Skip Navigation


JAC Advance Access originally published online on December 5, 2006
Journal of Antimicrobial Chemotherapy 2007 59(1):51-58; doi:10.1093/jac/dkl455
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
59/1/51    most recent
dkl455v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Liu, R.
Right arrow Articles by Negro, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, R.
Right arrow Articles by Negro, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

In vitro antiviral activity of SCH446211 (SCH6), a novel inhibitor of the hepatitis C virus NS3 serine protease

Rong Liu1,*, Karim Abid2, John Pichardo1, Valerio Pazienza3, Paul Ingravallo1, Rong Kong1, Sony Agrawal1, Stephane Bogen4, Anil Saksena4, Kuo-Chi Cheng5, Andrew Prongay4, F. George Njoroge4, Bahige M. Baroudy1 and Francesco Negro2,3

1 Department of Virology, Schering-Plough Research Institute Kenilworth, NJ 07033, USA 2 Divisions of Gastroenterology and Hepatology, University Hospital Geneva, Switzerland 3 Clinical Pathology, University Hospital Geneva, Switzerland 4 Chemical Research, Schering-Plough Research Institute, Kenilworth NJ 07033, USA 5 Drug Metabolism, Schering-Plough Research Institute Kenilworth, NJ 07033, USA


*Corresponding author. Tel: +1-908-740-3031; Fax: +1-908-740-3032; E-mail: Rong.Liu{at}spcorp.com

Received 29 June 2006; returned 5 September 2006; revised 15 September 2006; accepted 4 October 2006


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Background: Current hepatitis C virus (HCV) therapies may cure ~60% of infections. They are often contraindicated or poorly tolerated, underscoring the need for safer and more effective drugs. A novel, {alpha}-ketoamide-derived, substrate-based inhibitor of the HCV serine protease (SCH446211) was developed. Compared with earlier reported inhibitors of similar chemical class, it has a P1'–P2' extension which provides extended interaction with the protease active site. The aim of this study was to evaluate the in vitro antiviral activity of SCH446211.

Methods: Binding constant of SCH446211 to HCV NS3 protease was measured with the chromogenic substrate in vitro cleavage assay. Cell-based activity of SCH446211 was evaluated in replicon cells, which are Huh-7 hepatoma cells stably transfected with a subgenomic HCV RNA as reported previously. After 72 h of incubation with SCH446211, viral transcription and protein expression were measured by real-time RT–PCR (TaqMan), quantitative in situ hybridization, immunoblot and indirect immunofluorescence.

Results: The binding constant of SCH446211 to HCV NS3 protease was 3.8 ± 0.4 nM. HCV replication and protein expression were inhibited by SCH446211 in replicon cells as consistently shown by four techniques. In particular, based on quantitative real-time RT–PCR measurements, the IC50 and IC90 of SCH446211 were estimated to be 40 ± 20 and 100 ± 20 nM (n = 17), respectively. Long-term culture of replicon cells with SCH446211 reduced replicon RNA to <0.1 copy per cell. SCH446211 did not show cellular toxicity at concentrations up to 50 µM.

Conclusions: SCH446211 is a potent inhibitor of HCV protease in vitro. Its extended interaction with the HCV NS3 protease active site is associated with potent in vitro antiviral activity. This observation is potentially a useful guide for development of future potent inhibitors against HCV NS3 protease.

Keywords: chronic hepatitis , antiviral therapy , HCV replicon , in situ hybridization


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Chronic infection with hepatitis C virus (HCV) affects 170 million people worldwide. HCV shows a remarkable tendency to establish persistent infections and chronic liver disease, ultimately leading to cirrhosis and hepatocellular carcinoma.1 Current standard therapy with peg-interferon and ribavirin has a sustained virological response (SVR) rate of 70–80% in genotypes 2 or 3 in 24 weeks of therapy.2 Its results are less satisfactory with genotype 1, SVR is ~50% and requires longer treatment (48 weeks), although a 24 week schedule has been shown to be effective in a subgroup of patients with low viral load who achieved very rapid virological response.3 Both interferon-{alpha} (IFN-{alpha}) and ribavirin cause significant side effects, often leading to dose reduction or premature discontinuation of therapy. Lack of a complete virological response, relapse and toxicity concerns still represent major barriers to treatment in a substantial proportion of patients. Thus, more effective and better tolerated drugs are needed to treat chronic hepatitis C.

HCV is a member of the Flaviviridae family with a positive-stranded RNA genome of ~9.6 kb.4 Its genome encodes a 3000 amino acid polyprotein, which is processed co- or post-translationally by host and viral proteases.5 The NS3 serine protease, comprising the 189 N-terminal amino acids of protein NS3, is essential to HCV replication. It forms a heterodimer with NS4A, which is a cofactor for protease activity. Following the cis cleavage of NS3-NS4A site, NS3 protease cleaves the NS4A-NS4B, NS4B-NS5A and NS5A-NS5B sites to release the non-structural proteins.610 The NS3 serine protease is constituted of two six-stranded ß-barrel trypsin-like folds, defining a crevice in which substrate interactions with the catalytic triad take place.11,12 The shallowness and solvent accessibility of this pocket have made the development of effective inhibitors a challenging task.

