Skip Navigation


JAC Advance Access originally published online on February 8, 2007
Journal of Antimicrobial Chemotherapy 2007 59(3):403-410; doi:10.1093/jac/dkl491
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
59/3/403    most recent
dkl491v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Vali, L.
Right arrow Articles by Amyes, S. G. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vali, L.
Right arrow Articles by Amyes, S. G. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2007. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Antibiotic resistance and molecular epidemiology of Escherichia coli O26, O103 and O145 shed by two cohorts of Scottish beef cattle

Leila Vali1, Ahmed Hamouda1, Deborah V. Hoyle1, Michael C. Pearce2, Lucy H. R. Whitaker1, Claire Jenkins3, Hazel I. Knight2, Alastair W. Smith2 and Sebastian G. B. Amyes1,*

1 Molecular Chemotherapy, Centre for Infectious Diseases, The Chancellor's Building, 49 Little France Crescent, University of Edinburgh, Edinburgh EH16 4SB, UK 2 Scottish Agricultural College, Drummondhill, Stratherrick Road, Inverness IV2 4JZ, UK 3 Centre for Molecular Microbiology and Infection, Department of Biological Sciences, Imperial College London, London SW7 2AZ, UK


* Corresponding author. Tel: +44-131-2426461; Fax: +44-131-2429375; E-mail: s.g.b.amyes{at}ed.ac.uk

Received 10 August 2006; returned 14 September 2006; revised 2 November 2006; accepted 9 November 2006


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Transparency declarations
 References
 
Objectives: The aim of this study was to identify the profile of antibiotic resistance among E. coli O26, O103 and O145 in two cohorts of Scottish beef cattle on two farms and to determine whether there is an association between resistant phenotypes and the genotypic PFGE patterns to suggest clonality among resistant strains.

Methods: MICs of 11 antibiotics for 297 E. coli O26, 152 E. coli O103 and 13 E. coli O145 were determined. Isolates were screened for the presence integrons 1 and 2 and the virulence factors stx1, stx2, eaeA and ehxA by PCR with specific primers. PFGE subtyping was performed after digestion with XbaI endonuclease.

Results: Among E. coli O26, O103 and O145 there were four, four and one isolates, respectively, that harboured a class 1 integron. A class 2 integron was detected in only one O145 isolate. Diversity in PFGE patterns was higher among E. coli O103 and O145 strains compared with the O26 serotype; and PFGE demonstrated 13, 27 and 6 different patterns among O26, O103 and O145 isolates, respectively. Selective PFGE types that harboured virulence factors were widespread among the cattle population throughout the sampling period. There were multiply resistant isolates that were of similar PFGE patterns.

Conclusions: The dissemination and persistence of certain PFGE genotypes among the cattle population was evident in this study. Certain resistance phenotypes, especially among E. coli O26 isolates, were associated with distinct PFGE clones.

Keywords: Escherichia coli O26 , E. coli O103 , E. coli O145 , PFGE , MIC , Stx , eaeA


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Transparency declarations
 References
 
Escherichia coli is part of the normal gastrointestinal flora in humans and animals; however, certain serotypes such as O26, O103 and O145 have been associated with human and animal infections. Shigatoxin-producing Escherichia coli (STEC) O26, O103 and O145 may produce toxins Stx1 or Stx2, or both. Non-O157 STEC isolated from cattle have been associated with cattle and human urinary tract and enteric infections.1,2 In humans the clinical symptoms range from uncomplicated watery diarrhoea to haemorrhagic colitis (HC), and haemolytic uraemic syndrome (HUS).3

The pathogenic difference between STEC, enteropathogenic E. coli (EPEC) and the E. coli in normal gut flora is in their carriage of virulence factors.1 STEC isolates that carry the plasmid-encoded enterohaemolysin ehxA gene and the intimin gene eae are called EHEC (enterohaemorrhagic E. coli). Escherichia coli O26, O103 and O145 strains that lack stx1 and stx2 but carry the eae gene are categorized as EPEC, which is classified into ‘typical’ and ‘atypical’ strains: strains that are eae+ and harbour EAF plasmid (bfpA+) are classified as ‘typical’ and strains that are eae+ but do not possess the EAF plasmid are classified as ‘atypical’.4 EPECs have the ability to cause intimate attachment to epithelial cells.5,6 Over the past few years more outbreaks have been associated with non-O157 STEC isolates in humans.713 In Scotland, STEC and EPEC have been found in cattle14 and have been associated with human infections.15

