JAC Advance Access originally published online on January 4, 2007
Journal of Antimicrobial Chemotherapy 2007 59(2):323-324; doi:10.1093/jac/dkl487
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Correspondence |
Spread of Enterobacteriaceae carrying the PER-1 extended-spectrum ß-lactamase gene as a chromosomal insert: a report from Italy
1 Dipartimento di Scienze e Tecnologie Biomediche, Università di L'Aquila, I-67100 L'Aquila, Italy 2 Dipartimento di Biologia Molecolare, Laboratorio di Fisiologia e Biotecnologia dei Microrganismi, Università di Siena, I-53100 Siena, Italy 3 Laboratorio di Microbiologia, Ospedale di Circolo e Università dell'Insubria, I-21100 Varese, Italy 4 Dipartimento di Scienze Microbiologiche e Ginecologiche, Università di Catania, I-95124 Catania, Italy
* Corresponding author. Tel: +39-0862-433455; Fax: +39-0862-433433; E-mail: amicosante{at}cc.univaq.it
Keywords: ESBL , ß-lactam resistance , PER-1
Nowadays, therapeutic failure and increased hospital costs are associated with serious infections caused by PER-1-positive isolates of Enterobacteriaceae.1 PER-1 extended-spectrum ß-lactamase (ESBL), first detected in a Pseudomonas aeruginosa clinical isolate, has also been reported in Alcaligenes faecalis and Proteus mirabilis.2,3
In this study, hospital- and community-acquired ESBL producers were investigated by colony-blot hybridization, using random-primed 32P-labelled DNA probes for blaTEM-, blaSHV-, blaPER- and blaCTX-M-type genes and subjected to exhaustive sequencing of identified allelic variants. Particularly, the primers used to study the nature of blaPER and blaTEM alleles were as follows: PER-1/F (5'-ATGAATGTCATTATA AAAGCT) and PER-1/R (5'-TTAATTTGGGCTTAGGG), and TEM/F (5'-ATGAGTATTCAACATTTCCG) and TEM/R (5'- TTACCAATGCTTAATCAGTGAG), respectively. All PCR reactions were performed in a 100 µL volume using 2 µL of a crude bacterial lysate obtained by boiling bacterial suspension (A600 0.15) in sterile distilled water for 10 min as template. The PCR amplicons were directly sequenced on both strands, on two independent amplification products for each isolate, using an ABI PRISM 310 DNA Sequencer (Applied Biosystems, Applera Italia). PER-1-producing isolates were investigated by PFGE analysis and genomic DNA was prepared in agarose plugs as previously described,4 with the following modifications: bacterial cells [optical density (OD600) 0.7–1.0] were embedded in 2% low-melting-point agarose (LMPA) in SE buffer (75 mM NaCl, 25 mM EDTA, pH 7.5), followed by double protein digestion at 50°C for 16 h in ES proteolysis buffer (0.5 M EDTA, pH 9.0; 1% N-lauryl-sarcosine; 1 mg/mL proteinase K). The plugs were washed with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to remove excess proteinase K and stored at 4°C. DNA was digested with 40 U of SmaI (BioLabs, New England) at 30°C overnight. PFGE analysis of SmaI profiles was carried out in a CHEF-DR® II apparatus (Bio-Rad, CA, USA) at 14°C using a switch time of 0.5–15 s at 6 V/cm for 17 h. Similarities among SmaI macrorestriction patterns were identified according to established criteria.5 Conjugation experiments were carried out in Mueller–Hinton broth (Difco Laboratories, Detroit, MI, USA) using E. coli K-12 as a recipient and an initial donor/recipient ratio of 1 to 10. Transconjugants were selected on Mueller–Hinton agar with cefotaxime (16 mg/L) plus streptomycin (1000 mg/L). MICs of various antibiotics were determined by Etest (AB Biodisk, Solna, Sweden) according to CLSI guidelines,6 with Escherichia coli ATCC 25922 as a quality control strain.
