Skip Navigation


JAC Advance Access originally published online on October 31, 2006
Journal of Antimicrobial Chemotherapy 2007 59(1):43-50; doi:10.1093/jac/dkl450
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
59/1/43    most recent
dkl450v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Seaman, P. F.
Right arrow Articles by Day, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seaman, P. F.
Right arrow Articles by Day, M. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Small-colony variants: a novel mechanism for triclosan resistance in methicillin-resistant Staphylococcus aureus

Paul F. Seaman1, Dietmar Ochs2 and Martin J. Day1,*

1 Cardiff School of Biosciences, Cardiff University Park Place, Cardiff CF10 3TL, UK 2 Ciba Spezialitätenchemie Grenzach GmbH, Postfach 1266 D-79630 Grenzach-Wyhlen, Germany


*Corresponding author. Tel: +44-29-20875768; Fax: +44-29-20874305; E-mail: day{at}cardiff.ac.uk

Received 19 August 2006; returned 22 September 2006; revised 26 September 2006; accepted 9 October 2006


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Objectives: A little-understood mode of antimicrobial resistance in Staphylococcus aureus is the evolution of a sub-population of small-colony variants (SCVs). SCVs are a cause of persistent and recurring infections refractory to antimicrobial chemotherapy. Following the inadvertent isolation of suspected SCVs growing in the presence of triclosan we set out to evaluate the formation of these colonial mutants and assess their antimicrobial susceptibility.

Methods: SCVs were isolated on Mueller–Hinton agar supplemented with 1 mg/L triclosan. SCV formation frequency was calculated using a selection of both clinical methicillin-resistant S. aureus (MRSA) isolates and methicillin-susceptible S. aureus strains. Antimicrobial susceptibility was assessed and the fabI gene of SCVs was sequenced to ensure resistance was not mediated by mutation of this gene.

Results: We have found in vitro that triclosan can select for S. aureus colonies showing the characteristic SCV phenotype with low-level triclosan resistance and which coincidently have reduced susceptibility to penicillin and gentamicin. Additionally, triclosan-isolated SCVs were shown to have an increased tolerance to the lethal effects of triclosan.

Conclusions: We propose the formation of SCVs by S. aureus is a novel mechanism of resistance to low concentrations of triclosan, which for 25 years has been used widely in the domestic setting in various consumer healthcare products. More recently it has been recommended for the control of MRSA. Consequently, our results identify the potential for treatment failure in infections already notoriously difficult to eradicate. It remains unclear to what extent isolates with decreased susceptibility to triclosan would develop and have the fitness to survive under real world conditions.

Keywords: atypical growth , co-resistance , biocide resistance , mechanisms of resistance


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Small-colony variants (SCVs) of Staphylococcus aureus arise as a drug-resistant sub-population during exposure to antimicrobial chemotherapeutics.1 Two types of SCV are regularly isolated: those with an interrupted electron transport chain (ETC) and those showing thymidine auxotrophy. ETC-deficient SCVs can be further divided into those with mutations affecting menaquinone (vitamin K), haemin, thiamine or haem A biosynthesis. ETC SCVs are associated with persistent and relapsing osteomyelitis, sinusitis, muscle abscesses and device-related infections2,3 whilst thymidine SCVs are seen in cystic fibrosis patients.4 Although data concerning the virulence of SCVs is ambiguous, infections have proven fatal.57 Mutations knocking out menaquinone, haemin or haem A biosynthesis block the S. aureus ETC. The subsequent energy deficiency bestows a characteristic pleiotropic phenotype including slow growth (hence small colonies), lack of pigmentation, non-production of virulence factors and reduced spectrum of carbohydrate utilization.8 The basis for thymidine-auxotrophic SCVs is not currently understood.1

The ability to form a variant sub-population affords S. aureus a number of survival advantages. SCV persistence intracellularly within non-professional phagocytes shields them from host defences and decreases exposure to antimicrobial agents, and SCVs show reduced antimicrobial susceptibility. It is well documented that S. aureus has been adept at developing resistance to antimicrobials.9 Exposure of S. aureus to antimicrobials through prophylaxis and treatment has contributed to the isolation of multidrug-resistant staphylococci. These resistances have generally been mediated by spontaneous chromosomal mutations and acquisition of genes encoded on plasmids or other mobile genetic elements that modify drugs, induce their efflux, or alter the target molecule.9,10 However, resistance in SCVs does not follow one of these ‘classic’ mechanisms, but is instead a direct consequence of the SCV phenotype.

