg/L fluconazole, biofilm development was inhibited (Figure 3d–f and 3j–l). Although cells became adherent, the three-dimensional biofilm structure failed to form. After 96 h of incubation, neither of the drug-resistant strains was able to overcome the fluconazole effect, and no biofilm was observed.
Both CAPR514A (MDR1 OE) and CAPR518A (CDR1 OE) exhibited markedly elevated MICs of fluconazole and constitutively expressed efflux determinants in liquid culture. Nevertheless, biofilm formation by both strains was inhibited by the addition of fluconazole at the moderate level of 8 mg/L. Therefore, incubation in the presence of fluconazole resulted in inhibition of biofilm development by both fluconazole-resistant and fluconazole-susceptible laboratory strains. Under these conditions, the cells remained viable for at least 2 days.
Ramage et al. showed that the quorum-sensing molecule farnesol has an inhibitory effect on biofilm formation,33 and Hornby and Nickerson showed that treatment with fluconazole (1 µM) led to a 10-fold increase in the production of farnesol.34 Therefore, the enhanced farnesol production caused by fluconazole treatment may be responsible for defective biofilm formation. To test this hypothesis, a farnesol non-responsive strain was analysed. The strain CHK21 (chk1 null mutant) lacks a histidine kinase that is important for the response to farnesol. As a result, this strain forms biofilms in the presence of farnesol.35 In our experiments, biofilm formation by CHK21 was inhibited by fluconazole for up to 96 h (Figure 3p–r), indicating that inhibition was not mediated by farnesol production.
Reduced metabolic activity of adherent cells confirms that biofilm development was inhibited in the presence of fluconazole
To provide a more quantitative assessment of the extent of cell growth and metabolic activity of biofilms in the presence or absence of fluconazole, the ability of adherent cells to reduce XTT, a reaction catalysed by mitochondrial dehydrogenases, was measured as described in the Materials and methods section.29,36 It has been previously argued that the metabolic activity of a biofilm is correlated with cell numbers and that higher levels of XTT reduction indicate higher numbers of cells.29
Cells of various strains were incubated in plastic wells, in the presence or absence of fluconazole. After 3, 25, 48 or 72 h, the medium was removed, the adherent cells were washed, and their XTT reduction activity was measured. After 3 h of incubation in either the presence or absence of fluconazole, relatively low levels of XTT reduction (e.g. 0.15 OD) were observed for all strains (Figure 4a, sample 1), reflecting the small number of cells that had been inoculated into the well. Following 
25 h of incubation in the absence of drug, 4–10-fold higher levels of XTT reduction were observed (Figure 4a, samples 2–4), demonstrating the presence of higher numbers of metabolically active cells.
|
When fluconazole was present for up to 72 h of incubation, the XTT reduction activity of adherent cells remained at the level seen at 3 h (Figure 4a). Both the fluconazole-susceptible and fluconazole-resistant strains exhibited a low XTT reduction activity following incubation in the presence of fluconazole. These results suggest that cellular proliferation and biofilm development were inhibited by fluconazole, thus confirming the results obtained by visual observation of biofilms (Figures 1 and 3).
Strain CHK21 also showed inhibition of biofilm development by fluconazole at 8 mg/L (Figure 4b, sample 9) and at lower concentrations of drug (Figure 4c), consistent with visual observations of adherent cells (Figure 3). As noted in the Materials and methods section, the laboratory strains used in these experiments were originally Ura–. These original Ura– strains behaved very similarly to their Ura+ derivatives (Figure 4b). Also, the presence (Figure 4b, samples 6–8) or absence (Figure 4b, samples 1–5) of CRD1 did not affect the inhibition of biofilm formation by fluconazole.
To determine how susceptible the cells were to fluconazole under these conditions, experiments were performed with lower or higher concentrations of fluconazole. Biofilm formation by the fluconazole-susceptible strain CAPR306A was inhibited by fluconazole at 0.5 mg/L or 1 mg/L (Figure 4c, samples 2 and 3). However, these lower concentrations of fluconazole did not completely inhibit biofilm formation by the highly fluconazole-resistant strains CAPR514A (MDR1 OE) and CAPR518A (CDR1 OE). At higher fluconazole concentrations, biofilm formation by all strains was inhibited (Figure 4c, sample 5). Thus, the fluconazole-susceptible strain was affected at lower concentrations of drug than the resistant strains, but all three strains were affected by concentrations of fluconazole that are achieved in the bloodstream of patients. In summary, these measurements of metabolic activity confirmed our observations that biofilm development by both fluconazole-susceptible and fluconazole-resistant strains was inhibited by the presence of a moderate concentration of fluconazole.
