JAC Advance Access originally published online on October 12, 2006
Journal of Antimicrobial Chemotherapy 2006 58(6):1246-1249; doi:10.1093/jac/dkl411
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genetic characterization of the dihydrofolate reductase gene of Pneumocystis jirovecii isolates from Portugal
1 Unidade de Protozoários Oportunistas/VIH e outras Protozooses, Unidade de Parasitologia e Microbiologia Médicas (UPMM) Instituto de Higiene e Medicina Tropical, Rua da Junqueira 96, 1349-008 Lisboa, Portugal 2 Clínica das Doenças Infecciosas Hospital de Santa Maria, Avenida Prof. Egas Moniz, 1649-028 Lisboa, Portugal
*Corresponding author. Tel: +351-21-3652638; Fax: +351-21-3632105; E-mail: omatos{at}ihmt.unl.pt
Received 24 April 2006; returned 24 July 2006; revised 14 September 2006; accepted 14 September 2006
| Abstract |
|---|
|
|
|---|
Objectives: The aim of the present study was to evaluate the genetic variation of Pneumocystis jirovecii dihydrofolate reductase (DHFR) gene in an immunocompromised Portuguese population and to investigate the possible association between DHFR genotypes and P. jirovecii pneumonia (PcP) prophylaxis with co-trimoxazole.
Methods: One hundred and thirty-eight P. jirovecii isolates were submitted to DHFR genetic characterization by PCR and sequencing.
Results: In the studied population, 72.7% of the patients presented sequences identical to the wild-type sequence of the P. jirovecii DHFR gene and 27.3% presented point substitutions. A total of nine substitution sites were identified; four synonymous substitutions at nucleotide positions 201, 272, 312 and 381 were detected in 31 patients. Five non-synonymous substitutions were observed, leading to the DHFR mutations Leu-13
Ser, Asn-23
Ser, Ser-31
Phe, Met-52
Leu and Ala-67
Val. With the exception of the polymorphism at position 312 and the mutation at codon 52, all polymorphisms were reported in this study for the first time.
Conclusions: Our results suggest that DHFR gene polymorphisms are frequent in the Portuguese immunocompromised population but do not seem to be associated with PcP prophylaxis failure (P = 0.748 and P = 0.730).
Keywords: polymorphisms , mutations , co-trimoxazole , drug resistance
| Introduction |
|---|
|
|
|---|
Pneumonia caused by Pneumocystis jirovecii (PcP) is an important opportunistic infection in AIDS and other immunocompromised patients, although widespread PcP chemoprophylaxis and highly active antiretroviral therapy (HAART) have reduced the incidence of this infection.
Co-trimoxazole, a combination of sulfamethoxazole and trimethoprim, is the key agent for treatment and prophylaxis of PcP. Sulfamethoxazole inhibits the enzyme dihydropteroate synthase (DHPS) while trimethoprim targets the enzyme dihydrofolate reductase (DHFR), both components of the folic acid pathway.
Over the last few years, emergence of P. jirovecii sulfa resistance related with mutations at codons 55 and 57 of the DHPS gene has been suggested and demonstrated.1,2
Alteration of DHFR enzyme is also a common resistance mechanism in clinically important microbial pathogens, such as Plasmodium falciparum,3 Staphylococcus aureus4 and Streptococcus pneumoniae.5 However, information about the genetic variation of the P. jirovecii DHFR gene is scarce. Until now, few studies have addressed the genetic heterogeneity of the P. jirovecii DHFR gene,68 but only in one study have the authors established an association between DHFR non-synonymous polymorphisms and failure of PcP prophylaxis with DHFR inhibitors, namely with pyrimethamine.7
In this study, we intended to characterize the sequence variation of the DHFR gene from P. jirovecii isolated from Portuguese immunocompromised patients and to investigate the association of DHFR polymorphisms and failure of PcP prophylaxis.
| Materials and methods |
|---|
|
|
|---|
Specimens and patients
One hundred and thirty-eight pulmonary specimens (74 induced sputa, 62 bronchoalveolar lavage fluids and two oral washes) obtained between May 1995 and October 2004, from 128 immunocompromised patients with respiratory symptoms, were studied. Three patients had three pulmonary specimens collected during the PcP episode and four patients had two specimens collected. One hundred and nine patients were HIV-infected and eleven were HIV-negative (four with leukaemia, two with bone marrow aplasia, one transplant recipient and four unknown). In the remaining eight patients the cause of immunosuppression was not known. Data on anti-P. jirovecii prophylaxis were available for 114 patients: 89 patients were not receiving anti-P. jirovecii prophylaxis, and to our knowledge were not exposed to trimethoprim; and 25 were receiving anti-P. jirovecii prophylaxis (21 with co-trimoxazole and four with pentamidine).