Reduced antimicrobial susceptibility in SCVs is conferred through three known processes. First, reduced growth rate has been shown to reduce the susceptibility to cell-wall-targeting antimicrobials by up to 4-fold.8 Secondly, the break down in bacterial ETC reduces the transmembrane potential ({Delta}{psi}) resulting in reduced uptake of cationic compounds.11 Finally, subsistence within host cells confers resistance to those chemotherapeutics unable to pass into host cells. Interestingly it has been shown that the appearance of SCVs following exposure to gentamicin results from a rapid switch, and those bacteria exposed to cycles of gentamicin followed by antibiotic-free medium repeatedly switched between a resistant SCV and a susceptible parental phenotype (revertants). The fitness of revertants relative to S. aureus with stable gentamicin resistance was greater in drug-free media, which suggests that the SCV phenotype has evolved as an inducible and reversible resistance mechanism that evades a permanent fitness cost.12

Triclosan (2,4,4'-trichloro-2'-hydroxydiphenyl ether) is a synthetic bisphenol antimicrobial agent, which shows activity against a wide range of Gram-positive and Gram-negative bacteria. For over 25 years it has been included efficaciously in many hygiene and consumer health products, such as soaps, skin cleansers and mouthwashes, and is increasingly incorporated into a range of domestic plastics including toys, tea towels and chopping boards.13 In 1998, it was recommended for the control of methicillin-resistant S. aureus (MRSA)14 after being successfully used to control outbreaks in a neonatal nursery,15 cardiothoracic surgical unit16 and to provide an alternative to expensive vancomycin administration.17 Subsequently, 2% triclosan baths are now a recommended rationale for skin decolonization of MRSA carriers in the UK.18

Since the introduction of triclosan into clinical practice, strains of S. aureus exhibiting low-level resistance to triclosan have been isolated. MRSA strains with MICs of 2–4 mg/L have been isolated from patients treated with daily triclosan baths; this compares with MICs of 0.01–0.1 mg/L for susceptible strains.19 Traditionally triclosan has been regarded as a biocide rather than an antibiotic and, as such, has been thought to have numerous intracellular and cytoplasmic target sites.2023 However, this view has been challenged by evidence that triclosan may act on a specific target, FabI, an enoyl reductase enzyme involved in bacterial fatty acid biosynthesis.2426 Notably, fabI-mediated resistance to triclosan in S. aureus remains low-level and of ambiguous clinical significance. In addition, studies have failed to demonstrate any explicit link between triclosan exposure and resistance in ex-situ isolates, microcosms or the domiciliary environment.2730

Thus, although the development of S. aureus SCVs upon exposure to antibiotics, and in particular aminoglycosides, is well documented, this is not the case with biocides. So the small, non-pigmented colonies which arose on Mueller–Hinton (MH) agar, containing 1 mg/L triclosan, inoculated with S. aureus were initially suspected to be contaminants. However, these atypical colonies proved to be S. aureus SCVs. Here, we aimed to study these organisms to see whether they represent a novel resistance mechanism to this antimicrobial and to further examine their biology.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Experimental conditions

Unless otherwise stated, all experiments were performed in triplicate (n = 3) and results are presented as means ± SD. S. aureus strains NCTC 6571,31 NCIMB 9518 and F89 (high-level mupirocin-resistant) and clinical MRSA isolates 24500 and 27343 were maintained on nutrient agar (Oxoid Ltd, UK) from which cultures in nutrient broth (Oxoid Ltd, UK) were prepared when required. SCVs were isolated by the growth of S. aureus strains to mid-log phase in 10 mL of MH broth (Oxoid Ltd, UK) at 37°C. At this point pre-warmed triclosan solution (100 mg/L) was added to achieve a final concentration of 0.01 mg/L, and further incubation was performed for 6 h at 37°C. Cells were harvested by centrifugation (5000 rpm for 15 min), washed and resuspended in 10 mL of quarter-strength Ringer's solution. Volumes (100 µL) of 109 cells/mL were spread onto the surface of MH agar (Oxoid Ltd, UK) plates containing 0–10 mg/L triclosan. Plates were incubated for 48 h at 37°C. Suspected reduced triclosan susceptibility SCVs were observed as tiny, non-pigmented colonies on plates containing triclosan. Such colonies were maintained on MH agar supplemented with 1 mg/L triclosan, from which overnight cultures prepared in MH broth with 1 mg/L triclosan were made when required. Triclosan powder (Irgasan DP300) was a gift from Ciba Specialty Chemicals (Grenzach-Wyhlen, Germany) and was dissolved in sterile dimethylsulphoxide (DMSO). DMSO concentrations were maintained below 1% in growth media and DMSO controls were run alongside experiments where required.

Electron microscopy

Cells in logarithmic growth phase were prepared for scanning electron microscopy (SEM) by fixing in 2% glutaraldehyde in 0.1% sodium phosphate buffer, pH 7.4, for 2 h and were subsequently treated with 1% osmium tetroxide for 2 h at 4°C. Cells were dehydrated with graded concentrations of ethanol and sputter coated with gold. Samples were analysed with a Philips XL-20 high vacuum scanning electron microscope (Phillips, The Netherlands). Samples for transmission electron microscopy (TEM) were prepared as for SEM, but following ethanol dehydration were embedded in SPI-ChemTM Araldite® CY212. Ultra-thin sections were stained with uranyl acetate and lead citrate, and examined with transmission electron microscope JEM-1210 (JEOL, Japan).

