Skip Navigation


JAC Advance Access originally published online on March 20, 2006
Journal of Antimicrobial Chemotherapy 2006 57(5):914-923; doi:10.1093/jac/dkl093
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
57/5/914    most recent
dkl093v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Watters, A. A.
Right arrow Articles by Fritsche, T. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watters, A. A.
Right arrow Articles by Fritsche, T. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Antimicrobial activity of a novel peptide deformylase inhibitor, LBM415, tested against respiratory tract and cutaneous infection pathogens: a global surveillance report (2003–2004)

Amy A. Watters1,*, Ronald N. Jones1,2, Jennifer A. Leeds3, Gerald Denys4, Helio S. Sader1 and Thomas R. Fritsche1

1 JMI Laboratories, 345 Beaver Kreek Centre, Suite A, North Liberty, IA 52317, USA; 2 Tufts University School of Medicine, Boston, MA, USA; 3 Novartis Institute for Biomedical Research, Cambridge, MA, USA; 4 Clarian Health Partners, Inc., Methodist Hospital, Indianapolis, IN, USA


* Corresponding author. Tel: +1-319-665-3370; Fax: +1-319-665-3371; E-mail: amy-watters{at}jmilabs.com

Received 9 November 2005; returned 18 February 2006; revised 24 February 2006; accepted 27 February 2006


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Objectives: To evaluate the spectrum of activity and potency of LBM415, the first of the peptide deformylase inhibitor (PDFI) class to be developed for treatment of community-acquired respiratory tract infections and uncomplicated skin and soft tissue infections (uSSTI), against a large, contemporary international collection of targeted pathogens collected during 2003–2004.

Methods: A total of 21 636 isolates were tested by reference broth microdilution methods as part of a longitudinal international antimicrobial resistance surveillance study. Characteristics of the organism collection included resistance to oxacillin among 35.0% of Staphylococcus aureus and 76.0% of coagulase-negative staphylococci (CoNS); resistance to penicillin (MIC ≥ 2 mg/L) among 18.0% of Streptococcus pneumoniae; vancomycin resistance among 20.0% of Enterococcus spp. and ampicillin resistance among 22.0% of Haemophilus influenzae.

Results: LBM415 displayed potent activity against staphylococci, streptococci, Enterococcus faecium and Moraxella catarrhalis, with ≥99.0% of strains being inhibited at ≤4 mg/L; 97.0% of Enterococcus faecalis isolates and 92.0% of H. influenzae isolates were also inhibited at this concentration. Seventy-seven percent of Burkholderia cepacia and 82.0% of Stenotrophomonas maltophilia were inhibited at ≤8 mg/L. No differences in LBM415 activity against S. aureus, CoNS, S. pneumoniae, Enterococcus spp. and H. influenzae were detected for subsets susceptible or resistant to antimicrobials such as oxacillin, penicillin, ampicillin, macrolides, vancomycin and fluoroquinolones. While regional differences were apparent with some comparator agents, sensitivity to LBM415 did not vary significantly among strains from the various geographic areas sampled. One isolate of S. aureus displayed high-level resistance to LBM415 owing to multiple sequence changes in resistance phenotype genes (defB and fmt), despite the absence of the compound in clinical practice. This isolate remained susceptible to all other antimicrobials tested except for penicillin.

Conclusions: With few differences detected among strains from various geographic regions, the first PDFI class agent to enter clinical development has consistently demonstrated a broad spectrum of activity against commonly isolated pathogens associated with uncomplicated respiratory and cutaneous infections. These compounds represent a significant therapeutic advance owing to their novel mechanism of action and antibacterial spectrum, including activity against resistant organisms, should pharmacokinetic and pharmacodynamic parameters support their continued development. Given the detection of a pre-existing PDFI-resistant isolate of S. aureus as demonstrated here, surveillance for resistance among the PDFI-targeted pathogens following introduction of this class of agent into clinical usage will be an important component of future studies.

Keywords: PDFI , resistance , respiratory tract infections , uSSTI


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
The emergence of resistance in the commonly occurring Gram-positive and Gram-negative bacterial pathogens to antimicrobial agents has become a significant medical crisis.1,2 The increased morbidity, mortality and healthcare costs in inpatient and outpatient settings have been directly attributed to this problem.3,4 The limited number of antimicrobial classes and the common occurrence of cross-resistance within and between classes reinforce the urgent need to identify new compounds with novel mechanisms of action.