Growth inhibition by fluconazole is stronger in biofilm conditions than during growth in liquid culture
To determine whether growth inhibition by fluconazole would be observed under other conditions, we studied the effect of fluconazole on growth of liquid cultures that were continuously agitated at 37°C using the same medium, temperature and cell density as biofilm conditions. The XTT reduction assay demonstrated that growth of cells in liquid culture was inhibited by fluconazole in comparison with the no fluconazole control (Figure 5a). However, after 25 h of growth in liquid culture, cells had 3-fold higher levels of XTT reduction activity compared with cells at 3 h (Figure 5b, planktonic). This increase was not seen when cells were incubated under biofilm conditions in the presence of fluconazole (Figure 5b, biofilm). The growth of the fluconazole-susceptible strain in liquid culture probably reflects the fact that high initial cell densities were used to replicate biofilm-forming conditions. These results show that the growth inhibitory effect of fluconazole was stronger in biofilm conditions than in liquid culture conditions, and suggest that this effect is biofilm-specific.
|
Defective HWP1 expression confirms that biofilm formation was inhibited by incubation in the presence of fluconazole
As a third approach to assessing the effect of fluconazole on biofilm development, gene expression was analysed. Biofilms typically contain hyphae, and, as a result, HWP1, encoding a surface mannoprotein that is expressed in a hyphal-specific manner,37 is expressed by cells in biofilms3 (Figure 6). However, if biofilm formation was inhibited, HWP1 expressed would be reduced.
|
To determine the effect of fluconazole on expression of HWP1, RNA was isolated from cells incubated under biofilm-forming conditions in the presence or absence of fluconazole (8 mg/L). For all three strains [CAI4 (wild-type), CAPR518 (CDR1 OE) and CAPR514 (MDR1 OE)], HWP138 expression was observed when the cells were incubated in the absence of fluconazole (Figure 6), reflecting the formation of filamentous cells during normal biofilm formation.15 In contrast, HWP1 expression declined over time when cells were incubated in the presence of fluconazole (Figure 6). These results show at the molecular level that biofilm formation and true hypha formation were inhibited by fluconazole.
Biofilm development by a variety of clinically isolated fluconazole-resistant strains is inhibited by fluconazole
To demonstrate that the inhibition of biofilm formation was not restricted to laboratory-selected mutants, we measured XTT reduction activities of several clinically isolated fluconazole-resistant C. albicans strains during growth in biofilm-forming conditions. The fluconazole MICs for these strains were all markedly elevated (>128 mg/L; Table 1). Strain CI 158 overproduced MDR1 during growth in liquid medium without fluconazole (Figure 2, lane 5). After 25 h of incubation under biofilm-forming conditions in the absence of fluconazole, this strain exhibited a 3-fold increase in XTT reduction relative to the activity of the cells at 3 h (Figure 7a, sample 1). However, almost no increase in XTT reduction was observed when fluconazole was present (Figure 7b, sample 1). Strain CI 168 overproduced CDR1 during growth in liquid medium without fluconazole (Figure 2, lane 4) and showed poor biofilm formation both with and without fluconazole. When grown under biofilm-forming conditions, this strain showed a 6-fold increase in XTT reduction without fluconazole (Figure 7a, sample 7) and a 2-fold increase in the presence of fluconazole (Figure 7b, sample 7).