Species confirmation

All suspected SCVs were confirmed as S. aureus by multiplex-PCR as previously reported.32

SCV characterization

SCVs were analysed for haemolysis by streaking on MH agar supplemented with 5% defibrinated sheep blood (Oxoid Ltd, UK) and incubation at 37°C for 48 h. The presence of coagulase production was investigated by Staphylase test kit (Oxoid Ltd, UK) according to the manufacturers directions. Colonies (4–5) were transferred to a microscope slide followed by the addition of hydrogen peroxide; the presence of bubbling was taken as an indication of catalase production. Auxotrophy for haemin, menaquinone and thiamine was examined as described previously.33 Growth curves were attained by spectrophotometric analysis (580 nm) of MH broth cultures using a DYNEX Technologies MRX® Microplate Absorbance Reader with RevelationTM application programme. In each well of a sterile 96-well microtitre plate (Fisher Scientific, UK) 100 µL of MH broth, containing 2x final concentration of triclosan was inoculated with 100 µL of MH broth culture, diluted with broth to 103 cells/mL. Plates were sealed with adhesive plate seals (ABgene, UK) and incubation was performed at 37°C with agitation for 48 h. Significant effect of triclosan on bacterial growth was tested with analysis of variance (ANOVA). All data are presented as the mean ± SD.

SCV formation and reversion rates

The rate of mutation towards the SCV phenotype was assessed by the growth of S. aureus strains to mid-log phase in 9 mL of MH broth at 37°C. At this point either MH broth or pre-warmed triclosan solution was added to give final concentrations of 0, 0.01, 0.1 and 1 mg/L, and further incubation was performed for 6 h at 37°C. Cells were harvested by centrifugation (5000 rpm for 15 min), washed, resuspended in quarter-strength Ringer's solution and adjusted to 1010 cells/mL. Volumes (100 µL) of 1010 cells/mL were spread onto the surface of MH agar plates containing 1 mg/L triclosan. Additionally, dilutions of the cultures were plated onto MH agar in order to calculate the number of wild-type cfu. Plates were incubated for 48 h at 37°C. Non-pigmented colonies that grew to less than one-tenth of the size of wild-type colonies were recorded as SCVs. The frequencies were expressed as numbers of SCVs per cfu. Reversion rates were calculated by inoculating an MH agar plate with cells from ten SCV colonies suspended in 3 mL of 0.9% NaCl. After 48 h of growth at 37°C, SCVs and wild-type colonies were counted and the frequency of reversion was determined as number of wild-type cfu per SCV.

Antimicrobial susceptibility

MICs of the three biocides, triclosan, chlorhexidine gluconate (ICN Biomedicals Inc., USA) and cetylpyridinium chloride (ICN Biomedicals Inc., USA) were calculated according to the guidelines of the BSAC.34 Due to the slow growth of the SCVs, MIC plates were incubated for 48 h. Etest® strips (Bio-stat Ltd, UK) were utilized to determine the MICs of antibiotics, as per the manufacturer's directions. The bactericidal effects of triclosan on wild-type S. aureus and their SCVs were compared as reported previously35 except that the inoculum was adjusted to 107 cfu/mL; 2% azolectin and 5% Tween 80 in molecular grade de-ionized water was used as the neutralizing solution and sampling was continued up to 2 h. Log10 reduction was then calculated from log10Nc – log10Nt where Nc and Nt represent the numbers of cfu/mL in the control and triclosan solutions, respectively. The significant effect of triclosan on the reduction in cell density was tested with ANOVA. All data are presented as the mean ± SD.

Validation of triclosan neutralizer

Aliquots of 2% azolectin and 5% Tween 80 in molecular grade de-ionized water were used as the triclosan neutralizer. Its ability to neutralize triclosan without toxicity to bacterial cells was examined as described previously.36,37 Briefly, 8 mL of neutralizer, 100 µL of triclosan (10 mg/mL) and 900 µL of sterile de-ionized water was inoculated with 1 mL of an overnight culture of S. aureus NCIMB 9518 grown at 37°C. The viable cell count was enumerated after 5 min of contact time at ambient temperature. As controls, sterile de-ionized water was added to the incubation mixture instead of the triclosan solution or the neutralizer. When the cells were exposed to triclosan without the neutralizer no viable cells were detected in the sample after the 5 min incubation period. There was no significant difference (P = 0.879) between the viable cell count of cultures exposed to triclosan and the neutralizer and where water was added instead of triclosan. This confirmed the ability of the neutralizer to quench the bactericidal activity of triclosan at 100 mg/L. When examining the possible toxicity of the neutralizer, there was no significant difference (P = >0.05) between the viable cell counts of cultures exposed to sterile water and those exposed to the neutralizer for 15 min, confirming that the neutralizer was non-toxic.