Peptide deformylase (PDF), a highly conserved metalloproteinase, is required for protein maturation in bacteria.512 As a prerequisite for initiation of protein synthesis, formyltransferase (the product of the fmt gene) transfers a formyl group to the amino acid methionine.5,7,12 Bacterial protein synthesis is then initiated by the transfer of the charged initiator f-met tRNA to the A site of the ribosome. During protein maturation, the formyl group is removed, catalysed by deformylase, the product of def gene.5,7,12 This is followed by the action of methionine aminopeptidase (MAP), resulting in the removal of the amino-terminal methionine residue.68,11 If the formyl group is not removed, the MAP cannot function and this stage of post-translational protein modification is inhibited. The cellular pathways for PDF and MAP are essential, and inhibition results in cell death (slowing and eventually stopping cell growth). While a PDF homologue is present in eukaryotic cells, specifically within mitochondria, recent data suggest that the eubacterial and human mitochondrial PDF proteins have several distinguishing structural features which should permit specificity among inhibitors.13

The natural PDF inhibitor (PDFI), actinonin, has been studied since 1962 for its ability to affect protein expression in a variety of Gram-positive and Gram-negative organisms, and only in recent years has the actual mechanism of action been more fully elucidated.10,14,15 Upon exposure of bacteria to the agent, protein maturation is inhibited by the inability of PDF to deformylate the N-terminal methionine residue, ultimately resulting in bacteriostasis. Following the identification of the natural product actinonin, several novel synthetic PDFI candidates have recently been described. The PDFI NVP-PDF386 was tested against over 1000 clinical strains for potency and spectrum of activity.16 Results show that NVP-PDF386 demonstrated excellent potency against Staphylococcus aureus (MIC90 1 mg/L). It was 2-fold less active against Enterococcus spp. (MIC90, 2 mg/L) but 2-fold more active for Streptococcus pneumoniae (MIC90 0.5 mg/L). The NVP-PDF386 inhibited 75.0% of Haemophilus influenzae at 8 mg/L, as well as 92.0% of Gram-positive species tested. Inhibition of all Moraxella catarrhalis isolates occurred at 0.5 mg/L. Overall, NVP-PDF386 showed potent activity against staphylococci, streptococci, enterococci, M. catarrhalis and selected anaerobes with MIC values of ≤4 mg/L,16 demonstrating the potential for this class in a variety of clinical indications.

LBM415 (previously known as NVP PDF-713) is one of the first of the PDFI class to advance to early phase clinical trials for the oral and parenteral treatment of respiratory tract and skin and soft tissue infections caused by susceptible Gram-positive and Gram-negative organisms.1721 Recent studies have described LBM415 quality control guidelines for both disc and broth microdilution methods for use in clinical trial testing; validations of commercially prepared in vitro testing products have also been described.18,20 While a number of evaluations of the spectrum of LBM415 activity, including analysis of resistant subsets of pathogens, have demonstrated a potential role for this agent in the treatment of community-acquired bacterial infections,17,19,2123 no international surveillance programmes have previously reported on LBM415 spectrum of activity and potency.

In this report, we summarize the results of testing LBM415 and selected comparator agents for antimicrobial activity against a worldwide collection of contemporary clinical isolates collected during 2003–2004. This collection of 21 636 strains included predominantly staphylococci, streptococci, enterococci, and other Gram-positive species, H. influenzae, M. catarrhalis, Burkholderia cepacia and Stenotrophomonas maltophilia, isolated from clinically significant infections. This collection was tested for sensitivity to antimicrobials by a standardized method (broth microdilution) with categorical interpretations for comparator agents using current Clinical and Laboratory Standards Institute [CLSI, formerly National Committee for Clinical Laboratory Standards (NCCLS)] criteria.24,25


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Bacterial strains

The organism collection (21 636 strains) included 11 561 staphylococci (5026 oxacillin resistant); 2159 S. pneumoniae (1411 penicillin susceptible, 364 penicillin intermediate, 384 penicillin resistant); 777 ß-haemolytic streptococci; 256 viridans group streptococci; 2595 vancomycin-susceptible enterococci; 649 vancomycin-resistant enterococci; 2845 H. influenzae (616 ampicillin resistant); 135 M. catarrhalis; 43 B. cepacia; 341 S. maltophilia and 105 other Gram-positive species isolates (see Table 1). All isolates were non-duplicate, consecutive clinical isolates submitted from medical centres located in Europe (40.9% of strains, 29 centres), North America (44.8% of strains, 32 centres) and Latin America (14.3% of strains, 11 centres) that had contributed to international surveillance programmes for the years 2003 and 2004. Identifications were performed by the submitting laboratories and confirmed in the monitoring laboratory (JMI Laboratories, North Liberty, IA, USA) using standard biochemical algorithms, including use of the Vitek System (bioMerieux, Hazelwood, MO, USA).