The lack of a robust tissue culture system and a small animal model had hindered the pre-clinical evaluation of HCV inhibitors. The recent development of in vitro HCV infection systems1315 will provide an opportunity to evaluate HCV inhibitors in the entire HCV life cycle. Earlier development of HCV replicon has proved to be an invaluable tool to evaluate new inhibitors of HCV replication.1618 Recently, proof-of-concept clinical trials were reported with HCV NS3 protease inhibitors BILN-2061, VX-950 and SCH503034.1921 All these three compounds have submicromolar IC90 in the replicon assay and markedly reduced serum viral load in patients chronically infected with HCV. Resistance mutations against each of these inhibitors were developed. A156T/V conferred strong resistance to all three compounds, while D168V was resistant to BILN2061 and remained sensitive to VX-950 and SCH503034. The overlapping and distinct resistance profiles emphasizes the importance in versatility of inhibitors to optimize potency and reduce the emergence of resistance. Here, we report the in vitro antiviral activity of SCH446211 (SCH6), a new ketoamide peptidomimetic inhibitor of NS3. Our results demonstrate that SCH446211 is a potent inhibitor of HCV protease in vitro. Its extended interaction with HCV NS3 protease is associated with potent in vitro antiviral activity and its resistance profile is also discussed.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
HCV NS3/NS4A protease chromogenic assay

The continuous chromogenic assay for HCV protease was reported previously.22 Briefly, protease NS4A21–32-GSGS-NS33–181 was added to assay buffer containing peptide substrate linked to chromophore Ac-DTEDVVP(Nva)-O-PAP. The peptide sequence is derived from the NS5A-NS5B junction where the C-terminal group is coupled to chromophoric phenylazophenol (PAP). Serial diluted inhibitor was mixed with protease. The assay was performed at 30°C in 96-well microtitre plates. The reactions were monitored at 30 s intervals for 1 h by reading the absorbance at 370 nm in a Spectromax Plus microtitre plate reader (Molecular Devices, Sunnyvale, CA, USA). The data were fitted to the two-step slow-binding inhibition model of Morrison and Walsh P = vst + (v0 vs)(1 – ekt)/k using SAS version 8.0 (SAS Institute Inc.) The overall Formula was calculated from the estimated steady-state velocities Formula.

Replicon cells and treatment with SCH446211

The replicon cell clone 16 contains identical HCV replicon RNA sequences as reported,16 except for the incorporation of adaptive mutation(s) S1179I.17 The replicon clones were generated by transfection of replicon RNA followed by 0.5 mg/mL of G418 selection. The replicon cells were routinely maintained with DMEM medium supplemented with 4 mM L-glutamine, 1.8 mM sodium bicarbonate, 1x non-essential amino acids and 1 mM sodium pyruvate (Mediatech, VA, USA) on collagen-coated plates (BD Biosciences Pharmingen, CA, USA).

For real-time RT–PCR (TaqMan), 4000 cells were seeded in a 96-well plate in DMEM medium containing 0.5 mg/mL of G418. SCH446211 was added to the medium in concentrations from 5 µM to 10 nM in the presence of 5% FCS, 0.5 µg/mL of G418 and 0.5% DMSO. SCH446211 and medium were refreshed every day for 72 h.

For in situ hybridization, immunoblot and immunofluorescence, replicon cells were plated at 3 x 105 cells per 100 mm tissue culture dish. After 24 h, SCH446211 was added to the cells at final concentrations of 50, 100 and 500 nM with 10% fetal bovine serum, 0.5% DMSO and 1 mg/mL of G418 (all from Invitrogen, Basel, Switzerland). SCH446211 was refreshed every 24 h. After 72 h, the cells were trypsinized and processed.

Real-time RT–PCR

The 96-well plates were aspirated and washed. Cell-cDNA buffer (Ambion, TX, USA) (30 µL) was added to each well and heated at 75°C for 5 min. Lysate (1 µL) was added to real-time RT–PCR (TaqMan) reactions containing 1x RT–PCR master mix (Applied Biosystems, CA, USA), RNase inhibitor, 50 µM 5B forward (5'ATGGACAGGCGCCCTGA) and reverse (5'TTGATGGGCAGCTTGGTTTC) primers, 5B probe (5'CACGCCATGCGCTGCGG-FAM) and 1x GAPDH primer and probe mixture (Applied Biosystems). The PCR reactions were run on an ABI PRISM 7900HT Sequence Detection System using the following program: 48°C for 30 min, 95°C for 10 min, and 40 cycles of 95°C for 15 s followed by 60°C for 1 min. Amplification of HCV RNA was linear over five logs and the detection sensitivity was estimated to be 500 RNA copies per reaction with cell lysate and 10 copies per reaction with purified RNA.