Integrons and plasmids are important in dissemination of antibiotic resistance genes, especially among Gram-negative bacteria. Multiresistant integrons can carry as many as five resistance genes.16

Most studies identify the susceptibility of STEC isolates to antibacterial agents at cross-sectional levels in relation to virulence factors in cattle1721 or in clinical human isolates.22,23 However, the purpose of this surveillance study of two bovine cohorts on two Scottish farms was to identify E. coli O26, O103 and O145 strains from the faecal samples recovered, their antimicrobial resistance profiling and PFGE analysis, to determine whether the resistance phenotypes and genotypes correlate.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Transparency declarations
 References
 
Study group and sampling

Two cohorts of cattle were sampled, each on two different mixed beef and sheep farms (A and B) located 22 kilometres apart in northern Scotland. The complete sampling method and the rates of prevalence of shedding different serotypes of E. coli have been discussed previously.14 The first cohort comprised 49 calves born in the months of August to November 2001 and their 45 dams. Calves in the first cohort were sampled at birth, then weekly until the end of the sampling period in January 2002. One calf died shortly after birth and was sampled once; a second calf died 4 weeks after birth and was sampled three times. Dams of calves in the first cohort were sampled at the time of calving and at the end of the sampling period, with the exceptions of one dam which was sampled at calving only, one dam which was sampled at the end of the sampling period only, and a third dam which was sampled neither at calving nor at the end of the sampling period. The second cohort comprised 41 calves born in March to April 2004 and their 41 dams. Calves in the second cohort were sampled at birth, then weekly until the end of the sampling period in July 2004. Three calves born on farm B were transferred to farm A in July 2001; however, we are not aware of any other cattle transfers between the two farms. The farms did not share a common water source and the farmers grew their own silage. Both farms bought in concentrates and may have had a common supplier. However, we do not know if they received concentrates from a common batch at any time before or during the study. According to the farmers' records none of the animals was on antibiotics at the time of sampling.

Bacterial isolation

One gram of faeces from each sample was suspended in 20 mL of buffered peptone water (BPW), and incubated at 37°C for 6 h. Following incubation, an immunomagnetic separation (IMS) technique was performed as described previously.14 Fifty-microlitre suspensions of serogroup O26, O103 and O145 beads were plated on Chromocult TBX plates (Merck, Poole, Dorset). Plates were incubated at 37°C overnight. From each Chromocult TBX plate, colonies were tested against serogroup specific antisera (Statens Serum Institut, Copenhagen, Denmark) by a slide agglutination test.

Virulence factors

PCR was performed on all isolates in 50 µL volumes using HotStar Taq polymerase (Qiagen, UK) with primers corresponding to stx1/2, eae and ehxA as previously described.14

Minimum inhibitory concentrations

The MIC values were determined by the agar dilution method using a Denley multipoint inoculator (Denly, Billinghurst, UK) and with doubling dilutions of antibiotic solution on Iso-Sensitest Agar (Difco). Bacterial strains were grown overnight in LB broth at 37°C. A dilution of the overnight culture was made in 0.9% normal saline to an approximate concentration of 107 cfu/mL. The surface of Iso-Sensitest agar plates containing the antibacterial agents were then inoculated with a 2 µL volume of the freshly diluted bacterial suspension by a multipoint inoculator to give a final concentration of 2 x 104 cfu per spot. All plates were incubated at 37°C overnight. Pseudomonas aeruginosa NCTC 10662, E. coli NCTC 10418 and Staphylococcus aureus NCTC 6571 were used as controls on every plate.

Based within veterinary context, ß-lactams, aminoglycosides, quinolones and other antibiotics frequently used in farm animals were selected for this study. They included: ampicillin (0.015–512 mg/L), co-amoxiclav (0.015–512 mg/L), apramycin (0.015–512 mg/L), cefalexin (0.015–512 mg/L), chloramphenicol (0.015–256 mg/L), nalidixic acid (0.015–256 mg/L), neomycin (0.015–256 mg/L), streptomycin (0.015–256 mg/L), sulfamethoxazole (0.015–512 mg/L), tetracycline (0.015–128 mg/L) and trimethoprim (0.015–32 mg/L) (all from Sigma, Poole, UK). The MIC values were determined according to guidelines of the British Society for Antimicrobial Chemotherapy (BSAC)24,25 and the CLSI (formerly the NCCLS),26 with the exception of apramycin which is not used in human medicine. The MIC breakpoint for apramycin was based on previous studies performed in this laboratory.27,28