View this table:
[in this window]
[in a new window]
 
Table 1.. LBM415 spectrum and potency profile when tested by CLSI reference methods against all surveillance isolates (2003–2004)

 
Antimicrobial agents and susceptibility testing

LBM415, as laboratory-grade powder, was obtained from Novartis Pharmaceuticals (Summit, NJ, USA). All strains were tested for antimicrobial susceptibility by the broth microdilution method in cation-adjusted Mueller–Hinton broth.24,25 All streptococci were tested using Mueller–Hinton broth supplemented with 2.0–5.0% lysed horse blood, and Haemophilus Test Medium (HTM) was used for testing of H. influenzae. Dry-form, validated microdilution panels and broth reagents were manufactured by TREK Diagnostics (Cleveland, OH, USA). Comparator agents included those representing the most common classes and examples of drugs used for the empirical or directed treatment of the indicated pathogen. Interpretation of quantitative MIC results was in accordance with current CLSI25 criteria.

Molecular studies

defB and fmt genes were amplified directly from S. aureus colonies [strain 02-6390D and NB01004 (PDFI-sensitive control strain)] grown on tryptic-soy agar containing 5.0% sheep blood. The following PCR parameters and conditions [per reaction (total 19 µL)] were used: water, 12.4 µL; PCR buffer, 4 µL of 5x stock; forward primer, 1 µL of 100 µM stock; reverse primer, 1 µL of 100 µM stock; dNTP, 0.4 µL of 10 mM stock; and Phusion DNA polymerase, 0.2 µL of 2 U/µL stock (Finnzymes cat #F-530PS, lot #3). The primers used for amplification reactions included those for defB (BW15, 5'GTTGTACAAGAAAAAGCTTAGGAC3', and BW12, 5'CTACAAAGTTAACCAACTACTGCC3') and fmt, (BW23, 5'GCATATTATAGATCAAATGAACGGT3', and BW19, 5'ATGAAGGTGCGTATAGTAACTTG3'). The following cycling conditions were used for amplification of defB: 1 cycle for 10 min at 95°C; 30 cycles, each consisting of 30 s at 95°C, 30 s at 53°C and 45 s at 72°C; with a final elongation step of 1 cycle for 10 min at 72°C. For amplification of fmt, cycling conditions included 1 cycle for 10 min at 95°C; 30 cycles, each consisting of 30 s at 95°C, 30 s at 61°C and 65 s at 72°C; with a final elongation step of 10 min at 72°C. PCR products were evaluated on 1.2% agarose gels and then diluted 1 : 10 for sequencing. Sequencing was performed by Agencourt, Inc. (Bedford, MA, USA).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
Overall spectrum of activity and potency of LBM415

LBM415 displayed significant antimicrobial activity against the surveillance isolates tested (Table 1). For S. aureus, growth of >99.9% of isolates was inhibited at 2 mg/L, except for the one PDFI-resistant clinical isolate described below. Growth of viridans group and ß-haemolytic streptococci, as well as M. catarrhalis, was inhibited by 2 mg/L of LBM415. Coagulase-negative staphylococci (CoNS), S. pneumoniae and Enterococcus faecium were all inhibited at 4 mg/L. Ninety-seven percent of Enterococcus faecalis and 92.0% of H. influenzae also were inhibited at 4 mg/L. Among the non-fermentative Gram-negative bacilli, growth of 77.0% of B. cepacia and 82.0% of S. maltophilia was inhibited by 8 mg/L, as were all other Gram-positive isolates. LBM415 was least potent against B. cepacia and S. maltophilia (MIC50 and MIC90 values of 8 and >32 mg/L, and 8 and 16 mg/L, respectively).

Comparative activity of LBM415 against Gram-positive cocci

All LBM415 MIC values (except for the MIC of the single high-level resistant isolate) were ≤4 mg/L for S. aureus and CoNS with MIC50 and MIC90 values of 0.5 and 1 mg/L and of 0.5 and 2 mg/L, respectively, for oxacillin-susceptible S. aureus and CoNS, and 0.5–1 mg/L for oxacillin-resistant strains of both staphylococcal groups (Table 2). Comparator agents active against oxacillin-susceptible S. aureus included erythromycin (80.0% susceptible) and linezolid, quinupristin/dalfopristin, and vancomycin (all ≥99.9% susceptible). Linezolid (MIC90, 2 mg/L; 100.0%), vancomycin (MIC90, 1 mg/L; 100.0%) and quinupristin/dalfopristin (MIC90, 1 mg/L; 99.7%) also remained highly active against oxacillin-resistant S. aureus. For the oxacillin-susceptible CoNS strains, the only drug towards which the susceptible strain percentage did not exceed 90.0% was erythromycin (MIC90, >8 mg/L; 68.4% susceptible). Among oxacillin-resistant S. aureus, 100.0% of strains tested were susceptible to linezolid, quinupristin/dalfopristin and vancomycin (Table 2).