The difference in cycle numbers (CT) needed to amplify the NS5B and GAPDH to the threshold level ({Delta}CT), was plotted against the log of compound concentrations and fitted to the sigmoid dose–response model using SAS version 8.0 (SAS Institute) or PRISM (Graphpad Software Inc.). IC50 and IC90 indicate the drug concentrations needed to achieve 2-fold (50%) and 10-fold (90%) inhibition, respectively, compared with no treatment.

HCV RNA by in situ hybridization

Cells were collected in 150 µL of PBS after drug treatment; 20 µL (~50 000 cells) was layered onto poly-L-lysine-coated slides (Kindler GmbH & Co. Freiburg, Germany) and dried. The slides were fixed, washed and denatured. NS3 coding region was cloned into pGM vector under the T7 promoter, linearized with SpeI (Promega, Catalys AG, Wallisellen, Switzerland) and used for in vitro synthesis of 1028 base long, [35S]CTP-labelled RNA of antigenomic polarity, according to standard protocols (specific activity: 0.1–0.2 x 108 cpm/µg of RNA). The in situ hybridization procedure followed standard protocols. Cells were stained with H&E and visually inspected for autoradiographic silver grain density assessment. At least 20 cells were counted by two independent observers, and results expressed as mean (±SD) autoradiographic silver grain number per cell, after subtracting the average grain number per untransfected cell, hybridized and processed in parallel. Differences between experiments were assessed by the Student's t-test.

Antibodies

A rabbit polyclonal antibody was raised against NS3 protein. A monoclonal antibody 5B-3B1 directed against HCV NS5B protein and the antibody against ß-actin were kindly provided by Dr D. Moradpour (Lausanne, Switzerland) and Dr C. Chaponnier (Geneva), respectively.

Immunoblot

Cells were lysed in 250 mM Tris–HCl, pH 6.8, 500 mM DTT, 10% SDS, 0.5% Bromophenol Blue and 50% glycerol. Samples were boiled, loaded onto a 12% polyacrylamide gel and separated by electrophoresis. Proteins were transferred onto nitrocellulose membrane (Millipore, Milian, Geneva, Switzerland). Membranes were probed with primary antibody at 1:12, 1:1000 and 1:10 000 dilutions for anti-NS5B, anti-ß-actin and anti-NS3 antibodies, respectively, followed by incubation with horseradish peroxidase-conjugated secondary antibody (Bio-Rad, Reinach, Switzerland) diluted 1:3000 in washing buffer. Proteins were revealed by chemiluminescence using a commercially available kit (ECL, Amersham Pharmacia).

Indirect immunofluorescence

Replicon cells grown on coverslips in 6-well plates were fixed, washed and incubated with the primary antibody diluted 1:1000 in PBS, 2% bovine serum albumin (BSA), 1.2% Triton X-100 for 2 h at room temperature. After rinsing in PBS, cells were incubated for 2 h at RT with a rhodamine-conjugated anti-rabbit antibody (Jackson ImmunoResearch) diluted 1:100 in PBS/0.5% BSA. After rinsing, the coverslips were mounted onto a microscope slide with 90% glycerol, 200 mM Tris–HCl, pH 8, 0.02% sodium azide, 2% DABCO (Calbiochem, Juro AG, Luzern, Switzerland).

Cell toxicity

Cells (4000) were treated with SCH446211 at concentrations ranging from 50 µM to 10 nM in 96-well plates. SCH446211 was refreshed every day for the first 3 days and once for the last 3 days during the 6 day incubation period. The MTS assay (Promega) was performed at various time points up to 6 days.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Structural analysis

SCH446211 has unique features that can lead to enhanced activity in both enzyme and replicon assays. Different from BILN 2061, which is a macrocyclic inhibitor occupying the P3 to P1' area of the enzyme surface, SCH446211 contains a {alpha}-ketoamide electrophilic trap (Figure 1a). Compared with VX-950 and SCH503034, which are peptidomimetric inhibitors spanning from P4 or P3 to P1', respectively, SCH446211 extends from P3 towards the P2' side of the active site (Figure 1b). The peptidic core of SCH446211 binds to the protease through a series of hydrogen bonding interactions. Crystallographic analysis shows that in addition to the covalent bond formed after the attack of Ser-139 to the ketoamide moiety, Thr-42, Lys-136 and Ala-157 also form hydrogen bonds with SCH446211. The P' residue wraps around the side chain of lysine 136. Most notably, the P1'–P2' moiety forms a C-clamp locking Lys-136 in place,23,24 resulting in extensive hydrophobic interaction that can be translated into potent binding activity.