Overall, 15/583 isolates were found to be PER-1 positive (2.6% of total strains). Isolates included: Providencia stuartii (n = 8), P. mirabilis (n = 5), Providencia rettgeri (n = 1) and E. coli (n = 1). PER-1-positive strains were detected in 5/11 hospitals located in different Italian regions. Most isolates were obtained from urinary or lower respiratory tract infections and both community and hospitalized patients were involved. Two isolates of P. stuartii and one of E. coli harboured the blaPER gene only, whereas the remaining 12/15 isolates also carried blaTEM genes [TEM-1 (n = 6), TEM-2 (n = 4) and TEM-5 (n = 2)]. A large plasmid was extracted from isolates carrying both blaTEM and blaPER-1 genes and transferability was assayed for all strains. In contrast, no plasmids were detected in the two P. stuartii isolates carrying the PER-1 determinant only. In a Southern-blot experiment, carried out on nylon filters, the blaPER-1 probe yielded a hybridization signal corresponding to the chromosomal DNA band for P. mirabilis, P. stuartii and P. rettgeri. No hybridization signal was observed with plasmidic DNA bands that, instead, were positive when using the blaTEM probe (data not shown). Plasmids were inserted by transformation experiments into E. coli HB101 competent cells to verify that only TEM-type ß-lactamases were plasmid-encoded whereas PER-1 was chromosome-encoded.
The resistance phenotype of isolates was evaluated using the following antibiotics: amoxicillin/clavulanic acid, piperacillin/tazobactam, cefoxitin, cefotaxime, ceftazidime, cefepime, imipenem, meropenem, amikacin, gentamicin and ciprofloxacin. Isolates were consistently resistant to amoxicillin/clavulanate, ceftazidime and gentamicin, while they were always susceptible to piperacillin/tazobactam and meropenem; some strains were also resistant to cefotaxime (Table 1). Susceptibility to other antibiotics varied depending on the species.
|
The analysis of PFGE profiles revealed that strains of P. mirabilis recovered in the same hospital were closely related, but different from those obtained in other cities. The eight P. stuartii isolates collected in the same hospital were clonally related.
Overall, PER-1 ESBL-producing Enterobacteriaceae appear to be emerging in Italy. Adequate surveillance and monitoring are mandatory to avoid further spread of this resistance determinant.
None to declare.
Acknowledgements
This work was supported by grants to G. A. from PRIN 2004 and MURST 60% from the MIUR (Ministero dell'Istruzione, dell'Universita e della Ricerca). We wish to thank Wyeth Lederle Italia for an educational grant.
References
1 Endimiani A, Luzzaro F, Pini B, et al. (2006) Pseudomonas aeruginosa bloodstream infections: risk factors and treatment outcome related to the expression of the PER-1 extended-spectrum ß-lactamase. BMC Infect Dis 6:52.[CrossRef][Medline]
2 Pereira M, Perilli M, Mantengoli E, et al. (2000) PER-1 extended-spectrum ß-lactamase production in an Alcaligenes faecalis clinical isolate resistant to expanded-spectrum cephalosporins and monobactams from a hospital in Northern Italy. Microb Drug Resist 6:85–90.[Web of Science][Medline]
3
Luzzaro F, Mezzatesta M, Mugnaioli C, et al. (2006) Trends in production of extended-spectrum ß-lactamases among enterobacteria of medical interest: report of the second Italian nationwide survey. J Clin Microbiol 44:1659–64.
4 Cassone M, Campanile F, Pantosti A, et al. (2004) Identification of a variant ‘Rome clone’ of methicillin-resistant Staphylococcus aureus with decreased susceptibility to vancomycin, responsible for an outbreak in an intensive care unit. Microb Drug Resist 10:43–9.[CrossRef][Web of Science][Medline]
5 Tenover FC, Arbeit RD, Goering RV, et al. (1995) Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33:2233–9.[Web of Science][Medline]
6 Clinical and Laboratory Standards Institute. (2005) Performance Standards for Antimicrobial Susceptibility Testing M100-S15(CLSI, Wayne, PA, USA).
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Iabadene, C. Dallenne, Y. Messai, D. Geneste, R. Bakour, and G. Arlet Emergence of Extended-Spectrum {beta}-Lactamase PER-1 in Proteus vulgaris and Providencia stuartii Isolates from Algiers, Algeria Antimicrob. Agents Chemother., September 1, 2009; 53(9): 4043 - 4044. [Full Text] [PDF]
|
|
|
|
 |
|
 L. Poirel, T. Bruderer, R. Frei, S. Bernabeu, P. Graber, and P. Nordmann Multidrug-resistant Providencia stuartii expressing extended-spectrum {beta}-lactamase PER-1, originating in Kosovo J. Antimicrob. Chemother., June 1, 2008; 61(6): 1392 - 1393. [Full Text] [PDF]
|
|
|
|
 |
|
 J. Empel, K. Filczak, A. Mrowka, W. Hryniewicz, D. M. Livermore, and M. Gniadkowski Outbreak of Pseudomonas aeruginosa Infections with PER-1 Extended-Spectrum {beta}-Lactamase in Warsaw, Poland: Further Evidence for an International Clonal Complex J. Clin. Microbiol., September 1, 2007; 45(9): 2829 - 2834. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||