View this table:
[in this window]
[in a new window]
 
Table 2.. Antimicrobial activity of LBM415 and selected comparators tested against a global collection of Gram-positive pathogens, including resistant subsets (2003–2004)

 
LBM415 displayed uniform activity with MIC50 values of 0.5 mg/L and MIC90 values of 1–2 mg/L against S. pneumoniae (regardless of penicillin susceptibility). Among the S. pneumoniae strains grouped by penicillin susceptibility a stepwise increase in resistance was evident for erythromycin, clindamycin and chloramphenicol (Table 2). Ceftriaxone was highly active against both penicillin-susceptible (99.9%) and penicillin-resistant S. pneumoniae (87.5%). One hundred percent of S. pneumoniae strains showed susceptibility towards quinupristin/dalfopristin, levofloxacin, rifampicin and vancomycin.

ß-Haemolytic and viridans group streptococci were all inhibited by LBM415, with MIC50 values of 0.5 and 0.12 mg/L, respectively, and MIC90 values of 0.5 and 1 mg/L. Viridans group streptococci demonstrated more variability in resistance to comparator agents, except for linezolid and vancomycin, of which 100.0% of the strains were susceptible. The only drugs for which lower susceptibility rates of ß-haemolytic streptococci were demonstrated included erythromycin and clindamycin (82.2% and 93.7%, respectively); ≥99.0% of the strains displayed susceptibility to all other comparators.

LBM415 was consistently active against vancomycin-susceptible and vancomycin-resistant E. faecalis (MIC50, 2 mg/L and MIC90, 4 mg/L) and vancomycin-susceptible and vancomycin-resistant E. faecium (MIC50, 1 mg/L and MIC90, 2 mg/L). Vancomycin-resistant E. faecalis (18 strains) exhibited high susceptibility rates to ampicillin (96.6%) and linezolid (97.5%), whereas chloramphenicol (95.7%), quinupristin/dalfopristin (95.1%) and linezolid (99.1%) showed the greatest activity among vancomycin-resistant E. faecium. LBM415 also displayed a broad range (≤0.016–8 mg/L) of activity against a collection of other Gram-positive isolates, including Aerococcus, Bacillus, Corynebacteria, Kocuria, Leuconostoc, Listeria, Micrococcus and Rothia. However, the group MIC50 and MIC90 values (0.12 and 2 mg/L, respectively) remained within achievable LBM415 concentrations.

Activity of LBM415 against fastidious Gram-negative respiratory tract pathogens

LBM415 was variably active against both H. influenzae and M. catarrhalis (Table 3). Both ampicillin-susceptible and ampicillin-resistant H. influenzae had LBM415 MIC50 and MIC90 values of 1–4 and 2–8 mg/L, respectively. These values are 8- to 16-fold higher than those measured against M. catarrhalis (0.25 and 0.5 mg/L). The majority of comparator agents were ≥99.0% susceptible against both ampicillin-susceptible and -resistant H. influenzae. Only clarithromycin failed to demonstrate a susceptibility rate greater than 90.0% for either H. influenzae group (MIC90 16 mg/L; 87.6 and 83.1%, respectively), and trimethoprim/sulfamethoxazole (MIC90 > 4 mg/L; 81.9 and 77.3%). Against M. catarrhalis, all comparator drugs were highly active (≥99.0% susceptible using breakpoint criteria for Haemophilus spp.).


View this table:
[in this window]
[in a new window]
 
Table 3.. Antimicrobial activity of LBM415 and selected comparators tested against Gram-negative pathogens associated with community-acquired respiratory tract infection (2003–2004)

 
Activity of LBM415 tested against B. cepacia and S. maltophilia

LBM415 demonstrated modest activity against B. cepacia and S. maltophilia, with MIC50 values of 8 mg/L and MIC90 of 8 and 16 mg/L, respectively (Table 4). Regional antibiogram differences were apparent with some species, but activity of LBM415 did not vary between geographic samples. B. cepacia remained susceptible to the majority of comparator drugs with ceftazidime and meropenem susceptibilities of 95.3%. Ticarcillin-clavulanic acid (79.1%) and tetracycline (95.2%) demonstrated the highest resistance rates. Comparator drugs exhibited variable susceptibility rates for S. maltophilia with minocycline (100.0%) and trimethoprim/sulfamethoxazole (97.4%) showing the highest activity, whereas meropenem (92.7% resistance), piperacillin (81.5%) and tetracycline (65.7%) were less potent.