Figure 1
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. SCH446211 chemical structure (a) and X-ray structure of SCH446211 bound to protease (b). Time course of peptide hydrolysis by the single chain HCV NS3 protease in the presence of SCH446211 (c). The reaction was initiated by adding SCH446211 and enzyme mixture to substrate (see the Materials and methods section).

 
In vitro inhibition of NS3 protease

SCH446211 inhibited NS3 cleavage of the chromophore PAP-linked peptide substrate in a time- and dose-dependent manner (Figure 1c). The inhibitor binding constant Formulawas estimated to be 3.8 ± 0.4 nM (n = 18, 95% CI 3–6 nM). Human neutrophil elastase (HNE) is also a serine protease which prefers a hydrophobic residue at the P1 position. The binding constant of SCH446211 to HNE is estimated to be 1.5 ± 0.2 µM (n = 3, 95% CI 1.0–2.2 µM), ~1000-fold weaker compared with that to HCV protease.

Ex vivo potency of SCH446211

SCH446211 binds to HCV NS3 protease and blocks polyprotein processing which results in inhibition of HCV RNA replication. The clone 16 dicistronic replicon cells were dosed with SCH446211 at concentrations from 5 µM to 10 nM every 24 h for 3 days. Dose–response curves were generated and the drug concentrations necessary to suppress replicon RNA level by 50% (IC50) and 90% (IC90) were estimated to be 40 ± 30 nM (95% CI) and 100 ± 40 nM (95% CI) (n = 17). A representative experiment is shown in Figure 2(a). SCH446211 was also evaluated in three independent dicistronic replicon clones, monocistronic replicon cells (containing only HCV IRES, kindly provided by R. Bartenschlager) as well as full-length replicon cells25 and the results were comparable (data not shown).


Figure 2
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. SCH446211 inhibits HCV replication in subgenomic replicon cells. (a) Real-time RT–PCR analysis of replicon RNA. The cells containing HCV replicon were treated with SCH446211 at concentrations from 5 µM to 10 nM for 72 h. Cells were lysed at the end of treatment and the HCV RNA level was measured relative to GAPDH RNA. The difference in threshold cycle number between HCV RNA and GAPDH RNA ({Delta}CT) was plotted against the concentration of SCH446211. IC50 and IC90 are determined, respectively, as the concentrations corresponding to 1 and 3.2 {Delta}CT increase from the baseline as determined with no drug control. (b) Detection of HCV RNA by radioactive in situ hybridization. Top: cells were fixed and stained with haematoxylin and eosin after 72 h of incubation in the presence of DMSO or of increasing concentrations of SCH446211, as specified. Original magnification, x100. Bottom: Quantitative detection of HCV RNA (expressed as average number of silver grains per cell ± SD) by radioactive in situ hybridization.

 
By in situ hybridization, HCV replicon RNA was inhibited by 50% (P < 0.001) and 90% (P < 0.001) when treated with 50 and 100 nM SCH446211, respectively (Figure 2b), as compared with untreated cells. Similar results were obtained with different replicon clones (data not shown).

With the inhibition of HCV RNA replication, the non-structural proteins expressed from HCV replicon genome were also reduced. Immunoblot analysis with antibodies against HCV NS3 and NS5B indicated that increasing concentrations of SCH446211 were associated with a progressive decrease in both proteins (Figure 3a, left and middle panels), and the levels of ß-actin remained constant (Figure 3a, right panel). The decrease in both viral protein expression levels started from 50 nM SCH446211, and continued in a dose-dependent manner. However, trace amounts of NS5B were still recognized by specific antibodies at 500 nM of SCH446211, most likely due to incomplete degradation of existing proteins.


Figure 3
View larger version (54K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Detection of HCV NS3 and of NS5B proteins by immunoblot (a) and immunofluorescence (b). (a) The replicon cells were treated with indicated concentrations of SCH446211 for 72 h and then cells were analysed by immunoblot analysis with antibodies against NS3 (left) and NS5B (middle). The level of ß-actin (right) in each sample was used as a control. (b) Detection of HCV NS3 in replicon cells after 72 h of incubation with DMSO or increasing concentrations of SCH446211, as depicted. Untreated Huh7 cells are shown for comparison. Original magnification, x64.

 
Immunofluorescence assays were carried out using the anti-NS3 polyclonal antibody. In the absence of the drug, the antibody revealed a granular staining pattern that surrounded the nucleus and extended through the cytosol (Figure 3b). No nuclear or plasma membrane staining was observed. The fluorescence signal showed a strong decrease upon incubation with increasing concentrations of SCH446211. The most dramatic decrease was observed between 50 and 100 nM, whereas no signal was detected at 500 nM.

SCH446211 acts rapidly and eliminates HCV RNA from replicon cells

Time course studies which followed the HCV replicon RNA levels showed that replicon RNA started to decrease after 24 h of SCH446211 treatment. The increase in potency for a given dose over time reflects the decay of existing RNA. Based on the time course of 50x IC90 dose, the replicon RNA half-life is estimated to be 12 h (Figure 4).