The identification of P. jirovecii organisms was performed by indirect immunofluorescence with monoclonal antibodies (MonoFluo Kit Pneumocystis carinii, Sanofi Diagnostics Pasteur) and by the amplification of a fragment of the LSU-mtrRNA gene by nested-PCR.9
P. jirovecii DHFR gene amplification
Genomic DNA was extracted from pulmonary specimens by the Mini-BeadBeater/guanidinium thiocyanate-silica method, as described previously.10 The full length of the coding region of the DHFR gene was amplified by nested-PCR, with the external primers FR208 and FR1038 and with the internal primers FR242 and FR1018, with the use of Platinum® Taq DNA polymerase (Invitrogen), as described elsewhere.11 The nested-PCR yielded a 798 bp fragment, which was analysed by electrophoresis in a 1.5% agarose gel containing ethidium bromide (0.5 µg/mL).
Sequencing and cloning of DHFR PCR products
PCR products were purified with Jetquick PCR purification spin kit (Genomed). One hundred twenty-eight of the 138 DHFR fragments obtained were sequenced directly from both ends using the internal set of primers, FR242 (GTTTGGAATAGATTATGTTCATGGTGTACG) and FR1018 (GCTTCAAACCTTGTGTAACGCG). The remaining 10 fragments, randomly selected, were ligated into the pDrive cloning vector (Qiagen PCR Cloning Kit, Qiagen) and the ligated products were introduced into E. coli strain JM109 by transformation. Four to five recombinant plasmids for each PCR product cloned were purified with QIAprep Spin Miniprep Kit (Qiagen). Purified plasmid DNA was digested with restriction endonuclease EcoRI (Fermentas), and analysed by electrophoresis to confirm the presence of cloned inserts. Plasmid DNA with insert was sequenced from both ends with T7 and SP6 promoters flanking the cloning region. Sequencing of PCR and cloned fragments was conducted under BigDyeTM terminator (Applied Biosystems) cycling conditions on a 3730xl DNA Analyzer (Applied Biosystems), according to the manufacturer's instructions.
Nucleotide and derived amino acid sequences were aligned using the computer program CLUSTAL W (version 1.82), available at the European Bioinformatics Institute website (www.ebi.ac.uk), and compared with the sequences available at the GenBank database.
Statistical analysis
Statistical analysis was performed using SPSS version 13.0, for WINDOWS. Associations between failure of PcP prophylaxis and DHFR polymorphisms were investigated using
2 analysis. A P value < 0.05 was considered statistically significant. PcP prophylaxis was defined as adherence to co-trimoxazole chemoprophylaxis for a minimum of 2 months preceding PcP diagnosis. A failure of prophylaxis was defined as the development of PcP in patients who received anti-Pneumocystis prophylaxis.
Nucleotide sequence accession numbers
The accession numbers of the new DHFR sequences obtained in this study are DQ417355 [GenBank] through DQ417360 [GenBank] .
| Results |
|---|
|
|
|---|
In the present study, a 798 bp fragment of the P. jirovecii DHFR gene was sequenced and compared with the wild-type sequence present in GenBank (accession number AF090368 [GenBank] ).
