JAC Advance Access originally published online on May 23, 2006
Journal of Antimicrobial Chemotherapy 2006 58(1):173-177; doi:10.1093/jac/dkl207
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chloramphenicol and kanamycin resistance among porcine Escherichia coli in Ontario
1 Department of Pathobiology, University of Guelph Ontario, N1G 2W1, Canada 2 Department of Population Medicine, University of Guelph Ontario, N1G 2W1, Canada 3 Laboratory for Foodborne Zoonoses, Public Health Agency of Canada 110 Stone Road West, Guelph, Ontario, N1G 3W4, Canada
*Correspondence address. Department of Pathobiology, Ontario Veterinary College, Guelph, Ontario, N1G 2W1, Canada. Tel: +1-519-824-4120 ext. 54647; Fax: +1-519-824-5930; E-mail: pboerlin{at}uoguelph.ca
Received 28 February 2006; returned 22 March 2006; revised 26 April 2006; accepted 27 April 2006
| Abstract |
|---|
|
|
|---|
Objectives: The purpose of this study was to compare the distribution of chloramphenicol and kanamycin resistance genes across three populations of porcine Escherichia coli.
Methods: PCR was used to assess the distribution of the major chloramphenicol and kanamycin resistance genes catA1, cmlA and floR, and aphA1, aphA2 and aadB in enterotoxigenic E. coli (ETEC), non-ETEC isolates from cases of diarrhoea and commensal E. coli from healthy pigs. Associations between these genes and resistance genes for other antimicrobials or virulence genes were assessed.
Results: The chloramphenicol and kanamycin resistance genes were distributed differently among the three E. coli populations. While aphA1, aphA2 and aadB were evenly distributed among resistant ETEC, non-ETEC and commensals, the catA1 gene was significantly more frequent in ETEC than in non-ETEC and commensals. Transformation experiments confirmed statistical associations by demonstrating that elt, estB, astA, aadA and sul1 were located with catA1 on a large ETEC plasmid. Plasmids carrying cmlA also carried sul3 and aadA. Other plasmids carrying floR and aadB also carried tet(A), sul2, strA/strB, blaCMY-2 and occasionally aac(3)IV.
Conclusions: The clustering of genes observed is a likely cause for chloramphenicol resistance persistence. Similar to tetracycline, chloramphenicol resistance genes are physically linked to virulence genes. This is not the case for kanamycin resistance determinants, which were linked to other resistance genes only.
Keywords: chloramphenicol resistance , kanamycin resistance , E. coli , swine , genotyping , plasmids
| Introduction |
|---|
|
|
|---|
Antimicrobials are heavily used in veterinary medicine and agriculture. Over time, bacteria develop resistance to these agents, which may later persist despite discontinuation of the corresponding antimicrobial agents. This was observed with chloramphenicol, as resistance to this antimicrobial was still high after its ban in 1985.14 To counter the rise of antimicrobial resistance, there is a push to establish legislation to ban/limit the use of antimicrobials for growth promotion and disease prevention in agriculture. Therefore, it is important to investigate mechanisms driving antimicrobial resistance persistence and to determine potential effects of banning single selected antimicrobial agents in food animals versus applying general limitations.
Unlike chloramphenicol, neomycin is used in the Ontario swine industry;5 however, resistance to kanamycin/neomycin shows similar distributions to chloramphenicol resistance in porcine Escherichia coli.3 The comparison of resistance gene distributions and their linkages with other genes may help elucidate the reasons for the observed similarities in frequency and the persistence of chloramphenicol resistance.
The objective of the present study was to assess and compare the frequency and distribution of chloramphenicol and kanamycin/neomycin resistance genes among porcine E. coli and to investigate gene clustering. Potential gene associations were detected by statistical analysis, followed by molecular investigations to confirm gene linkages. Based on previous studies,2 three main resistance genes were investigated for both chloramphenicol (catA1, cmlA and floR) and kanamycin (aphA1, aphA2 and aadB).