Pulsed-field gel electrophoresis

PFGE analysis was based on techniques described elsewhere.14 After PFGE, the gels were stained with ethidium bromide, and digital images of each gel were captured by Gel Doc 2000 (Bio-Rad, UK) and Bio-Rad Diversity Database software image capturing system. To normalize bands from one gel to another, a mid-range molecular weight lambda marker (New England BioLabs, UK) was included in three lanes of each gel as well as an internal E. coli O157 control on every gel. Comparison of digested profiles of isolates was performed using BioNumerics (version 4.0) software (Applied Maths, Ghent, Belgium). This software facilitated the development of the algorithms necessary for gel analysis including the comparison of profiles of isolates based on the Dice coefficient, preparation of a phylogenetic tree and cluster analysis using the hierarchical un-weighted pair arithmetic average algorithm with an optimization of 1.0% and a tolerance of 0.7%. Fragments smaller than 48.5 kb in length were not used in the analysis.

Polymerase chain reaction for detection of class 1 and 2 integrons

PCR was performed on all isolates in 50 µL volume using HotStar Taq polymerase (Qiagen, UK) with primers corresponding to intI1 and intI2 transposons as described previously.16,29 Primer sequences were as follow: Int1.F (GGGTCAAGGATCTGGATTTCG), Int1.R (ACATGCGTGTAAATCATCGTCG) and IntI2.F (CACGGATATGCGACAAAAAGGT), IntI2.R (GTAGCAAACGAGTGACGAAATG). Conditions for amplification were as follows: 95°C for 15 min, 30 cycles of 95°C for 60 s, 62°C for 60 s and 72°C for 60 s, and an additional 10 min extension at 72°C. Product sizes of 483 bp and 788 bp were observed for intI1 and intI2, respectively.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Transparency declarations
 References
 
Bacterial isolates

Table 1 shows the total number of E. coli O26, O103 and O145 detected over the sampling period and the presence of stx1, stx2, eae and ehxA. The majority of STEC detected in calves were of serogroup O26 harbouring stx1, eae and ehxA genes (228/370, 61.6%), and the majority of the E. coli O145 did not carry any of the pathogenic markers. Over the sampling period, 41.4% (55/133) animals shed more than one serogroup, either concurrently or at different sampling dates.


View this table:
[in this window]
[in a new window]

 
Table 1.. Number of faecal samples from calves and cows with E. coli O26, O103 and O145 by carriage of genes encoding shigatoxin, intimin and enterohaemolysin

 
Antibiotic susceptibility

All E. coli O26 isolates were susceptible to apramycin (MIC < 8 mg/L), cefalexin (MIC < 8 mg/L), chloramphenicol (MIC < 8 mg/L) and nalidixic acid (MIC < 16 mg/L) (Table 2). Only 2.7% of these were resistant to one of the antibiotics tested, and 2% were resistant to two or more antibiotics.


View this table:
[in this window]
[in a new window]

 
Table 2.. Percentage of resistance in the population according to the CLSI breakpoint guidelines

 
All E. coli O103 isolates were susceptible to apramycin (MIC < 8 mg/L), nalidixic acid (MIC < 16 mg/L) and neomycin (MIC < 8 mg/L). Of these, 49.3% were resistant to at least one antibiotic tested and 8.6% were resistant to two or more antibiotics (Table 3).


View this table:
[in this window]
[in a new window]

 
Table 3.. Resistant Escherichia coli isolates, with their antibiotic resistance phenotypes, virulence markers and PFGE types

 
All E. coli O145 isolates were susceptible to apramycin (MIC < 8 mg/L), cefalexin (MIC < 8 mg/L), chloramphenicol (MIC < 8 mg/L) and nalidixic acid (MIC < 16 mg/L) (Table 2). Resistance to at least one antibiotic tested was observed in 61.5% strains and multidrug resistance was found in 30.8% isolates (Table 3).