|
The remaining clinically isolated strains were fluconazole-resistant due to unknown mechanisms. Only some of these strains (Figure 7, samples 1–5) proliferated and formed biofilms when incubated under biofilm conditions without fluconazole [Figure 7a, compare white bars (3 h) and black bars (25 h)]. For these strains, there was no increase in the metabolic activity of the cells when the strains were incubated in the presence of fluconazole [Figure 7b, compare white bars (3 h) and black bars (25 h)]. There was also a significant difference in XTT reduction at 25 h in the presence versus in the absence of fluconazole (P < 0.00001). Several of the clinical strains failed to produce a biofilm regardless of whether fluconazole was present or absent (Figure 7, samples 6–9). Therefore, we concluded that biofilm formation by a variety of fluconazole-resistant biofilm-forming clinical strains was inhibited by fluconazole.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionTransparency declarationsReferences |
|---|
Biofilm formation is commonly associated with antifungal resistance. Many studies have shown that cells in biofilms are highly resistant to fluconazole and that they rapidly become resistant.39 For example, enhanced resistance to chlorhexidine was detected within 15 min of cell plating.40 However, the mechanisms responsible for this enhanced antifungal resistance are not well understood at the molecular level.
During C. albicans biofilm development in the absence of fluconazole, transient expression of MDR1 as well as increased expression of CDR1 and CDR2 have been observed.14,15 Expression of these efflux determinants is believed to be important for antifungal resistance during early stages of biofilm development because mutants lacking MDR1 or CDR1,2 fail to exhibit normal resistance at early time points.14 Despite these findings, the results reported here argue that a high expression of efflux determinants is not sufficient to allow cells to initiate biofilm formation in the presence of moderate levels of fluconazole. Efflux determinant expression was only effective when low levels of fluconazole were used.
Mature biofilms exhibit drug resistance via a non-efflux, unknown mechanism because efflux determinants are not highly expressed in mature biofilms.14,39,41,42 This biofilm-associated mechanism probably allows both fluconazole-susceptible and fluconazole-resistant strains to achieve high resistance to the effects of fluconazole on biofilms.
In our collection of drug-resistant clinically isolated strains, only 8 out of 20 produced significant biofilms under the conditions of our experiments. These results are consistent with previous analyses of clinical strains43 and show that the potential for biofilm formation varies widely among strains. The collections of strains used in this study were collected from blood and oral mucosa specimens and found to be fluconazole-resistant by antifungal susceptibility testing. The results reported here demonstrate that all strains that were capable of forming biofilms were defective in forming biofilms in the presence of fluconazole. Fluconazole inhibited biofilm formation in strains that were MDR1 overproducers, CDR1 overproducers or drug-resistant by unknown mechanisms. Therefore, the inhibition of biofilm formation by fluconazole appeared to be a general effect.
The quorum-sensing molecule farnesol inhibits biofilm formation,33 and azole treatment can increase the production of farnesol.34 The strain CHK2144 lacking the histidine kinase Chk1p fails to respond to farnesol and can form biofilms in the presence of farnesol.35 The finding that biofilm formation by CHK21 was inhibited in the presence of fluconazole indicates that farnesol production does not account for the inhibition of biofilm development by fluconazole.
In conclusion, C. albicans biofilms are notorious for their high resistance to antifungal drugs. Resistance to both azole drugs and amphotericin B has been documented. Fortunately, the echinocandins are active against C. albicans biofilms. The unexpected finding that fluconazole inhibits biofilm formation by fluconazole-resistant clinically isolated C. albicans strains could be useful for development of new methods to reduce the incidence of device-associated infections.
|
Transparency declarations |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionTransparency declarationsReferences |
|---|
I. B., C. A. K. and P. R. have no conflicts to declare. S. H. declares the following—grant/research support: Pfizer; consultant: Astellas, Schering-Plough, Domantis; speaker's bureau: Astellas, Merck, Pfizer, Schering-Plough, Enzon; major stock shareholder: none; other financial/material support: none.
|
Acknowledgements |
|---|
We thank Michael Kruppa and Richard Calderone for the gift of strain CHK21 and all Kumamoto lab members and Paula Watnick for helpful discussions. This research was supported by grant AI 052805 (to C. A. K.) from the National Institutes of Health.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionTransparency declarationsReferences |
|---|
1 Morschhauser J. (2002) The genetic basis of fluconazole resistance development in Candida albicans. Biochim Biophys Acta 1587:240–8.[Medline]
2
Ramage G, Saville SP, Thomas DP, et al. (2005) Candida biofilms: an update. Eukaryot Cell 4:633–8.