| Materials and methods |
|---|
|
|
|---|
Bacterial isolates
A total of 318 porcine E. coli isolates previously classified as enterotoxigenic E. coli (ETEC), non-ETEC from cases of diarrhoea and commensals from healthy pigs, and characterized in detail for their antimicrobial resistance and virulence genotypes, were used.3 Epidemiologically unrelated isolates (n = 166) were selected as described previously.3 All isolates were previously tested for their susceptibility to 19 antimicrobial agents using the broth microdilution method and disc diffusion.3 In epidemiologically unrelated isolates, 61% (4577%) and 56% (4072%) of ETEC isolates, 45% (2862%) and 15% (327%) of non-ETEC isolates, and 19% (1226%) and 10% (416%) of commensal isolates were chloramphenicol resistant (chlR) and kanamycin resistant (kanR), respectively.3
Genotyping
Genotypes for resistance to tetracycline [tet(A), tet(B), tet(C)], spectinomycin/streptomycin (aadA), streptomycin (strA/strB), sulphonamides (sul1, sul2, sul3) and apramycin/tobramycin/gentamicin [aac(3)IV] had been previously assessed.3 Single, duplex and triplex PCRs were used to detect catA1; cmlA and floR; and aphA1, aphA2 and aadB, respectively, using the multiplex PCR kit from QIAGEN® (Missisauga, Ontario, Canada). The primers for catA1, floR and aphA1 had been previously described and validated.2 New primers for cmlA (cmlA-L: TTGCAACAGTACGTGACAT, cmlA-R: ACACAACGTGTACAACCAG), aphA2 (aphA2-L: GATTGAACAAGATGGATTGC, aphA2-R: CCATGATGGATACTTTCTCG) and aadB (aadB-L: GAGGAGTTGGACTATGGATT, aadB-R: CTTCATCGGCATAGTAAAAG) were designed and validated by comparison with susceptibility testing and dot-blot hybridization results following standard protocols.6 All PCRs used an annealing temperature of 55°C and the products for cmlA, aphA2 and aadB were 293, 347 and 208 bp long, respectively. The control strains used for aadB, aphA2 and floR were Tn1409, M155 and CVM-1807 as used previously.2 The control strains used for aphA1, catA1 and cmlA were AMR-108, AMR-110 and RL-0607 from our collection. Virulence genotypes for faeG, fanA, fasA, fedA, aida-1, astA, elt, estA, estB, stx2e, paa and sepA were previously detected by PCR.3
Transformations
Plasmid DNA was obtained from E. coli isolates randomly selected based on their chlR genotype (n = 16) and kanR genotype (n = 15) using the QIAGEN® plasmid mini kit. Southern hybridizations for catA1, cmlA, floR, aphA1, aphA2 and aadB were performed with the plasmid DNA from each isolate following standard protocols6 to confirm they were plasmidic. Probes were made using the DIG-labelling kit (Roche, Mannheim, Germany) and the aforementioned PCRs. Plasmid DNA was transferred into E. coli DH10B by electroporation using a Bio-Rad electroporation pulser (Bio-Rad, Hercules CA, USA) following standard protocols.6 Transformants were recovered using LuriaBertani (LB) agar (Becton Dickinson, Sparks, MD, USA) containing 20 mg/L chloramphenicol (Sigma-Aldrich, St Louis, MO, USA) or 50 mg/L kanamycin (Sigma-Aldrich). Plasmids were isolated from transformants using the QIAGEN® plasmid mini kit. Gel electrophoresis confirmed that each transformant contained single plasmids.
Each transformant, recipient strain DH10B and control strains were tested for susceptibility to ampicillin, cefoxitin, chloramphenicol, trimethoprim, ceftiofur, spectinomycin, amoxicillin/clavulanic acid, tetracycline, gentamicin, sulfisoxazole, apramycin, florfenicol, kanamycin and neomycin by disc diffusion.7 PCR was performed on transformants to confirm the presence of catA1, cmlA, floR, aphA1, aphA2 or aadB and to detect other antimicrobial resistance genes (AMR genes), including blaCMY-2,8 and virulence genes described elsewhere.3
Statistical analysis
Ninety-five per cent confidence intervals on proportions were obtained using NCSS (NCSS Statistical Software, Kaysville, UT, USA). Exact P values for
2 tests and Fischer's exact tests and odds ratios (including 95% confidence intervals using Sternes limits) were obtained with software produced by William Sears, Department of Population Medicine, Ontario Veterinary College, Guelph, Canada.
| Results |
|---|
|
|
|---|
Genotyping
The distribution of catA1, cmlA, floR, aphA1, aphA2 and aadB in ETEC, non-ETEC and commensal populations is presented in Figure 1. The catA1 gene was more prevalent among ETEC isolates (P
6.81 x 108). The cmlA gene was more prevalent among commensal isolates (P
0.0001). The floR gene was found with similar frequencies among both ETEC and non-ETEC populations (P
0.33), but was absent among commensals (P = 0.16). The proportion of aphA1, aphA2 and aadB was not significantly different among the three E. coli populations (P
0.3). Statistical associations between the chlR and kanR genes, AMR genes and virulence genes are presented in Table 1.