fabI gene sequencing

Chromosomal DNA was extracted as described previously.38 Primers adapted from those designed for the amplification of the staphylococcal fabI gene and putative fabI promoter region39 were used in 50 µL PCRs (Fab1F, tgttccgcatggagatacac; and Fab1R, taaggactaattctgtggatgt). Reactions contained 0.5 µL of chromosomal DNA (~0.5 µg), 0.5 µg of each primer, 1 U of Taq DNA polymerase (Bioline Ltd, UK), 5 µL of 10x buffer (Bioline Ltd) and 0.2 mM deoxynucleoside triphosphates (Bioline Ltd). The PCR was performed in a PTC-200 DNA engine (MJ Research, USA) with an initial 5 min denaturation at 94°C, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 50°C for 30 s and extension at 72°C for 45 s, followed by a final extension step at 72°C for 5 min. The amplified products were purified using a QIAquick PCR purification kit (Qiagen Ltd, UK) and the sequences of both strands were determined with an ABI Prism 377 DNA sequencer, BigDye fluorescent terminators and primers used in the initial PCR amplification. To ensure complete sequence coverage a further set of primers, again adapted from Slater-Radosti et al.39 were also used (Fab2F, atgttaaatcttgaaaacaaaac; and Fab2R, ttatttaattgcgtggaatccgc).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Suspected SCVs were isolated from MH agar plates containing 1 mg/L triclosan and spread with a heavy inoculum of S. aureus strains NCTC 6571 (Oxford strain), NCIMB 9518 and F89 (high-level mupirocin-resistant) and clinical MRSA isolates 24500 and 27343. Non-pigmented colonies were approximately one-tenth the size of wild-type S. aureus colonies and non-haemolytic on sheep blood agar. Most appeared coagulase-negative during examination by latex agglutination test, although SCVs of F89 and 24 500 showed very weak positive reactions. Upon addition of hydrogen peroxide the colonies were shown to be weakly catalase positive. The cells generally appeared as Gram-positive cocci, although some cultures of suspected SCVs appeared to show a heterogeneous cellular morphology; apparently normal S. aureus mixed with larger cell morphotypes. Subsequent SEM of SCV samples revealed bacterial cells of different sizes, in distinction to homogeneous cocci of the isogenic wild-type S. aureus (data not shown). Kahl et al.40 suggest the larger cells are a result of impaired cell separation. TEM disclosed this to a greater extent, by revealing SCV cultures to contain 48.7% large cells with incomplete cross walls and 2.3% ‘empty’ cells (Figure 1), significantly more than were found in wild-type cultures (P = <0.05, for both phenomena).


Figure 1
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1. Heterogeneous SCV cultures containing a mixture of large and small cell morphologies. Analysis of a triclosan-induced SCV culture revealed a large number of unusually large cells (2.13:1), attributed to interrupted cell division. (a) TEM analysis of a triclosan-induced SCV culture showing a heterogeneous culture of cells; some (48.7%) contained incomplete cell walls. (b) In comparison, wild-type cultures contained only homogeneous cocci with clear single cell walls. (c) Also observed in cultures of SCVs were a smaller number (2.3%) of ‘empty’ cells, which were not seen in wild-type cultures.

 
Species confirmation of S. aureus SCVs is notoriously challenging and can often lead to misidentification as coagulase-negative staphylococci.6 Consequently, the suspected colonies were ultimately identified as S. aureus by genomic analysis. Suspected SCVs were interrogated for the presence of four genes (staphylococcal 16S rRNA, nuc, mecA and mupA) by multiplex PCR.32 The presence of a staphylococcal 16S rRNA gene and S. aureus specific nuc gene was recorded for all suspected SCVs analysed (Figure 2). This procedure also indicated that the SCVs maintained the mecA and mupA resistance determinants associated with their parents.


Figure 2
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2. SCVs were confirmed as S. aureus by amplification of the staphylococcal 16S rRNA (756 bp) and nuc (279 bp) genes. Additionally mecA (310 bp) and mupA (457 bp) were also targeted to identify methicillin and high-level mupirocin resistance respectively. 1, no template control; 2, E. coli; 3; S. epidermidis 1228; 4 and 5, 27343 and 27343SCV; 6 and 7, 24500 and 24500SCV; 8 and 9, F89 and F89SCV; 10 and 11, NCIMB9518 and 9518SCV; 12 and 13, NCTC6571 and 6571SCV.

 
None of the SCVs were identified as haemin, menaquinone or thymidine auxotrophs and neither did any show a combination of menaquinone, haemin or thymidine auxotrophy. Thus the reason for their expression of the SCV phenotype remains uncharacterized.