3 Nobile CJ and Mitchell AP. (2005) Regulation of cell-surface genes and biofilm formation by the C. albicans transcription factor Bcr1p. Curr Biol 15:1150–5.[CrossRef][Web of Science][Medline]
4
Wu T, Wright K, Hurst SF, et al. (2000) Enhanced extracellular production of aspartyl proteinase, a virulence factor, by Candida albicans isolates following growth in subinhibitory concentrations of fluconazole. Antimicrob Agents Chemother 44:1200–8.
5
Donlan RM and Costerton JW. (2002) Biofilms: survival mechanisms of clinically relevant microorganisms. Clin Microbiol Rev 15:167–93.
6 Douglas LJ. (2002) Medical importance of biofilms in Candida infections. Rev Iberoam Micol 19:139–43.[Medline]
7
Kojic EM and Darouiche RO. (2004) Candida infections of medical devices. Clin Microbiol Rev 17:255–67.
8 Kumamoto CA. (2002) Candida biofilms. Curr Opin Microbiol 5:608–11.[CrossRef][Web of Science][Medline]
9 Lopez-Ribot JL. (2005) Candida albicans biofilms: more than filamentation. Curr Biol 15:R453–5.[CrossRef][Web of Science][Medline]
10
Baillie GS and Douglas LJ. (1998) Effect of growth rate on resistance of Candida albicans biofilms to antifungal agents. Antimicrob Agents Chemother 42:1900–5.
11
Baillie GS and Douglas LJ. (2000) Matrix polymers of Candida biofilms and their possible role in biofilm resistance to antifungal agents. J Antimicrob Chemother 46:397–403.
12
Bachmann SP, VandeWalle K, Ramage G, et al. (2002) In vitro activity of caspofungin against Candida albicans biofilms. Antimicrob Agents Chemother 46:3591–6.
13 Kumamoto CA and Vinces MD. (2005) Alternative Candida albicans lifestyles: growth on surfaces. Annu Rev Microbiol 59:113–3.[CrossRef][Web of Science][Medline]
14
Mukherjee PK, Chandra J, Kuhn DM, et al. (2003) Mechanism of fluconazole resistance in Candida albicans biofilms: phase-specific role of efflux pumps and membrane sterols. Infect Immun 71:4333–40.
15
Ramage G, Bachmann S, Patterson TF, et al. (2002) Investigation of multidrug efflux pumps in relation to fluconazole resistance in Candida albicans biofilms. J Antimicrob Chemother 49:973–80.
16 Mukherjee PK and Chandra J. (2004) Candida biofilm resistance. Drug Resist Updat 7:301–9.[CrossRef][Web of Science][Medline]
17
Kuhn DM, George T, Chandra J, et al. (2002) Antifungal susceptibility of Candida biofilms: unique efficacy of amphotericin B lipid formulations and echinocandins. Antimicrob Agents Chemother 46:1773–80.
18 Kuhn DM and Ghannoum MA. (2004) Candida biofilms: antifungal resistance and emerging therapeutic options. Curr Opin Investig Drugs 5:186–97.[Medline]
19 Fonzi WA and Irwin MY. (1993) Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717–28.[Abstract]
20
Riggle PJ and Kumamoto CA. (2000) Role of a Candida albicans P1-type ATPase in resistance to copper and silver ion toxicity. J Bacteriol 182:4899–905.
21 Gillum AM, Tsay EY, Kirsch DR. (1984) Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol Gen Genet 198:179–82.[CrossRef][Web of Science][Medline]
22 National Committee for Clinical Laboratory Standards. (1990) Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically—Second Edition: Approved Standard M7-A2(NCCLS, Villanova, PA, USA).
23
Provine H and Hadley S. (2000) Preliminary evaluation of a semisolid agar antifungal susceptibility test for yeasts and molds. J Clin Microbiol 38:537–41.
24 Ausubel FM. (2002) Short Protocols in Molecular Biology: A Compendium of Methods From Current Protocols in Molecular Biology 5th edn. (Wiley, Hoboken, NJ).