|
|
Transformations
Hybridization studies demonstrated that chlR and kanR genes were plasmidic in all 31 isolates investigated (results not shown). Despite repeated attempts only 11 chlR transformants and 11 kanR transformants containing single plasmids were obtained. The resistance phenotype of all but one transformant matched the genotypes obtained by PCR. The only exception was a cmlA-positive transformant with a slightly reduced susceptibility to florfenicol despite the absence of a detectable floR. Physical linkages explained several statistical associations including those between catA1, sul1, aadA, elt, astA and estB (found in all six catA1-positive isolates tested); between cmlA, aadA and sul3 (found in all three cmlA-positive isolates tested); and between aadB, floR, aac(3)IV, strA/strB, sul2 and tet(A) (found in three of six aphA1-positive isolates tested). ETEC virulence genes were not associated with any kanR gene.
| Discussion |
|---|
|
|
|---|
In accordance to other observations in North America, our previous study showed that chloramphenicol and kanamycin resistance is more prevalent among ETEC than other E. coli strains.1,3,9 The distribution of chloramphenicol and kanamycin resistance is complex since multiple genes are responsible for the same phenotype.10,11 The present study shows significant differences between populations in the distribution of chlR genes and that catA1 predominates in resistant ETEC. While all three kanR genes were found with similar frequencies across all resistant E. coli populations, aphA1 was more frequent. Maynard et al.2 similarly showed that catI (same as catA1) was present in 79%, aphA1 in 87% and aphA2 in 19% of resistant ETEC isolates in Quebec, Canada, while aadB was absent. On the contrary, Bischoff et al.1 found that 98% of chlR ETEC isolates in Oklahoma, USA, carried cmlA, 8% contained cat-2 and 2% had flo. This difference could result from the presence of different ETEC strains or from the spread of different plasmids in Canadian and American populations due to different selection pressures. The recent emergence of a new porcine ETEC strain in Ontario with a new virulence combined antimicrobial resistancevirulence plasmid may support these hypotheses.12
Several statistical associations were observed between chlR genes, kanR genes, AMR genes and virulence genes. Of most interest were associations between catA1, sul1, aadA, aac(3)IV, tet(A), elt and astA and between floR, aac(3)IV, strA/strB, sul2, tet(A) and aadB. The association between catA1 and aac(3)IV had previously been observed in Canadian ETEC by Maynard et al.2 While transformation experiments confirmed that catA1, sul1, aadA, elt and astA were physically linked on a plasmid, the statistical associations observed between catA1, tet(A) and aac(3)IV were indirect and due to the simultaneous presence of several virulence and resistance plasmids in a single major ETEC clone.3 Transformation experiments confirmed that aadB, floR, aac(3)IV, strA/strB, sul2 and tet(A) were carried on a single plasmid with blaCMY-2. Such associations, which may be of great public health relevance, have already been described on other Salmonella and E. coli plasmids in North America.13
In conclusion, these results show that despite strong similarities at the phenotype level major genotypic differences exist between chloramphenicol and kanamycin resistance. KanR genes have a similar distribution across pathogenic and non-pathogenic porcine E. coli, whereas major differences exist in the relative distribution of chlR genes. Both kanR and chlR genes are frequently linked to other AMR genes. However, like tetracycline resistance genes,3 catA1 is additionally linked to virulence genes on large ETEC plasmids. These linkages may in part explain the long-term persistence of chloramphenicol resistance in ETEC despite its withdrawal years ago. In addition, major differences in the distribution of these linkages can be observed depending on the geographical origin of the strains under investigation. Consequently, resistance must be analysed genotypically with local representative samples to be fully understood.
The present approach incorporating both statistical and molecular methods for investigating gene linkages is a valuable tool, providing numerical evidence that is further supported by a detailed analysis of the underlying genetic phenomena. Finally, the study supports the hypothesis that banning single antimicrobial agents is not always enough to reduce the burden of antimicrobial resistance. More comprehensive evidence-based approaches are needed.
| Transparency declarations |
|---|
|
|
|---|
None to declare.
| Acknowledgements |
|---|
We thank Vivian Nicholson for technical assistance and Jeff Gray and Josée Harel for providing control strains. Funding was provided by Ontario Pork, the Public Health Agency of Canada, and the Ontario Ministry of Agriculture, Food and Rural Affairs (OMAFRA).
| References |
|---|
|
|
|---|
1 Bischoff KM, White DG, McDermott PF, et al. (2002) Characterization of chloramphenicol resistance in ß-hemolytic Escherichia coli associated with diarrhea in neonatal swine. J Clin Microbiol 40:38994.