Figure 4
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. SCH446211 acts quickly on replicon cells. Replicon cells were treated with SCH446211 and were collected at 6, 24, 48 and 72 h for real-time RT–PCR analysis.

 
To assess the effect of prolonged exposure of replicon cells to SCH446211, clone 16 cells were dosed with 0.8x, 5x and 50x IC90 SCH446211 in the absence of G418 selection and total RNA was isolated at days 6, 11 and 14. Replicon RNA was below detection limit in the samples treated with 5x and 50x IC90 on day 14, estimated to be <0.1 copy per cell. When 0.5 mg/mL of G418 was added to cells treated with 5x and 50x IC90, no cells survived the selection, indicating cure of replicon RNA from these cells.

SCH446211 did not show toxic effects on the cells. No changes in morphology and growth rate was noted when clone 16 cells were treated with up to 10 µM of SCH446211 during the 14 day study. In a second study, cells were treated with up to 50 µM of SCH446211 for 6 days and no cytotoxicity was observed by the MTS assay (data not shown).

When G418 was added to the SCH446211 treated cell culture to select for resistant replicon cells, cells were isolated only from the replicon cells dosed with 0.8x IC90, not at 5x or higher doses, indicating that higher doses may have advantages in reducing resistance and/or highly resistant replicon may be less fit in the presence of cured cells. Others have reported resistance at higher doses.26 It is possible that the lack of G418 in the first 2 weeks of treatment, which applied no selection pressure on replicon cells, favoured the growth of the cured replicon cells in culture over cells bearing replicon RNA. The IC90 of the resistant cells was measured to be 700 nM, ~7-fold increase compared with the parental replicon cells. Sequence analysis of the RT–PCR products from the NS3 protease domain indicated mixed populations at several amino acid positions including the previously reported A156,27,28 confirming that SCH446211 inhibited NS3 protease.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Since currently available treatments for HCV result in a permanent cure in only ~60% of patients and are often contraindicated or poorly tolerated,2 the development of alternative, efficacious antivirals is warranted. Several compounds have been reported to block the NS3 protease activity. They include both peptide (i.e. substrate-based)3038 and non-peptide3941 inhibitors, which may bind either to the S site or to the prime site,32,33 generally not used by natural substrates. In addition, short RNA molecules have also been reported to inhibit the NS3 protease activity.4244 Recently, small molecular protease inhibitors were shown to inhibit HCV RNA replication in replicon cells37,38 and proof-of-concept clinical trials have been reported.18,19 SCH446211 is a new {alpha}-ketoamide-derived, substrate-based inhibitor of the HCV serine protease. Its potency was also confirmed with the newly developed HCV infection system and its EC50 in the infection system was reported to be 190 nM.45 SCH446211's extended P1'–P2' interaction with NS3 protease is translated into tight binding activity to NS3 protease and potent antiviral activity in replicon cells. Its binding constant is 3.8 ± 0.4 nM and its IC90 is 100 ± 40 nM (95% CI). In comparison, VX-950 and SCH503034, which are also peptidomimetric inhibitors, respectively, spanning from P4 or P3 to P1', have binding constants of 7 nM and 14 ± 1 nM, respectively.46,47 In the same 72 h replicon assay used to test SCH446211, the IC90 for SCH503034 was reported to be 400 nM (95% confidence interval, 200–700 nM; n = 23).47 The IC90 for VX-950 was determined as 830 ± 190 nM in a 48 h replicon assay.46 This information is potentially a useful guide for future development of potent inhibitors against HCV NS3 protease. This versatility of NS3 inhibitors may pave the way to therapeutic combinations, thus minimizing the risk of selection for drug-resistant viral variants.

A156T/V and R109K were identified as major resistance mutations to SCH446211 in the genotype 1b replicon cells.25 R109K was a novel resistance mutation against SCH446211 and it conferred moderate level (~3-fold) resistance. This mutation remains sensitive to VX-950 and SCH503034.25 The lack of cross-resistance to VX-950 and SCH503034 was expected as the unique feature of SCH446211 was its extension toward the P' side of the active site and interaction with R109. VX-950 and SCH503034 do not make contacts with this residue and therefore their potency was not affected.25 A156T/V conferred >100-fold resistance to VX-950 and BILN2061 as well as SCH503034.28,48 This mutation also reduced replicon fitness to 3–5% versus wild-type. The same mutation only conferred ~20-fold resistance to SCH446211. The difference in resistance to different compounds by the same mutation may be explained by that SCH446211 derived its binding energy from contacts from both P and P' sides of the enzyme.25 Owing to its extended contacts with NS3 protease, SCH446211 may encounter few strong resistant variants as they would require loss of contacts at both P and P' sides of the enzyme.

