JAC Advance Access originally published online on October 9, 2006
Journal of Antimicrobial Chemotherapy 2006 58(6):1250-1253; doi:10.1093/jac/dkl407
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression of the las and rhl quorum-sensing systems in clinical isolates of Pseudomonas aeruginosa does not correlate with efflux pump expression or antimicrobial resistance
Division of Infectious Diseases, State University of New York Downstate Medical Center 450 Clarkson Avenue, Brooklyn, NY 11203, USA
*Corresponding author: Tel: +1-718-270-2148; Fax: +1-718-270-2465; E-mail: jquale{at}downstate.edu
Received 30 June 2006; returned 17 August 2006; revised 6 September 2006; accepted 12 September 2006
| Abstract |
|---|
|
|
|---|
Objectives: Quorum-sensing systems regulate expression of several virulence factors and may affect the MexAB-OprM efflux system in Pseudomonas aeruginosa. This study investigated the relationship between two quorum-sensing systems, efflux pump MexAB-OprM expression and antimicrobial resistance in 33 clinical isolates of P. aeruginosa.
Methods: Expression of the quorum-sensing regulatory genes lasR and rhlR was assessed by real time RTPCR. The autoinducer synthetase genes lasI and rhlI and the regulatory genes mexT and mexS were characterized by DNA sequencing. Production of pyocyanin and elastase in each of the isolates was also determined.
Results: While there was a significant correlation between expression of the quorum-sensing regulatory genes and production of pyocyanin and elastase, there was no correlation with expression of mexA or with antimicrobial resistance. There were no mutations in lasI, rhlI, mexT or mexS that correlated with quorum-sensing expression.
Conclusions: Increased activity of two quorum-sensing systems in P. aeruginosa does not contribute to increased mexA expression or antimicrobial resistance.
Keywords: virulence mechanisms , resistance mechanisms , ß-lactamase
| Introduction |
|---|
|
|
|---|
Pseudomonas aeruginosa is a common pathogen in immunocompromised patients, afflicting those with cystic fibrosis, burns and those in intensive care areas. P. aeruginosa is well known to produce a variety of virulence proteins that can affect the severity of infections. These virulence proteins are controlled by quorum-sensing systems, and loss of these systems impairs the virulence of the bacterial isolate.1 Two quorum-sensing systems in P. aeruginosa have been characterized. The las system is governed by the transcriptional regulator LasR. When activated by the autoinducer N-(3-oxododecanoyl-homoserine lactone (3OC12-HSL), the las system triggers the expression of staphylolytic protease, exotoxin A, elastase, and its autoinducer synthetase (lasI).1 The second system, rhl, is controlled by the regulator RhlR. When activated by the autoinducer N-butyryl-homoserine lactone (C4-HSL), RhlR enhances the expression of rhamnolipid biosynthesis, elastase, pyocyanin and its autoinducer synthetase (rhl1).1 The las system also enhances expression of rhlR and rhlI.1,2 A third signal, Pseudomonas quinolone signal (PQS), is also intricately involved with the las and rhl quorum-sensing systems.3 The PQS also regulates the expression of LasB elastase, is governed by the las system and requires the presence of RhlR.3
It is also apparent that quorum sensing may be related to antimicrobial resistance. The autoinducer C4-HSL can enhance the expression of MexAB-OprM,4,5 an efflux system with a wide variety of antibiotic substrates. However, this activation is negated in laboratory-derived nfxC mutants (known to be hypersusceptible to ß-lactam antibiotics, with the exclusion of imipenem), and is dependent on the presence of a functional MexT.5 MexT has also been implicated as a global regulator, involved in the control of OprD,6 and is under the control of mexS.7 More recently, AmpR, the regulator of the chromosomal ß-lactamase AmpC, has been shown to also be a global regulator, increasing the expression of lasB and rhlR, and decreasing lasA, lasI, lasR and pyocyanin expression.8
In this report, we characterize the two quorum-sensing systems, las and rhl, in P. aeruginosa clinical isolates and their regulation of the MexAB-OprM efflux system and antimicrobial resistance.
| Materials and methods |
|---|
|
|
|---|
The 33 isolates of P. aeruginosa examined in this report have undergone preliminary characterization as reported elsewhere.9 The isolates represent clinical strains from patients in Brooklyn, NY, USA and were selected for their varying degrees of ß-lactam susceptibility.