2
Maynard C, Fairbrother JM, Bekal S, et al. (2003) Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrobial Agents Chemother 47:321421.
3
Boerlin P, Travis R, Gyles CL, et al. (2005) Antimicrobial resistance and virulence genes of Escherichia coli isolates from swine in Ontario. Appl Environ Microbiol 71:675361.
4 Gilmore A. (1986) Chloramphenicol and the politics of health. Can Med Assoc J 134:4325.
5 Amezcua R, Friendship RM, Dewey CE, et al. (2002) Presentation of postweaning Escherichia coli diarrhea in southern Ontario, prevalence of hemolytic E. coli serogroups involved, and their antimicrobial resistance patterns. Can J Vet Res 66:738.[Medline]
6 Sambrook J and Russell DW. (2001) Molecular Cloning (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press).
7 National Committee for Clinical Laboratory Standards. (2002) Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals: Approved Standard M31-A2 (NCCLS, Wayne, PA, USA).
8 Allen KJ and Poppe C. (2002) Occurrence and characterization of resistance to extended-spectrum cephalosporins mediated by ß-lactamase CMY-2 in Salmonella isolated from food-producing animals in Canada. Can J Vet Res 66:13744.[Medline]
9 Irwin R, Dore K, Reid-Smith R. (2002/2003) Canadian integrated program for antimicrobial resistance surveillance (CIPARS). http://www.phac-aspc.gc.ca/cipars-picra/index.html (17 April 2006, date last accessed).
10 Schwarz S, Kehrenberg C, Doublet B, et al. (2004) Molecular basis of bacterial resistance to chloramphenicol and florfenicol. FEMS Microbiol Rev 28:51942.[CrossRef][ISI][Medline]
11
Shaw KJ, Rather PN, Miller GH. (1993) Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiol Rev 57:13863.
12 Noamani BN, Fairbrother JM, Gyles CL. (2003) Virulence genes of O149 enterotoxigenic Escherichia coli from outbreaks of postweaning diarrhea in pigs. Vet Microbiol 97:87101.[CrossRef][Medline]
13
Winokur PL, Brueggemann A, DeSalvo DL, et al. (2000) Animal and human multidrug-resistant, cephalosporin-resistant Salmonella isolates expressing a plasmid-mediated CMY-2 AmpC ß-lactamase. Antimicrob Agents Chemother 44:277783.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
P. Duriez, Y. Zhang, Z. Lu, A. Scott, and E. Topp Loss of Virulence Genes in Escherichia coli Populations during Manure Storage on a Commercial Swine Farm Appl. Envir. Microbiol., July 1, 2008; 74(13): 3935 - 3942. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Gow, C. L. Waldner, J. Harel, and P. Boerlin Associations between Antimicrobial Resistance Genes in Fecal Generic Escherichia coli Isolates from Cow-Calf Herds in Western Canada Appl. Envir. Microbiol., June 15, 2008; 74(12): 3658 - 3666. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Millar, A. Philpott, M. Wilks, A. Whiley, S. Warwick, E. Hennessy, P. Coen, S. Kempley, F. Stacey, and K. Costeloe Colonization and Persistence of Antibiotic-Resistant Enterobacteriaceae Strains in Infants Nursed in Two Neonatal Intensive Care Units in East London, United Kingdom J. Clin. Microbiol., February 1, 2008; 46(2): 560 - 567. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Diarra, F. G. Silversides, F. Diarrassouba, J. Pritchard, L. Masson, R. Brousseau, C. Bonnet, P. Delaquis, S. Bach, B. J. Skura, et al. Impact of Feed Supplementation with Antimicrobial Agents on Growth Performance of Broiler Chickens, Clostridium perfringens and Enterococcus Counts, and Antibiotic Resistance Phenotypes and Distribution of Antimicrobial Resistance Determinants in Escherichia coli Isolates Appl. Envir. Microbiol., October 15, 2007; 73(20): 6566 - 6576. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Duriez and E. Topp Temporal Dynamics and Impact of Manure Storage on Antibiotic Resistance Patterns and Population Structure of Escherichia coli Isolates from a Commercial Swine Farm Appl. Envir. Microbiol., September 1, 2007; 73(17): 5486 - 5493. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