PFGE patterns

We detected 13 different PFGE patterns for E. coli O26 after restriction with the XbaI enzyme (Figure 1). On farm A, from August 2001 to January 2002, seven different PFGE patterns [A_O26 (1.05%), B_O26 (1.05%), C_O26 (4.2%), E_O26 (1.05%), F_O26 (1.05%), H_O26 (1.05%) and K_O26 (90.5%)] were detected. PFGE type K_O26 was the most prevalent during this sampling period. Most (93%) of the PFGE type K_O26 contained stx1, eae and ehxA genes. During the sampling period on farm B from March 2004 to July 2004, seven patterns were identified by PFGE. These included D_O26 (5.4%), G_O26 (10.9%), I_O26 (1.8%), K_O26 (50.9%), L_O26 (27.3%), O_O26 (1.8%) and T_O26 (1.8%); 1.8% were non-typeable. Type K_O26 was also the most the dominant type on farm B.


Figure 1
View larger version (55K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1.. Relationship between the PFGE banding patterns after digestion with XbaI endonuclease for the Escherichia coli O26 strains showing the percentage similarity between group types and clustered using DICE/UPGMA with an optimization of 1.0% and a tolerance of 0.7%.

 
We observed that 11/40 (27.5%) of the calves that were sampled at different times and shed E. coli O26 displayed different PFGE patterns at consecutive sampling dates (Table 4). A particular example was a calf from farm B (B-129) which was sampled three times within the 6 week sampling frame and each time a different pattern was observed.


View this table:
[in this window]
[in a new window]

 
Table 4.. PFGE banding patterns of 23 Escherichia coli O26 and 22 E. coli O103 isolates from 11 and 10 calves, respectively, at different sampling dates, after digestion with XbaI endonuclease with the banding group types and their virulence factors

 
PFGE with XbaI on E. coli O103 strains revealed 27 different patterns (Figure 2). Thirty isolates were non-typeable with PFGE. On farm A, 23 PFGE patterns were detected and 5 on farm B. We observed that 10/26 (3.8%) calves that were sampled at least two times and shed E. coli O103 over the sampling period displayed different PFGE patterns at consecutive sampling dates (Table 4). An example is a calf from farm A (A-515) that shed isolates with different PFGE types.


Figure 2
View larger version (69K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2.. Relationship between the PFGE banding patterns after digestion with XbaI endonuclease for the Escherichia coli O103 strains showing the percentage similarity between group types and clustered using DICE/UPGMA with an optimization of 1.0% and a tolerance of 0.7%.

 
There were six different PFGE patterns with the XbaI restriction enzyme for E. coli O145 (Figure 3).


Figure 3
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3.. Relationship between the PFGE banding patterns after digestion with XbaI endonuclease for the Escherichia coli O145 strains showing the percentage similarity between group types and clustered using DICE/UPGMA with an optimization of 1.0% and a tolerance of 0.7%.

 
Class 1 and 2 integrons

Four E. coli O26 isolates were found to carry a class 1 integron, and none carried a class 2 integron. One of the multiresistant isolates was non-typeable with PFGE (Table 3).

A class 1 integron was also detected in four E. coli O103 isolates (Table 3). Two of these (7199 M and 7235 M) having antibiotic resistance pattern ampicillin/co-amoxiclav/tetracycline/trimethoprim were of PFGE type P_O103, and two others (7174 M and 7187 M) having the core resistance profile of neomycin/streptomycin/tetracycline/trimethoprim were typed as H_O103.

Among multiresistant E. coli O145, a class 1 integron was detected in one isolate harbouring stx1, eae and ehxA; however, it was non-typeable with PFGE. A class 2 integron was also detected in one streptomycin- and trimethoprim-resistant E. coli O145 that was PFGE type F_O145.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Transparency declarations
 References
 
Escherichia coli O26, O103 and O145 strains are important zoonotic pathogens; therefore the emergence or the dissemination of antibiotic resistance genes among the bacterial flora of food-producing animals as well as in clinical settings are significant. Previous studies on antibiotic resistance among E. coli serotypes O26, O103 and O145 have involved reports on the prevalence of antibiotic resistance and the prevalence of virulence factors.19,21 The aim of this study was to determine whether an association existed between antibiotic-resistant E. coli O26, O103 and O145 isolates and their PFGE patterns in cohorts of Scottish beef cattle.