In addition to the direct antiviral activity, SCH446211 was shown to revert the NS3/4A mediated blockade of phosphorylation and effector activity of the interferon regulatory factor-3 (IRF-3).49,50 IRF-3 induces the expression of a variety of cellular genes including type I IFNs,49,51 which further amplify the antiviral response through the induction of interferon-stimulated genes (ISGs).51 The blockade of IRF-3 activation by the HCV NS3/4A protease may significantly affect both the host response to viral infection and the response to IFN-{alpha}-based therapy.51,52 Thus, SCH446211 and other NS3/4A protease inhibitors may counteract not only the cleavage function necessary to proper processing of mature viral proteins, but also the inhibition of the innate host immune response against HCV. Foy et al.49 have shown the likelihood of such dual therapeutic mechanisms, since SCH446211 both restored the host IRF-3 pathway and inhibited viral polyprotein processing. As an additional effect, NS3/4A inhibitors may also counteract the transforming activity of HCV. Transfection with NS3 of different cell lines has shown that this protein may induce tumour formation upon engrafting of transfected cells into nude mice.53 Non-specific inhibitors of NS3 protease eliminated the transforming activity.54,55

In conclusion, SCH446211 is a potent inhibitor of the NS3 protease and it effectively inhibits the HCV subgenomic RNA replication. Its extended interaction with the protease active site is associated with improved antiviral potency in replicon cells and can be a useful guide for future development of potent inhibitors.


    Transparency declarations
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
None to declare.


    Acknowledgements
 
This study was supported by the Schering-Plough Research Institute.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
1 Alter HJ and Seeff LB. (2000) Recovery, persistence, and sequelae in hepatitis C virus infection: a perspective on long-term outcome. Semin Liver Dis 20:17–35.[CrossRef][Web of Science][Medline]

2 Hadziyannis SJ, Sette H Jr, Morgan TR, et al. (2004) Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern Med 140:346–55.[Abstract/Free Full Text]

3 Zeuzem S, Buti M, Ferenci P, et al. (2006) Efficacy of 24 weeks treatment with peginterferon alfa-2b plus ribavirin in patients with chronic hepatitis C infected with genotype 1 and low pretreatment viremia. J Hepatol 44:97–103.[CrossRef][Web of Science][Medline]

4 Moradpour D, Brass V, Gosert R, et al. (2002) Hepatitis C: molecular virology and antiviral targets. Trends Mol Med 8:476–82.[CrossRef][Web of Science][Medline]

5 Reed KE and Rice CM. (2000) Overview of hepatitis C virus genome structure, polyprotein processing, and protein properties. Curr Top Microbiol Immunol 242:55–84.[Web of Science][Medline]

6 Grakoui A, McCourt DW, Wychowski C, et al. (1993) Characterization of the hepatitis C virus-encoded serine proteinase: determination of proteinase-dependent polyprotein cleavage sites. J Virol 67:2832–43.[Abstract/Free Full Text]

7 Tomei L, Failla C, Santolini E, et al. (1993) NS3 is a serine protease required for processing of hepatitis C virus polyprotein. J Virol 67:4017–26.[Abstract/Free Full Text]

8 Manabe S, Fuke I, Tanishita O, et al. (1994) Production of nonstructural proteins of hepatitis C virus requires a putative viral protease encoded by NS3. Virology 198:636–44.[CrossRef][Web of Science][Medline]

9 Bartenschlager R, Ahlborn-Laake L, Mous J, et al. (1993) Nonstructural protein 3 of the hepatitis C virus encodes a serine-type proteinase required for cleavage at the NS3/4 and NS4/5 junctions. J Virol 67:3835–44.[Abstract/Free Full Text]

10 Yang SH, Lee CG, Song MK, et al. (2000) Internal cleavage of hepatitis C virus NS3 protein is dependent on the activity of NS34A protease. Virology 268:132–40.[CrossRef][Web of Science][Medline]

11 Love RA, Parge HE, Wickersham JA, et al. (1996) The crystal structure of hepatitis C virus NS3 proteinase reveals a trypsin-like fold and a structural zinc binding site. Cell 87:331–42.[CrossRef][Web of Science][Medline]

12 Kim JL, Morgenstern KA, Lin C, et al. (1996) Crystal structure of the hepatitis C virus NS3 protease domain complexed with a synthetic NS4A cofactor peptide. Cell 87:343–55.[CrossRef][Web of Science][Medline]

13 Lindenbach BD, Evans MJ, Syder AJ, et al. (2005) Complete replication of hepatitis C virus in cell culture. Science 309:623–6.[Abstract/Free Full Text]

14 Wakita T, Pietschmann T, Kato T, et al. (2005) Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat Med 11:791–6.[CrossRef][Web of Science][Medline]

15 Zhong J, Gastaminza P, Cheng G, et al. (2005) Robust hepatitis C virus infection in vitro. Proc Natl Acad Sci USA 102:9294–9.[Abstract/Free Full Text]

16 Lohmann V, Korner F, Koch J, et al. (1999) Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285:110–3.[Abstract/Free Full Text]