When grown in unmodified MH broth, SCV growth was significantly different to wild-type (P = <0.05). SCVs exhibited extended lag periods (3 h compared with 1 h), greatly reduced maximal growth rates (0.23 compared with 1.65 generations/h) and achieved maximal cell densities approximately one-half of their parent strain (Figure 3). However, when grown in MH broth adjusted to 1 mg/L triclosan, SCV growth remained unaffected, whilst wild-type S. aureus growth was greatly restricted, indicating the advantage of SCV growth under conditions of antimicrobial stress. The SCVs showed similar antimicrobial susceptibilities, all of which differed from their wild-type parent (Table 1). Susceptibility to triclosan was decreased by between 24- and 60-fold and to gentamicin by between 2.5- and 10-fold. The MIC of penicillin was raised by up to 4-fold in all SCVs for which the progenitor was penicillin susceptible (methicillin-susceptible S. aureus). The penicillin MIC for the two MRSA strains that had existing penicillin resistance was either unaffected (24500) or lowered (27343).


Figure 3
View larger version (9K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3. Typical SCV and wild-type growth dynamics. SCV (grey lines) and their wild-type S. aureus parent (black lines) were grown in broth with (dashed lines) and without (solid lines) 1 mg/L triclosan. Typical SCV growth was significantly retarded in comparison with typical wild-type S. aureus (P = <0.05). SCVs characteristically exhibited extended lag phases and reduced maximal growth rate and cell density. Data are the mean of three measurements ±SD.

 


View this table:
[in this window]
[in a new window]

 
Table 1. MICs for S. aureus SCVs and their corresponding wild-type parent

 
Additionally, SCV susceptibility to two other biocides was investigated. Chlorhexidine, a bis-biguanide biocide used widely in mouthwashes, toothpastes and clinical hand washes, and cetylpyridinium chloride, a quaternary ammonium compound. Both are cationic, and as such the uptake of these compounds may be affected by a reduction in {Delta}{psi}, reducing their antimicrobial effect.11 However, none of the SCV strains showed any reduction in susceptibility to either of these compounds in comparison with their isogenic wild-type, perhaps an indication that a reduction in {Delta}{psi} is not associated with these SCVs, or that the permeability of these biocides remains unaffected.

Commonly, antibiotics possess single target sites, and consequently increased MICs and reduced bactericidal effectiveness are linked. In contrast, this correlation is not so for biocides; biocides have multiple targets and increased MICs often do not correlate with decreased bactericidal activities of that compound.23 It has been shown previously that increases in triclosan MIC in S. aureus have resulted in little to no increase in bactericidal effectiveness of the compound.21 Contrary to these data, our SCVs showed significantly increased resistance to the lethal effects of 7.5 mg/L triclosan (P = <0.05). Five log10 reductions in cell density by 7.5 mg/L triclosan were achieved in times ranging from 15 to 20 min for wild-type S. aureus, this compares with times of over 2 h for SCV strains (Figure 4a). However, the bactericidal efficacy of triclosan at 20 and 40 mg/L was comparable between wild-type and SCV strains (Figure 4b and c).


Figure 4
View larger version (4K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4. Typical death curves for wild-type and SCV S. aureus exposed to triclosan. Reduction in viable cell count following exposure to various concentrations of triclosan was measured for a wild-type S. aureus (solid line) and its isogenic SCV (dashed line). (a) The lethal effects of 7.5 mg/L triclosan were shown to be greatly reduced against SCVs. The lethal effect of triclosan is significantly different between typical wild-type and typical SCV (P = <0.05). The times for a five log10 reduction in cell density were increased from 15 to 20 min for wild-type S. aureus to >2 h for SCVs strains. However, at higher concentrations of triclosan, (b) 20 mg/L and (c) 40 mg/L, no significant difference was observed between the lethal effect upon wild-type and SCV (P = >0.05). Data are the mean of three measurements ±SD.

 
DNA sequences for the fabI gene and preceding promoter region were ascertained for all SCVs and compared with those of their wild-type parent. Sequence comparison failed to identify any mutations within the gene, showing that the reduced susceptibility within the SCVs was not mediated by mutation of fabI. This implies that fabI is not the sole target for triclosan.

SCV formation occurs at rates as high as 1 in 1000 when selected by gentamicin.12,41 The rate of reversion can also be very high,12 although some SCVs can show stability under non-selective conditions. Triclosan was shown to select for SCVs at rates between 1.86 x 10–11 and 9.46 x 10–10 SCV/cfu. Interestingly, these frequencies were increased by up to four orders of magnitude when strains were subject to a pre-exposure to triclosan (Figure 5). Subsequent reversion occurred at variable frequencies, with some SCVs of strains 9518, F89 and 24500 exhibiting a stable phenotype (e.g. less than 10–10). Revertants exhibited antimicrobial susceptibilities comparable to their wild-type parent, i.e. upon reversion all strains lost any SCV-associated reduction in antimicrobial susceptibility.