Real time reverse transcriptase PCR (RTPCR) studies
Expression of lasR and rhlR was determined using real time RTPCR. An overnight culture was diluted 1:100 in MuellerHinton broth and grown to the late log phase of growth. RNA was isolated and treated with DNase using the RNeasy kit (Qiagen Inc). RNA (2 µL) adjusted to a concentration of 25 mg/L was used for all RTPCR experiments; the housekeeping gene rpoD was used as the normalizing gene.10 Primers for lasR and rhlR expression were lasR forward, 5'-AAGGAAGTGTTGCAGTGGTG-3' and reverse, 5'-GAGCAGTTGCAGATAACCGA-3', and the probe for detection was 5'-[DFAM] CCCAACTGGTCTTGCCGATGG [DTAM]-3'); and rhlR forward, 5'-GACCAGGAGTTCGACCAGTT-3' and reverse, 5'-GGTAGGCGAAGACTTCCTTG-3', and the probe for detection was 5'-[DFAM] CCGACGACCGACGCCCGACCT [DTAM]-3'. Primer and probe concentrations were adjusted to provide amplification efficiencies of
90110% for all experiments. Real time RTPCR experiments were performed using the Brilliant QRTPCR Master Mix (Stratagene). Samples were run in triplicate; virtually all individual results were within 0.5 Ct units of the averaged triplicate value. Controls run without reverse transcriptase confirmed the absence of contaminating DNA in any of the samples. Carboxy-X-rhodamine (ROX) was included as a reference dye. Normalized expression of lasR and rhlR was calibrated against corresponding mRNA expression by P. aeruginosa ATCC 27853; results are given as the relative expression of the mRNA compared to P. aeruginosa 27853. When compared to the standard strain PAO1, P. aeruginosa ATCC 27853 has comparable expression of lasR (relative expression = 1.5 compared to PAO1), rhlR (relative expression = 0.93) and mexA (relative expression = 0.84).
DNA sequencing studies
To search for the presence of mutations that may affect the quorum-sensing synthetase genes, lasI and rhlI underwent PCR amplification and sequencing. The following primers were used for amplification and sequencing: lasI forward, 5'-ATGATCGTACAAATTGGTCGGC-3' and lasI reverse, 5'-GTCATGAAACCGCCAGTCG-3'; rhlI forward, 5'-CTTGGTCATGATCGAATTGCTC-3' and rhlI reverse, 5'-ACGGCTGACGACCTCACAC-3'. The PCR conditions were 94°C for 15 min, followed by 30 cycles of 94°C for 30 s, 56°C for 30 s and 72°C for 30 s, followed by a final extension at 72°C for 10 min.
The regulatory genes mexR, nalC, nalD and mexT have been previously characterized for the isolates and reported elsewhere.9 The gene mexS was amplified and sequenced using previously reported primers and PCR conditions.7
Amplified products underwent bi-directional sequencing using the automated fluorescent dye-terminator sequencing system (Applied Biosystems, Foster City, CA, USA). Sequences were compared with those of the PAO1 strain of P. aeruginosa using the BLAST program from the National Center for Biotechnology Information.
Virulence factor expression studies
To correlate the expression of the quorum-sensing systems with virulence factor expression, pyocyanin and elastase production were quantified in each isolate. Isolates were grown in Pseudomonas broth for spectrophotometric determination of pyocyanin production, as previously described.8 Elastase production was determined following growth in LB broth, and also assessed spectrophotometrically.8 Pyocyanin and elastase production were calibrated for the inoculum (determined spectrophotometrically) present prior to the assay, and results are given as relative expression compared to P. aeruginosa ATCC 27853 (as in the real time RTPCR studies).
Multiple regression analysis, to correlate quorum-sensing expression to that of efflux pump and virulence factor expression, was performed using SPSS (Chicago, IL, USA). This study was approved by the Institutional Review Board at SUNY-Downstate.
| Results and discussion |
|---|
|
|
|---|
The susceptibility data and relative expression of rhlR, lasR and mexA of the 33 clinical isolates are presented in Table 1. Overall, there was no discernible correlation between rhlR and/or lasR expression and antibiotic susceptibility. In addition, there was no association between rhlR and lasR expression and that of mexA. Eleven isolates had increased expression of mexA (defined as a
2-fold increase compared to P. aeruginosa ATCC 27853).9 Eight of these isolates had mutations affecting nalC or nalD to account for the increased expression.9 Of the remaining three isolates with increased expression of mexA, two (MD104 and CK516) had increased expression of both rhlR and lasR. However, other isolates without elevated mexA expression had similarly increased expression of rhlR and lasR, suggesting other factors were involved.