17 Blight KJ, Kolykhalov AA, Rice CM. (2000) Efficient initiation of HCV RNA replication in cell culture. Science 290:1972–4.[Abstract/Free Full Text]

18 Bartenschlager R. (2002) Hepatitis C virus replicons: potential role for drug development. Nat Rev Drug Discov 1:911–6.[CrossRef][Web of Science][Medline]

19 Lamarre D, Anderson PC, Bailey M, et al. (2003) An NS3 protease inhibitor with antiviral effects in humans infected with hepatitis C virus. Nature 426:186–9.[CrossRef][Medline]

20 Reesink HW, Zeuzem S, Weegink CJ, et al. (2005) Final results of a phase 1B, multiple-dose study of VX-950, a hepatitis C virus protease inhibitor. Hepatology 42:(Suppl 1), 234A.

21 Zeuzem SC, Sarrazin R, Rouzier A, et al. (2005) Anti-viral activity of SCH 503034, a HCV protease inhibitor, administered as monotherapy in hepatitis C genotype-1 (HCV-1) patients refractory to pegylated interferon (Peg-IFN-alpha). Hepatology 42:233A abstract 94.

22 Zhang R, Beyer BM, Durkin J, et al. (1999) A continuous spectrophotometric assay for the hepatitis C virus serine protease. Anal Biochem 270:268–75.[CrossRef][Web of Science][Medline]

23 Arasappan A, Njoroge FG, Chan TY, et al. (2005) Hepatitis C virus NS3-4A serine protease inhibitors: SAR of P'2 moiety with improved potency. Bioorg Med Chem Lett 15:4180–4.[Medline]

24 Bogen SL, Ruan S, Liu R, et al. (2006) Depeptidization efforts on P3-P2' {alpha}-ketoamide inhibitors of HCV NS3-4A serine protease: effect on HCV replicon activity. Bioorg Med Chem Lett 16:1621–7.[CrossRef][Medline]

25 Yi M, Tong X, Skelton A, et al. (2006) Mutations conferring resistance to SCH6, a novel hepatitis C virus NS3/4A protease inhibitor. Reduced RNA replication fitness and partial rescue by second-site mutations. J Biol Chem 281:8205–15.[Abstract/Free Full Text]

26 Pietschmann T, Lohmann V, Kaul A, et al. (2002) Persistent and transient replication of full-length hepatitis C virus genomes in cell culture. J Virol 76:4008–21.[Abstract/Free Full Text]

27 Lin C, Lin K, Luong YP, et al. (2004) In vitro resistance studies of hepatitis C virus serine protease inhibitors, VX-950 and BILN 2061: structural analysis indicates different resistance mechanisms. J Biol Chem 279:17508–14.[Abstract/Free Full Text]

28 Lin C, Gates CA, Rao BG, et al. (2005) In vitro studies of cross-resistance mutations against two hepatitis C virus serine protease inhibitors, VX-950 and BILN 2061. J Biol Chem 280:36784–91.[Abstract/Free Full Text]

29 Bogen SL, Arasappan A, Bennett F, et al. (2006) Discovery of SCH446211 (SCH6): a new ketoamide inhibitor of the HCV NS3 serine protease and HCV subgenomic RNA replication. J Med Chem 49:2750–7.[CrossRef][Web of Science][Medline]

30 Dymock BW, Jones PS, Wilson FX. (2000) Novel approaches to the treatment of hepatitis C virus infection. Antivir Chem Chemother 11:79–96.[Web of Science][Medline]

31 Zhang R, Durkin JP, Windsor WT. (2002) Azapeptides as inhibitors of the hepatitis C virus NS3 serine protease. Bioorg Med Chem Lett 12:1005–8.[CrossRef][Medline]

32 Ingallinella P, Fattori D, Altamura S, et al. (2002) Prime site binding inhibitors of a serine protease: NS3/4A of hepatitis C virus. Biochemistry 41:5483–92.[CrossRef][Medline]

33 Casbarra A, Piaz FD, Ingallinella P, et al. (2002) The effect of prime-site occupancy on the hepatitis C virus NS3 protease structure. Protein Sci 11:2102–12.[CrossRef][Web of Science][Medline]

34 Zhang R, Durkin JP, Windsor WT. (2002) Azapeptides as inhibitors of the hepatitis C virus NS3 serine protease. Bioorg Med Chem Lett 12:1005–8.[CrossRef][Medline]

35 Andrews DM, Carey SJ, Chaignot H, et al. (2002) Pyrrolidine-5,5-trans-lactams. 1. Synthesis and incorporation into inhibitors of hepatitis C virus NS3/4A protease. Org Lett 4:4475–8.[CrossRef][Web of Science][Medline]

36 Priestley ES, De Lucca I, Ghavimi B, et al. (2002) P1 Phenethyl peptide boronic acid inhibitors of HCV NS3 protease. Bioorg Med Chem Lett 12:3199–202.[CrossRef][Medline]