Figure 5
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5. (a) Frequency of mutation to the SCV phenotype following exposure to zero (white bars), sub-MIC (0.01 mg/L; light grey bars) and higher than MIC (0.1 mg/L; dark grey bars) concentrations of triclosan and (b) the rate of reversion to wild-type of SCVs selected on various concentrations of triclosan. Data are the mean of three measurements ±SD.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
We have shown that in vitro exposure to triclosan can trigger the emergence of reduced drug-susceptibility SCVs, and this was augmented by a pre-exposure to sub-MIC triclosan. These SCVs showed the characteristic SCV phenotype; as a consequence of this the organisms were difficult to culture and identify by classical methods. These findings raise potential issues in healthcare; although clinical evidence for failure of triclosan has not yet been shown, the findings create the possible scenario that selection of SCVs during skin decolonization with triclosan may cause patients to be misidentified as MRSA-free. These missed SCVs may then be transmitted between patients and/or revert to the wild-type state and initiate more familiar MRSA infections. Additionally, we have shown that MRSA SCVs retain the genetic determinants for methicillin resistance; hence these may provide a longstanding reservoir of resistance genes to be shared amongst the microbial community, although it remains to be shown that these variants are able to partake in horizontal gene transfer.

Fitness of the SCVs was severely impaired with regard to growth rate, however, this was negated by their refractoriness to antimicrobial therapy. In vivo this phenotype may also confer the ability for intracellular maintenance. If able to persist intracellularly, further reductions in antimicrobial susceptibility may be expected,42 and the potential for more deep-seated infections is increased. Susceptibility to three widely used antimicrobials (penicillin, gentamicin and triclosan) was shown to reduce notably and similarly the lethal effects of triclosan at 7.5 mg/L. However, the lethality of triclosan at 20 and 40 mg/L and no cross-resistance to chlorhexidine and cetylpyridinium chloride show that these staphylococcal variants can be controlled by pertinent use of antimicrobial chemotherapeutics. Reductions in triclosan susceptibility were comparable to those achieved through alteration of the fabI gene product, and as such are hypothetically of equal clinical significance. It is important to understand that in laboratory studies susceptibility is not comparable to that in situ. During clinical or domestic use, triclosan is delivered often as part of a complex formulation. These formulations contain various combinations of surfactants, detergents, chelating agents and wetting agents, all of which will affect their action, and ultimately the susceptibility of microorganisms exposed to them. Moreover, typical in-use concentrations of triclosan in hand wash, bath formulations and surface disinfectants are 0.3–1%; for hospital wash applications for MRSA eradication even 2% triclosan is recommended.18 These in-use concentrations are magnitudes higher than the concentrations of triclosan needed to inhibit SCV isolates of MRSA reported herein.

We were unable to identify any auxotrophy towards haemin, menaquinone or thymidine; hence the reason for the expression of the SCV phenotype remains uncharacterized.

This investigation highlights a microbial phenomenon (SCV formation) affecting antimicrobial chemotherapy. Despite this, it is important to appreciate the differences between in vitro susceptibility to triclosan in pure culture conditions and those in situ where mixed microbial populations are exposed to complex formulations. Further investigations should be targeted to elucidate the existence of this phenomenon under conditions better reflecting the environments in which triclosan is used.


    Transparency declarations
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
P. F. S. and M. J. D. have nothing to declare. D. O. is an employee of Ciba Specialty Chemicals, Grenzach-Wyhlen, Germany.


    Acknowledgements
 
We would like to acknowledge the contribution of Professor A. Denver Russell, Welsh School of Pharmacy, Cardiff, who died in September 2004, for his invaluable contribution to our work. We would also like to thank Mr Alan Paull, PHLS, Cardiff, for the gift of the clinical MRSA isolates. We are also grateful to Dr Ant Hann, Cardiff School of Biosciences, for his help with the electron microscopy. This work was supported by Ciba Specialty Chemicals, Grenzach-Wyhlen, Germany, including a research studentship to P. F. S.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
1 Proctor RA, von Eiff C, Kahl BC, et al. (2006) Small colony variants: a pathogenic form of bacteria that facilitates persistent and recurrent infections. Nat Rev Microbiol 4:295–305.[CrossRef][ISI][Medline]

2 Proctor RA, van Langevelde P, Kristjansson M, et al. (1995) Persistent and relapsing infections associated with small-colony variants of Staphylococcus aureus. Clin Infect Dis 20:95–102.[ISI][Medline]

3 Spanu T, Romano L, D'Inzeo T, et al. (2005) Recurrent ventriculoperitoneal shunt infection caused by small-colony variants of Staphylococcus aureus. Clin Infect Dis 41:e48–52.[CrossRef][ISI][Medline]