Of the 128 PcP episodes studied, 93 (72.7%) presented sequences identical to the wild-type sequence of the P. jirovecii DHFR gene and in 35 (27.3%) point substitutions were identified (Table 1). A total of nine substitution sites were identified; four synonymous (silent) substitutions at nucleotide positions 201 (T to A), 272 (T to C), 312 (T to C) and 381 (C to T) were identified in 31 patients. Five non-synonymous substitutions at nucleotide positions 38 (T to C), 68 (A to G), 92 (C to T), 154 (A to T) and 200 (C to T), which lead to amino acid alterations at codons 13 (leucine to serine), 23 (asparagine to serine), 31 (serine to phenylalanine), 52 (methionine to leucine) and 67 (alanine to valine), respectively, were identified in five different patients. One patient presented simultaneously one synonymous polymorphism, at position 272, and one non-synonymous polymorphism, at codon 31.
|
Ten randomly selected specimens were cloned and four to five clones of each specimen were sequenced. In this study, all clones, from each specimen presented identical sequences. We did not detect a mixture of wild-type and polymorphic DHFR sequences.
Five specimens with cloned sequences presented synonymous polymorphisms at position 312, two cloned specimens had synonymous polymorphisms at position 381 and the remaining three cloned specimens presented wild-type sequences.
Among the seven patients with repeated pulmonary samples, collected during the same PcP episode, four presented wild-type genotype and three presented synonymous polymorphisms, two patients at positions 312 and one at position 381. The majority of the patients presented stable DHFR genotypes. The only exception was a patient with a synonymous substitution at position 312 in the first and second pulmonary specimens that presented the wild-type sequence in the third specimen. This patient did not receive PcP prophylaxis and was successfully treated with co-trimoxazole. In the remaining six patients, with repeated pulmonary specimens, the DHFR genotype was identical throughout the PcP episode.
Of the 128 PcP episodes studied, 21 occurred in patients receiving co-trimoxazole for PcP prophylaxis (Table 2). Among these, five presented polymorphisms in the DHFR gene: one had a non-synonymous polymorphism at codon 13; and four presented a synonymous polymorphism at nucleotide position 312. In the 93 patients not receiving co-trimoxazole for PcP prophylaxis (89 with no PcP prophylaxis and four receiving pentamidine), 69 presented wild-type sequences and 24 presented polymorphisms in the DHFR gene. In the remaining six patients with DHFR polymorphisms, there was no information available regarding anti-P. jirovecii prophylaxis use. In our study, the presence of DHFR polymorphisms, synonymous and non-synonymous, was not related to failure of co-trimoxazole prophylaxis (P = 0.748 and 0.730, respectively). Also among the 35 patients with DHFR polymorphisms, 17 were successfully treated with co-trimoxazole.
|
The five substitution sites that led to amino acid changes in the P. jirovecii DHFR gene were aligned and compared with the DHFR amino acid sequences of P. falciparum, S. aureus and in S. pneumoniae35 and no overlapping was observed.
| Discussion |
|---|
|
|
|---|
In the present study, involving 138 P. jirovecii isolates corresponding to 128 PcP episodes, 35 (27.3%) patients presented polymorphisms in the P. jirovecii DHFR gene, with five non-synonymous and four synonymous substitutions. The P. jirovecii DHFR polymorphisms identified in this study are reported for the first time, with the exception of synonymous substitution at position 312 and the mutation at codon 67 (Ala to Val).68,11 The mutation at codon 52 was described previously as the substitution of a methionine for an isoleucine.9 In our study, we detected an alteration of a methionine for a leucine, as a result of a nucleotide substitution at position 154. However, mutations described here do not match those known to cause trimethoprim or pyrimethamine resistance in other microorganisms.35
In our study, there was no statistically significant association between PcP prophylaxis failure and the occurrence of DHFR mutations. Of the five patients presenting the amino acid changes described here, only one was receiving co-trimoxazole for PcP prophylaxis. The remaining four patients, according to the clinical charts, had not been exposed to co-trimoxazole. In Portugal, this is a drug specially used for the prophylaxis of PcP and of toxoplasmic encephalitis, in HIV-positive patients. It is not commonly used in other situations. Also, it is not a common drug used in the general population for treatment of bacterial infections. Therefore, the mutations observed in this study may not be selected by trimethoprim use.