37 Pause A, Kukolj G, Bailey M, et al. (2003) An NS3 serine protease inhibitor abrogates replication of subgenomic hepatitis C virus RNA. J Biol Chem 278:20374–80.[Abstract/Free Full Text]

38 Trozzi C, Bartholomew L, Ceccacci A, et al. (2003) In vitro selection and characterization of hepatitis C virus serine protease variants resistant to an active-site peptide inhibitor. J Virol 77:3669–79.[Abstract/Free Full Text]

39 Yeung KS, Meanwell NA, Qiu Z, et al. (2001) Structure-activity relationship studies of a bisbenzimidazole-based, Zn2+-dependent inhibitor of HCV NS3 serine protease. Bioorg Med Chem Lett 11:2355–9.[CrossRef][Medline]

40 Sperandio D, Gangloff AR, Litvak J, et al. (2002) Highly potent non-peptidic inhibitors of the HCV NS3/NS4A serine protease. Bioorg Med Chem Lett 12:3129–33.[CrossRef][Medline]

41 Sing WT, Lee CL, Yeo SL, et al. (2001) Arylalkylidene rhodanine with bulky and hydrophobic functional group as selective HCV NS3 protease inhibitor. Bioorg Med Chem Lett 11:91–4.[CrossRef][Medline]

42 Fukuda K, Vishnuvardhan D, Sekiya S, et al. (2000) Isolation and characterization of RNA aptamers specific for the hepatitis C virus nonstructural protein 3 protease. Eur J Biochem 267:3685–94.[Web of Science][Medline]

43 Kumar PK, Machida K, Urvil PT, et al. (1997) Isolation of RNA aptamers specific to the NS3 protein of hepatitis C virus from a pool of completely random RNA. Virology 237:270–82.[CrossRef][Web of Science][Medline]

44 Kakiuchi N, Fukuda K, Nishikawa F, et al. (2003) Inhibition of hepatitis C virus serine protease in living cells by RNA aptamers detected using fluorescent protein substrates. Comb Chem High Throughput Screen 6:155–60.[Web of Science][Medline]

45 Lindenbach BD, Evans MJ, Syder AJ, et al. (2005) Complete replication of hepatitis C virus in cell culture. Science 309:623–6.[Abstract/Free Full Text]

46 Lin K, Perni RB, Kwong AD, et al. (2006) VX-950, a novel hepatitis C virus (HCV) NS3-4A protease inhibitor, exhibits potent antiviral activities in HCV replicon cells. Antimicrob Agents Chemother 50:1813–22.[Abstract/Free Full Text]

47 Malcolm B, Liu R, Lahser F, et al. (2006) SCH 503034, a mechanism-based inhibitor of hepatitis C virus NS3 protease, suppresses polyprotein maturation and enhances the antiviral activity of alpha interferon in replicon cells. Antimicrob Agents Chemother 50:1013–20.[Abstract/Free Full Text]

48 Tong X, Chase R, Skelton A, et al. (2006) Identification and analysis of fitness of resistance mutations against the HCV protease inhibitor SCH 503034. Antiviral Res 70:28–38.[CrossRef][Web of Science][Medline]

49 Foy E, Li K, Wang C, et al. (2003) Regulation of interferon regulatory factor-3 by the hepatitis C virus serine protease. Science 300:1145–8.[Abstract/Free Full Text]

50 Grandvaux N, tenOever BR, Servant MJ, et al. (2002) The interferon antiviral response: from viral invasion to evasion. Curr Opin Infect Dis 15:259–67.[Web of Science][Medline]

51 Nakaya T, Sato M, Hata N, et al. (2001) Gene induction pathways mediated by distinct IRFs during viral infection. Biochem Biophys Res Commun 283:1150–6.[CrossRef][Web of Science][Medline]

52 Yoneyama M, Suhara W, Fukuhara Y, et al. (1998) Direct triggering of the type I interferon system by virus infection: activation of a transcription factor complex containing IRF-3 and CBP/p300. EMBO J 17:1087–95.[CrossRef][Web of Science][Medline]

53 Sakamuro D, Furukawa T, Takegami T. (1995) Hepatitis C virus nonstructural protein NS3 transforms NIH 3T3 cells. J Virol 69:3893–6.[Abstract]

54 He QQ, Cheng RX, Sun Y, et al. (2003) Hepatocyte transformation and tumor development induced by hepatitis C virus NS3 c-terminal deleted protein. World J Gastroenterol 9:474–8.[Web of Science][Medline]

55 Zemel R, Gerechet S, Greif H, et al. (2001) Cell transformation induced by hepatitis C virus NS3 serine protease. J Viral Hepat 8:96–102.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
59/1/51    most recent
dkl455v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Liu, R.
Right arrow Articles by Negro, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, R.
Right arrow Articles by Negro, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?