4 Kahl B, Herrmann M, Everding AS, et al. (1998) Persistent infection with small colony variant strains of Staphylococcus aureus in patients with cystic fibrosis. J Infect Dis 177:1023–9.[ISI][Medline]

5 Jonsson I-M, von Eiff C, Proctor RA, et al. (2003) Virulence of a hemB mutant displaying the phenotype of a Staphylococcus aureus small colony variant in a murine model of septic arthritis. Microb Pathog 34:73–9.[CrossRef][ISI][Medline]

6 Seifert H, von Eiff C, Fatkenheuer G. (1999) Fatal case due to methicillin-resistant Staphylococcus aureus small colony variants in an AIDS patient. Emerg Infect Dis 5:450–3.[ISI][Medline]

7 Pelletier LL Jr, Richardson M, Feist M. (1979) Virulent gentamicin-induced small colony variants of Staphylococcus aureus. J Lab Clin Med 94:324–34.[ISI][Medline]

8 McNamara PJ and Proctor RA. (2000) Staphylococcus aureus small colony variants, electron transport and persistent infections. Int J Antimicrob Agents 14:117–22.[CrossRef][ISI][Medline]

9 Livermore DM. (2001) Antibiotic resistance in staphylococci. Int J Antimicrob Agents 16:3–10.

10 Kuroda M, Ohta T, Uchiyama I, et al. (2001) Whole genome sequencing of methicillin-resistant Staphylococcus aureus. Lancet 357:1225–40.[CrossRef][ISI][Medline]

11 Gilman S and Saunders VA. (1986) Accumulation of gentamicin by Staphylococcus aureus: the role of the transmembrane electrical potential. J Antimicrob Chemother 17:37–44.[Abstract/Free Full Text]

12 Massey RC, Buckling A, Peacock SJ. (2001) Phenotypic switching of antibiotic resistance circumvents permanent costs in Staphylococcus aureus. Curr Biol 11:1810–14.[CrossRef][ISI][Medline]

13 Russell AD. (2004) Whither triclosan? J Antimicrob Chemother 53:693–5.[Abstract/Free Full Text]

14 Ayliffe GA, Buckles A, Casewell MW, et al. (1998) Revised guidelines for the control of methicillin-resistant Staphylococcus aureus infection in hospitals. J Hosp Infect 39:253–90.[CrossRef][ISI][Medline]

15 Zafar AB, Butler RC, Reese DJ, et al. (1995) Use of 0.3% triclosan (Bacti-Stat) to eradicate an outbreak of methicillin-resistant Staphylococcus aureus in a neonatal nursery. Am J Infect Control 23:200–8.[CrossRef][ISI][Medline]

16 Brady LM, Thomson M, Palmer MA, et al. (1990) Successful control of endemic MRSA in a cardiothoracic surgical unit. Med J Aust 152:240–5.[ISI][Medline]

17 Webster J, Faoagali JL, Cartwright D. (1994) Elimination of methicillin-resistant Staphylococcus aureus from a neonatal intensive care unit after hand washing with triclosan. J Paediatr Child Health 30:59–64.[ISI][Medline]

18 Coia JE, Duckworth GJ, Edwards DI, et al. (2006) Guidelines for the control and prevention of methicillin-resistant Staphylococcus aureus (MRSA) in healthcare facilities. J Hosp Infect 63:1–44.[CrossRef][ISI][Medline]

19 Cookson BD, Farrelly H, Stapleton P, et al. (1991) Transferable resistance to triclosan in MRSA. Lancet 337:1548–9.[ISI][Medline]

20 Russell AD. (2002) Mechanisms of antimicrobial action of antiseptics and disinfectants: an increasingly important area of investigation. J Antimicrob Chemother 49:597–9.[Free Full Text]

21 Suller MT and Russell AD. (2000) Triclosan and antibiotic resistance in Staphylococcus aureus. J Antimicrob Chemother 46:11–18.[Abstract/Free Full Text]

22 Villalain J, Mateo CR, Aranda FJ, et al. (2001) Membranotropic effects of the antibacterial agent triclosan. Arch Biochem Biophys 390:128–36.[CrossRef][ISI][Medline]

23 McDonnell G and Pretzer D. (1998) Action and targets of triclosan. ASM News 84:670–1.

24 Heath RJ and Rock CO. (2000) A triclosan-resistant bacterial enzyme. Nature 406:145–6.[CrossRef][Medline]

25 Levy CW, Roujeinikova A, Sedelnikova S, et al. (1999) Molecular basis of triclosan activity. Nature 398:383–4.[CrossRef][Medline]

26 McMurry LM, Oethinger M, Levy SB. (1998) Triclosan targets lipid synthesis. Nature 394:531–2.[CrossRef][Medline]

27 Ledder RG, Gilbert P, Willis C, et al. (2006) Effects of chronic triclosan exposure upon the antimicrobial susceptibility of 40 ex-situ environmental and human isolates. J Appl Microbiol 100:1132–40.[CrossRef][Medline]