Over the sampling period, 41.4% of animals shed more than one serogroup either concurrently or at different sampling dates, suggesting the simultaneous shedding of more than one strain.20,30

The interpretation of the susceptibility results for some antibiotics can vary a great deal, depending on the application of BSAC or CLSI guidelines for the relevant breakpoints. In general, the BSAC suggested breakpoints, while comparing favourably with other European standards,31 are conservative to those suggested by the American organization—the CLSI guidelines. The CLSI (NCCLS 2001) recommendations would result in a lower prevalence of resistance to certain antimicrobials. Given that this is part of a British study, and the isolates were collected in Scotland, the BSAC breakpoints should have been applied to this study. However for comparative purposes we have applied the CLSI breakpoints.

In general, resistance to antibiotics is less widespread in Scotland compared with other countries where studies have been made.18,19 The reason for the lower prevalence might be the impact of farm management. In the USA, 50% of E. coli shed by the food-producing animals are resistant to antibiotics. In Brazil, from 1976 to 1999, resistance to at least one antibiotic was identified in 51.7% of the STEC strains in humans.23

Overall among E. coli O26 isolates on the two farms during the sampling periods, PFGE type K_O26 was the dominant type. The persistence or frequent re-infection was clearly evident; however, the reason for the persistence from 2001 to 2004 on two different farms, which did not interact, was unclear, although environmental factors such as changes in housing and feed might play a crucial role.32,33 It will be interesting to observe in a comprehensive study if this type is detected on different farms in Scotland and if it has been associated with human infections.

In this study, PFGE demonstrated that compared to serogroup O26, E. coli O103 is genetically more diverse. In cattle populations the genetic diversity is not only dependent on virulence factors, and thus environmental dynamics are also crucial to the serotype's diversity and the ability to disseminate and persist among cattle populations.

Resistance to antibiotics in Enterobacteriaceae can be caused by mutation or spread by horizontal transfer of mobile DNA elements such as plasmids, transposons and integrons.18 Integrons have the ability to capture antibiotic resistance genes by site-specific recombination. Based on the type of integrase gene, five integron classes have been described to date.34 This study and several others11,18,29 demonstrated that integrons are present in STEC strains which confer resistance to antibiotics. Class 1 integrons containing sulI (sulphonamide resistance), aadA1 (streptomycin resistance) and/or dfrA1 (trimethoprim resistance)11,18 are widely disseminated. Class 2 integrons are associated with Tn7 and carry three gene cassettes: dfrA1, sat1 and aadA1, which confer resistance to trimethoprim, streptothricin and streptomycin/spectinomycin, respectively. Class 1 and 2 integrons are the most common for antibiotic resistance among some multiresistant strains.

Most (66.7%) of the multiresistant E. coli O26 strains in this study contained a class 1 integron and all, except for one strain that could not be typed by PFGE, resembled PFGE pattern G_O26. This is of particular interest regarding the clonality of multidrug resistance in community bacteria. Diversity in PFGE genotypes was more noticeable in E. coli O145 strains. Unfortunately, the number of detected E. coli O145 on the two sampled farms was too low to draw any meaningful conclusions. Several isolates displayed resistance to multiple antibiotics but did not contain any gene cassettes conferring resistance; therefore other mechanisms contribute to the antibiotic resistance.18 It has previously been shown that the age of the cattle is an important factor in the prevalence of resistant commensal faecal E. coli where generally the younger animals display more resistance than isolates from the older animals.27,35,36

In conclusion, we identified antimicrobial resistance among E. coli O26, O103 and O145 in a bovine reservoir on two beef cattle farms in Scotland. Notably, the diversity in PFGE types among E. coli O26 was less than the rapidly changing populations of E. coli O103 and O145. Among E. coli O26 and O103, some antibiotic resistance phenotypes were specific to defined clones. The dissemination and persistence of selective PFGE genotypes among cattle population was evident in this study. It will be interesting to demonstrate if such clones have been associated with human infections.


    Transparency declarations
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Transparency declarations
 References
 
None to declare.


    Acknowledgements
 
We would like to acknowledge Dr Margo Chase-Topping for her assistance in the sampling section. This study is a part of the International Partnership Research Award in Veterinary Epidemiology (IPRAVE), Epidemiology and Evolution of Enterobacteriaceae Infections in Humans and Domestic Animals, funded by the Wellcome Trust (grant no. 073958/A/03/Z).