|
Of the 33 isolates, 24 had Ser62
Gly and 31 had Asp83
Glu changes affecting RhlI; these changes were also present in the control strain. One isolate (UL517) also had an Arg41
Lys change affecting this protein that correlated with a moderately depressed expression of rhlR. A single isolate (MD119) had a Phe11
Leu affecting LasI; this isolate had comparable expression of the quorum-sensing genes compared to the control isolate. All of the isolates possessed the 8 bp insert characteristic of a non-functional MexT.9,10 An Asp249
Val substitution involving MexS was seen in 32 isolates (and in the control); three additional isolates had mutations causing a Gly78
Ser. There was a significant correlation between lasR and rhlR expression among the clinical isolates (P = 0.002). A significant association was also observed between rhlR expression and pyocyanin production (P < 0.001) and between lasR expression and elastase production (P = 0.001).
The MexAB-OprM efflux system is an important contributor to intrinsic antimicrobial resistance in P. aeruginosa. The control of this system is multifactorial; mexR, nalC and nalD are regulatory genes implicated in the control of the mexAB-oprM operon. In addition, accumulation of the rhl quorum system autoinducer C4-HSL has been associated with increased expression of MexAB-OprM in laboratory-derived strains.4 It is conceivable, therefore, that increased expression of virulence factors may be linked to reduced susceptibility to antimicrobial agents. However, in this report, no association was found between expression of two quorum-sensing systems and mexAB-oprM expression (or antimicrobial resistance). While manipulating laboratory-derived isogenic mutants is crucial for understanding the regulatory systems in P. aeruginosa, it is also important to examine these systems in clinical isolates to determine the applicability of laboratory findings. For example, while mutations in ampR and mexR can clearly affect their respective operons, they do not seem to be important in most clinical isolates.9 Our studies also re-affirm that the mexS-mexT-mexEF-oprN operon is not functional in most clinical isolates, and that the various roles ascribed to MexT are not relevant in the clinical setting.5,6
| Transparency declarations |
|---|
|
|
|---|
Drs S. B. and J. Q. have received research grant support from Merck & Co., Pfizer Inc., Cubist Pharmaceuticals, Wyeth Pharmaceuticals and Elan Pharmaceuticals.
| Acknowledgements |
|---|
This work was supported by a grant from Merck & Co., Inc.
| References |
|---|
|
|
|---|
1 Rumbaugh KP, Griswold JA, Hamood AN. (2000) The role of quorum sensing in the in vivo virulence of Pseudomonas aeruginosa. Microbes Infect 2:172131.[CrossRef][ISI][Medline]
2
Pesci EC, Pearson JP, Seed PC, et al. (1997) Regulation of las and rhl quorum sensing in Pseudomonas aeruginosa. J Bacteriol 179:312732.
3
Pesci EC, Milbank JBJ, Pearson JP, et al. (1999) Quinolone signaling in the cell-to-cell communication system of Pseudomonas aeruginosa. Proc Natl Acad Sci USA 96:1122934.
4 Swada I, Maseda H, Nakae T, et al. (2004) A quorum-sensing autoinducer enhances the mexAB-oprM efflux-pump expression without the MexR-mediated regulation in Pseudomonas aeruginosa. Microbiol Immunol 48:4359.[ISI][Medline]
5 Maseda H, Sawada I, Saito K, et al. (2004) Enhancement of the mexAB-oprM efflux pump expression by a quorum-sensing autoinducer and its cancellation by a regulator, MexT, of the mexEF-oprN efflux pump operon in Pseudomonas aeruginosa. Antimicrob Agents Chemother 48:13308.
6
Kohler T, Epp SF, Curty K, et al. (1999) Characterization of MexT, the regulator of the MexE-MexF-OprN multidrug efflux system of Pseudomonas aeruginosa. J Bacteriol 181:63005.
7
Sobel ML, Neshat S, Poole K. (2005) Mutations in PA2491 (mexS) promote MexT-dependent mexEF-oprN expression and multidrug resistance in a clinical strain of Pseudomonas aeruginosa. J Bacteriol 187:124653.
8
Kong K-F, Jayawardena SR, Indulkar SD, et al. (2005) Pseudomonas aeruginosa AmpR is a global transcriptional factor that regulates expression of AmpC and PoxB ß-lactamases, proteases, quorum sensing, and other virulence factors. Antimicrob Agents Chemother 49:456775.
9
Quale J, Bratu S, Gupta J, et al. (2006) Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother 50:163341.
10
Kohler T, van Delden C, Curty LK, et al. (2001) Overexpression of the MexEF-OprN multidrug efflux system affects cell-to-cell signaling in Pseudomonas aeruginosa. J Bacteriol 183:521322.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||