28 McBain AJ, Bartolo RG, Catrenich CE, et al. (2003) Effects of triclosan-containing rinse on the dynamics and antimicrobial susceptibility of in vitro plaque ecosystems. Antimicrob Agents Chemother 47:3531–8.[Abstract/Free Full Text]

29 McBain AJ, Bartolo RG, Catrenich CE, et al. (2003) Exposure of sink drain microcosms to triclosan: population dynamics and antimicrobial susceptibility. Appl Environ Microbiol 69:5433–42.[Abstract/Free Full Text]

30 Cole EC, Addison RM, Rubino JR, et al. (2003) Investigation of antibiotic and antibacterial agent cross-resistance in target bacteria from homes of antibacterial product users and nonusers. J Appl Microbiol 95:664–76.[CrossRef][Medline]

31 Heatley NG. (1944) A method for the assay of penicillin. Biochem J 38:61–5.[Medline]

32 Zhang K, Sparling J, Chow BL, et al. (2004) New quadriplex PCR assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. J Clin Microbiol 42:4947–55.[Abstract/Free Full Text]

33 von Eiff C, Heilmann C, Proctor RA, et al. (1997) A site-directed Staphylococcus aureus hemB mutant is a small-colony variant which persists intracellularly. J Bact 179:4706–12.[Abstract/Free Full Text]

34 Andrews JM. (2001) Determination of minimum inhibitory concentrations. J Antimicrob Chemother 48:5–16.[Abstract]

35 Gomez Escalada M, Russell AD, Maillard JY, et al. (2005) Triclosan-bacteria interactions: single or multiple target sites? Lett Appl Microbiol 41:476–81.[CrossRef][ISI][Medline]

36 Walsh SE, Maillard JY, Russell AD. (1999) Ortho-phthalaldehyde: a possible alternative to glutaraldehyde for high level disinfection. J Appl Microbiol 86:1039–46.[CrossRef][Medline]

37 Langsrud S and Sundheim G. (1998) Factors influencing a suspension test method for antimicrobial activity of disinfectants. J Appl Microbiol 85:1006–12.[Medline]

38 Enright MC, Day NPJ, Davies CE, et al. (2000) Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol 38:1008–15.[Abstract/Free Full Text]

39 Slater-Radosti C, Van Aller G, Greenwood R, et al. (2001) Biochemical and genetic characterization of the action of triclosan on Staphylococcus aureus. J Antimicrob Chemother 48:1–6.[Abstract/Free Full Text]

40 Kahl BC, Belling G, Reichelt R, et al. (2003) Thymidine-dependent small-colony variants of Staphylococcus aureus exhibit gross morphological and ultrastructural changes consistent with impaired cell separation. J Clin Microbiol 41:410–13.[Abstract/Free Full Text]

41 Vesga O, Groeschel MC, Otten MF, et al. (1996) Staphylococcus aureus small colony variants are induced by the endothelial cell intracellular milieu. J Infect Dis 173:739–42.[ISI][Medline]

42 Barcia-Macay M, Seral C, Mingeot-Leclercq M-P, et al. (2006) Pharmacodynamic evaluation of the intracellular activities of antibiotics against Staphylococcus aureus in a model of THP-1 macrophages. Antimicrob Agents Chemother 50:841–51.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
T. Norstrom, J. Lannergard, and D. Hughes
Genetic and Phenotypic Identification of Fusidic Acid-Resistant Mutants with the Small-Colony-Variant Phenotype in Staphylococcus aureus
Antimicrob. Agents Chemother., December 1, 2007; 51(12): 4438 - 4446.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
V. A. Gant, M. W. D. Wren, M. S. M. Rollins, A. Jeanes, S. S. Hickok, and T. J. Hall
Three novel highly charged copper-based biocides: safety and efficacy against healthcare-associated organisms
J. Antimicrob. Chemother., August 1, 2007; 60(2): 294 - 299.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
P. F. Seaman, D. Ochs, and M. J. Day
Comment on: Triclosan resistance in methicillin-resistant Staphylococcus aureus expressed as small colony variants: a novel mode of evasion of susceptibility to antiseptics
J. Antimicrob. Chemother., July 1, 2007; 60(1): 175 - 176.
[Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
R. Bayston, W. Ashraf, and T. Smith
Triclosan resistance in methicillin-resistant Staphylococcus aureus expressed as small colony variants: a novel mode of evasion of susceptibility to antiseptics--authors' response
J. Antimicrob. Chemother., July 1, 2007; 60(1): 176 - 177.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
59/1/43    most recent
dkl450v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Seaman, P. F.
Right arrow Articles by Day, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seaman, P. F.
Right arrow Articles by Day, M. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?