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Transparency declarations
 References
 
1 Bettelheim KA. (2003) Non-O157 verotoxin-producing Escherichia coli: a problem, paradox, and paradigm. Exp Biol Med 228:333–44.[Abstract/Free Full Text]

2 Scotland SM, Willshaw GA, Smith HR, et al. (1993) Virulence properties of Escherichia coli strains belonging to serogroup O26, O55, O111, and O128 isolated in the United Kingdom in 1991 from patients with diarrhoea. Epidemiol Infect 111:429–38.[Medline]

3 Karmali MA. (1989) Infection by verocytotoxin-producing Escherichia coli. Clin Microbiol Rev 2:15–38.[Abstract/Free Full Text]

4 Kaper JB. (1996) Defining EPEC. Rev Microbiol 27:130–3.

5 Nataro JP and Koper JB. (1998) Diarrheagenic Escherichia coli. Clin Microbiol Rev 11:142–201.[Abstract/Free Full Text]

6 Oswald E, Schmidt H, Morabito S, et al. (2000) Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: Characterization of a new intimin variant. Infect Immun 68:64–71.[Abstract/Free Full Text]

7 Mariani-Kurdkdjian P, Denamur E, Milon A, et al. (1993) Identification of a clone of Escherichia coli O103:H2 as a potential agent of hemolytic uremic syndrome in France. J Clin Microbiol 31:296–301.[Abstract/Free Full Text]

8 Tarr PI, Fouser LS, Stapleton AE, et al. (1996) Hemolytic-uremic syndrome in a six year old girl after a urinary tract infection with shiga-toxin producing Escherichia coli O103:H2. New Engl J Med 335:635–8.[Free Full Text]

9 Bonnet R, Souweine B, Gauthier G, et al. (1998) Non-O157:H7 Stx2-producing Escherichia coli strains associated with sporadic cases of haemolytic-uremic syndrome in adults. J Clin Microbiol 36:1777–80.[Abstract/Free Full Text]

10 Thran BH, Hussein HS, Hall MR, et al. (2001) Shigatoxin-producing Escherichia coli in beef heifers grazing an irrigated pasture. J Food Prot 64:1613–16.[Web of Science][Medline]

11 Maidhof H, Guerra B, Abbas S, et al. (2002) A multiresistant clone of shiga toxin-producing Escherichia coli O118:[H16] is spread in cattle and humans over different European countries. Appl Environ Microbiol 68:5834–42.[Abstract/Free Full Text]

12 Werber D, Fruth A, Liesegang A, et al. (2002) A multistate outbreak of Shiga toxin-producing Escherichia coli O26:H11 infections in Germany, detected by molecular subtyping surveillance. J Infect Dis 186:419–22.[CrossRef][Web of Science][Medline]

13 Sonntag A-KR, Prager M, Bielaszewska W, et al. (2004) Phenotypic and genotypic analyses of enterohemorrhagic Escherichia coli O145 strains from patients in Germany. J Clin Microbiol 42:954–62.[Abstract/Free Full Text]

14 Pearce MC, Jenkins C, Vali L, et al. (2004) Temporal shedding patterns and virulence factors of Escherichia coli serogroups O26, O103, O111, O145 and O157 in a cohort of beef calves and their dams. Appl Environ Microbiol 70:1708–16.[Abstract/Free Full Text]

15 Locking M, Allison L, Rae L, et al. (2004) VTEC in Scotland 2003: enhanced surveillance and reference laboratory data. Scott Centr Infect Environ Health Wkly Rep 38:294–7.

16 Mazel D, Dychinco B, Webb VA, et al. (2000) Antibiotic resistance in the ECOR collection: Integrons and identification of a novel aad gene. Antimicrob Agents Chemother 44:1568–74.[Abstract/Free Full Text]

17 Stephan R and Schumacher S. (2001) Resistance patterns of non-O157 shiga toxin-producing Escherichia coli (STEC) strains isolated from animals, food and asymptomatic human carriers in Switzerland. Lett Appl Microbiol 32:114–17.[CrossRef][Web of Science][Medline]

18 Zhao S, White DG, Ge B, et al. (2001) Identification and characterization of integron-mediated antibiotic resistance among shiga toxin-producing Escherichia coli isolates. Appl Environ Microbiol 67:1558–64.[Abstract/Free Full Text]

19 Schroeder CM, Meng J, Zhao S, et al. (2002) Antimicrobial resistance of Escherichia coli O26, O103, O111, O128, and O145 from animals and humans. Emerg infect Dis 8:1409–14.[Web of Science][Medline]