Nahimana et al.7 have reported a significant association between DHFR mutations and anti-P. jirovecii prophylaxis, however the majority of polymorphisms were detected in patients receiving pyrimethamine as a DHFR inhibitor, combined with sulfadoxine or atovaquone (all second-line drugs for PcP prophylaxis, rarely used). These authors suggested that pyrimethamine, rather than trimethoprim, could exert a higher pressure on the DHFR locus. In fact, in vitro kinetics studies demonstrated that pyrimethamine is a stronger inhibitor of the P. jirovecii DHFR than trimethoprim.12
Further studies on P. jirovecii DHFR genetic heterogeneity, in a larger patient population, need to be conducted in order to better characterize the role of this gene in the development of resistance to co-trimoxazole.
| Transparency declarations |
|---|
|
|
|---|
None to declare.
| Acknowledgements |
|---|
We thank Professor Celso Cunha (Unit of Molecular Biology, Institute of Hygiene and Tropical Medicine, Lisboa, Portugal) for his helpful assistance with cloning. This work was supported in part by Associação para a investigação e o desenvolvimento da Faculdade de Medicina de Lisboa.
| References |
|---|
|
|
|---|
1 Nahimana A, Rabodonirina M, Zanetti G, et al. (2003) Association between a specific Pneumocystis jiroveci dihydropteroate synthase mutation and failure of pyrimethamine/sulfadoxine prophylaxis in human immunodeficiency virus-positive and -negative patients. J Infect Dis 188:101723.[CrossRef][Web of Science][Medline]
2 Iliades P, Meshnick SR, Macreadie IG. (2005) Analysis of Pneumocystis jirovecii DHPS alleles implicated in sulfamethoxazole resistance using an Escherichia coli model system. Microb Drug Resist 11:18.[CrossRef][Web of Science][Medline]
3
Khalil I, Ronn AM, Alifrangis M, et al. (2003) Dihydrofolate reductase and dihydropteroate synthase genotypes associated with in vitro resistance of Plasmodium falciparum to pyrimethamine, trimethoprim, sulfadoxine, and sulfamethoxazole. Am J Trop Med Hyg 68:5869.
4 Dale GE, Broger C, D'Arcy A, et al. (1997) A single amino acid substitution in Staphylococcus aureus dihydrofolate reductase determines trimethoprim resistance. J Mol Biol 266:2330.[CrossRef][Web of Science][Medline]
5
Maskell JP, Sefton AM, Hall LM, et al. (2001) Multiple mutations modulate the function of dihydrofolate reductase in trimethoprim-resistant Streptococcus pneumoniae. Antimicrob Agents Chemother 45:11048.
6
Takahashi T, Endo T, Nakamura T, et al. (2002) Dihydrofolate reductase gene polymorphisms in Pneumocystis carinii f. sp. hominis in Japan. J Med Microbiol 51:5105.
7
Nahimana A, Rabodonirina M, Bille J, et al. (2004) Mutations of Pneumocystis jirovecii dihydrofolate reductase associated with failure of prophylaxis. Antimicrob Agents Chemother 48:43015.
8
Robberts FJ, Chalkley LJ, Weyer K, et al. (2005) Dihydropteroate synthase and novel dihydrofolate reductase gene mutations in strains of Pneumocystis jirovecii from South Africa. J Clin Microbiol 43:14434.
9 Matos O, Lundgren B, Caldeira L, et al. (2000) Evaluation of two nested polymerase chain reactions for diagnosis of Pneumocystis carinii pneumonia in immunocompromised patients. Clin Microbiol Infect 6:14951.[CrossRef][Web of Science][Medline]
10 Costa MC, Gaspar J, Mansinho K, et al. (2005) Detection of Pneumocystis jirovecii dihydropteroate synthase polymorphisms in patients with Pneumocystis pneumonia. Scand J Infect Dis 37:76671.[CrossRef][Web of Science][Medline]
11 Ma L, Borio L, Masur H, et al. (1999) Pneumocystis carinii dihydropteroate synthase but not dihydrofolate reductase gene mutations correlate with prior trimethoprim-sulfamethoxazole or dapsone use. J Infect Dis 180:196978.[CrossRef][Web of Science][Medline]
12
Ma L and Kovacs JA. (2000) Expression and characterization of recombinant human-derived Pneumocystis carinii dihydrofolate reductase. Antimicrob Agents Chemother 44:30926.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||