25 Brown DH Jr, Giusani AD, Chen X, et al. (1999) Filamentous growth of Candida albicans in response to physical environmental cues and its regulation by the unique CZF1 gene. Mol Microbiol 34:651–62.[CrossRef][Web of Science][Medline]
26
Kumamoto CA. (2005) A contact-activated kinase signals Candida albicans invasive growth and biofilm development. Proc Natl Acad Sci USA 102:5576–81.
27 Ramage G, Vandewalle K, Wickes BL, et al. (2001) Characteristics of biofilm formation by Candida albicans. Rev Iberoam Micol 18:163–70.[Medline]
28 Sambrook J, Fritsch EF, Maniatis T. (1989) Molecular Cloning: A Laboratory Manual 2nd edn. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY).
29
Ramage G, Vande Walle K, Wickes BL, et al. (2001) Standardized method for in vitro antifungal susceptibility testing of Candida albicans biofilms. Antimicrob Agents Chemother 45:2475–9.
30
Chandra J, Kuhn DM, Mukherjee PK, et al. (2001) Biofilm formation by the fungal pathogen Candida albicans: development, architecture, and drug resistance. J Bacteriol 183:5385–94.
31
Marchetti O, Majcherczyk PA, Glauser MP, et al. (2001) Sensitive bioassay for determination of fluconazole concentrations in plasma using a Candida albicans mutant hypersusceptible to azoles. Antimicrob Agents Chemother 45:696–700.
32
Louie A, Liu QF, Drusano GL, et al. (1998) Pharmacokinetic studies of fluconazole in rabbits characterizing doses which achieve peak levels in serum and area under the concentration-time curve values which mimic those of high-dose fluconazole in humans. Antimicrob Agents Chemother 42:1512–4.
33
Ramage G, Saville SP, Wickes BL, et al. (2002) Inhibition of Candida albicans biofilm formation by farnesol, a quorum-sensing molecule. Appl Environ Microbiol 68:5459–63.
34
Hornby JM and Nickerson KW. (2004) Enhanced production of farnesol by Candida albicans treated with four azoles. Antimicrob Agents Chemother 48:2305–7.
35
Kruppa M, Krom BP, Chauhan N, et al. (2004) The two-component signal transduction protein Chk1p regulates quorum sensing in Candida albicans. Eukaryot Cell 3:1062–5.
36
Cocuaud C, Rodier MH, Daniault G, et al. (2005) Anti-metabolic activity of caspofungin against Candida albicans and Candida parapsilosis biofilms. J Antimicrob Chemother 56:507–12.
37
Staab JF, Bradway SD, Fidel PL, et al. (1999) Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1. Science 283:1535–8.
38 Hogan DA, Vik A, Kolter RA. (2004) Pseudomonas aeruginosa quorum-sensing molecule influences Candida albicans morphology. Mol Microbiol 54:1212–23.[CrossRef][Web of Science][Medline]
39 Nobile CJ and Mitchell AP. (2006) Genetics and genomics of Candida albicans biofilm formation. Cell Microbiol 8:1382–91.[CrossRef][Web of Science][Medline]
40
Suci PA and Tyler BJ. (2002) Action of chlorhexidine digluconate against yeast and filamentous forms in an early-stage Candida albicans biofilm. Antimicrob Agents Chemother 46:3522–31.
41
Garcia-Sanchez S, Aubert S, Iraqui I, et al. (2004) Candida albicans biofilms: a developmental state associated with specific and stable gene expression patterns. Eukaryot Cell 3:536–45.
42 d'Enfert C. (2006) Biofilms and their role in the resistance of pathogenic Candida to antifungal agents. Curr Drug Targets 7:465–70.[CrossRef][Web of Science][Medline]
43
Shin JH, Kee SJ, Shin MG, et al. (2002) Biofilm production by isolates of Candida species recovered from nonneutropenic patients: comparison of bloodstream isolates with isolates from other sources. J Clin Microbiol 40:1244–8.
44
Calera JA and Calderone R. (1999) Flocculation of hyphae is associated with a deletion in the putative CaHK1 two-component histidine kinase gene from Candida albicans. Microbiology 145:1431–42.
45
Riggle PJ and Kumamoto CA. (2006) Transcriptional regulation of MDR1, encoding a drug efflux determinant, in fluconazole-resistant Candida albicans strains through an Mcm1p binding site. Eukaryot Cell 5:1957–68.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||