20 Blanco J, Blanco M, Blanco JE, et al. (2003) Verotoxin-producing Escherichia coli in Spain: prevalence, serotypes, and virulence genes of O157:H7 and non-O157 VTEC in ruminants, raw beef products, and humans. Exp Biol Med 228:345–51.[Abstract/Free Full Text]

21 Mora A, Blanco JE, Blanco M, et al. (2005) Antimicrobial resistance of shiga toxin (verotoxin)-producing Escherichia coli O157:H7 and non-O157 strains isolated from humans, cattle, sheep and food in Spain. Res in Microbiol 156:793–806.[CrossRef]

22 Beutin L, Krause G, Zimmermann S, et al. (2004) Characterization of shiga toxin-producing Escherichia coli strains isolated from human patients in Germany over a 3-year period. J Clin Microbiol 42:1099–108.[Abstract/Free Full Text]

23 Vaz TMI, Irino K, Kato MAMF, et al. (2004) Virulence properties and characteristics of shiga toxin-producing Escherichia coli in São Paulo, Brazil, from 1976 through 1999. J Clin Microbiol 42:903–5.[Abstract/Free Full Text]

24 Andrews JM. (2001) Determination of minimum inhibitory concentrations. J Antimicrob Chemother 48:Suppl 1, 5–16.[Abstract]

25 Andrews JM. (2005) BSAC standardized disc susceptibility testing method (version 4). J Antimicrob Chemother 56:60–76.[Free Full Text]

26 National Committee for Clinical Laboratory Standards. (2001) Performance Standards for Antimicrobial Susceptibility Testing-Tenth Informational Supplement. M100-S11(NCCLS, Wayne, PA, USA).

27 Hoyle DV, Knight HI, Shaw DJ, et al. (2004) Acquisition and epidemiology of antibiotic-resistant Escherichia coli in a cohort of newborn calves. J Antimicrob Chemother 53:867–71.[Abstract/Free Full Text]

28 Yates CM, Pearce MC, Woolhouse MEJ, et al. (2004) High frequency transfer and horizontal spread of apramycin resistance in calf faecal Escherichia coli. J Antimicrob Chermother 54:534–7.[Abstract/Free Full Text]

29 Sánez Y, Briñas L, Domínguez E, Ruiz J, et al. (2004) Mechanisms of resistance in multiple-antibiotic-resistant Escherichia coli strains of human, animal, and food origins. Antimicrob Agents Chemother 48:3996–4001.[Abstract/Free Full Text]

30 Orden JA, Cid D, Ruiz-Santa-Quiteria JA, et al. (2002) Verotoxin-producing E. coli (EPEC), and necrotoxigenic E. coli (NTEC) isolated from healthy cattle in Spain. J Appl Microbiol 93:29–35.[CrossRef][Medline]

31 Degener JE and Phillips I. (2001) Comparison of antimicrobial susceptibility test breakpoints of national societies. Clin Microbiol Infect 7:51–4.[CrossRef][Web of Science][Medline]

32 Gannon VPJ, Graham TA, King R, et al. (2002) Escherichia coli O157:H7 infection in cows and calves in a beef cattle herd in Alberta, Canada. Epidemiol Infect 129:163–72.[CrossRef][Medline]

33 Vali L, Pearce MC, Wisely KA, et al. (2005) A comparison between the diversity of Escherichia coli O157 shed from a cohort of spring born beef calves at pasture and in housing. Appl Environ Microbiol 71:1648–52.[Abstract/Free Full Text]

34 Collis CM, Kim MJ, Partfidge HW, et al. (2002) Characterization of the class 3 integron and the site-specific recombination system it determines. J Bacteriol 184:3017–26.[Abstract/Free Full Text]

35 Hoyle DV, Shaw DJ, Knight HI, et al. (2004) Age-related decline in the carriage of ampicillin-resistant Escherichia coli in young calves. Appl Environ Microbiol 70:6927–30.[Abstract/Free Full Text]

36 Khachatryan AR, Hancock DD, Besser TE, et al. (2004) Role of calf-adapted Escherichia coli in maintenance of antimicrobial drug resistance in dairy calves. Appl Envriron Microbiol 70:725–57.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
59/3/403    most recent
dkl491v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Vali, L.
Right arrow Articles by Amyes, S. G. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vali, L.
Right arrow Articles by Amyes, S. G. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?