View this table:
[in this window]
[in a new window]
 
Table 4.. Antimicrobial activity of LBM415 and selected comparators tested against selected non-fermentative Gram-negative bacilli (2003–2004)

 
Case report (PDFI-resistant strain of S. aureus)

One S. aureus strain (02-6390D) was isolated from a 34-year-old patient hospitalized in the USA in 2004 who had experienced multiple fractures during a motor vehicle accident. This strain was repeatedly isolated from multiple sites (chest, blood and abdominal wounds) during an extended hospitalization. Several classes of antimicrobials (ß-lactams, aminoglycosides and fluoroquinolones) were administered to the patient intermittently during this time. The strain was fully susceptible to 16 agents representing 10 antimicrobial classes, except for penicillin (MIC, 0.5 mg/L) and LBM415 (≥1024 mg/L). This represents the first high-level LBM415-resistant strain to be recovered from a clinical source. The strain was found to contain multiple sequence changes in genes relevant to the resistance phenotype (defB and fmt, Table 5). When compared with the PDFI-susceptible strain, the Fmt protein from the PDFI-resistant strain had an amino acid substitution (L101I) in a residue that is highly conserved in PDF proteins from many species (H. influenzae, Pseudomonas aeruginosa, Escherichia coli, S. aureus, E. faecalis, Staphylococcus epidermidis, but not S. pneumoniae or Bacillus subtilis). The substitution D195N was also found in the Fmt from the PDFI-resistant strain. In the susceptible strains, this is a functionally conserved residue (Asp or Glu) next to an absolutely conserved aspartic acid. S212N, a third Fmt amino acid substitution identified, is at a non-conserved residue that is found immediately after an absolutely conserved tryptophan. The fmt mutations resulting in these substitutions are consistent with the hypothesis that Fmt-bypass in S. aureus confers resistance to LBM415. However, the individual contributions of each substitution towards the PDFI resistance phenotype have not been examined.


View this table:
[in this window]
[in a new window]
 
Table 5.. Sequence changes identified in the defB and fmt genes of S. aureus 02-6390D

 
An amino acid change was also detected in PDF (N171D), in the C-terminal tail of the protein (Table 5). This residue is not conserved among the PDFs across bacterial species. However, it is downstream from the metal binding region of the enzyme. No data have been previously published in describing the selection of mutants of S. aureus with alterations in the defB gene; therefore the individual contribution of this substitution to the PDFI resistance phenotype remains unknown.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
There is a critical need for the development of new antimicrobial compounds that inhibit novel bacterial targets owing to the rapid emergence of antimicrobial resistance.1,2 Given these criteria, the inhibition of peptide deformylation has recently been investigated in the search for new antimicrobials.14 N-formylmethionine is required for the initiation of prokaryotic polypeptide synthesis.79 Following chain elongation, the PDF enzyme uses iron as a catalytic metal for amide bond hydrolysis to cleave the N-formylmethionine group.6,7,9,12 This exposes the N-terminal methionine to hydrolysis by MAP. When deformylation with PDF is interrupted, the MAP enzyme cannot perform its intended function. This alteration in post-translational protein modification inhibits cell growth, although the ultimate cause of cell death is unknown.

Similar to the activities of NVP-PDF386, this study and others have demonstrated the potential for LBM415 as an antimicrobial agent, particularly against pathogens important in community-acquired respiratory tract infections (CARTI) and uncomplicated skin and skin structure infections.16,17,19 The level of activity reported here against a large international collection of isolates supports this with inhibition of ≥99.0% of all staphylococci, streptococci, E. faecium and M. catarrhalis at MIC ≤ 4 mg/L, as well as inhibition of 97.0% of E. faecalis and 92.0% of H. influenzae strains. This PDFI compound displays antimicrobial activity against a broad spectrum of pathogens and enhanced potency against the commonly occurring community pathogens, making it an attractive candidate for further clinical development. Interestingly, LBM415 retains activity against strains displaying the commonly occurring resistance phenotypes including resistance to oxacillin for staphylococci, penicillin resistance of pneumococci, vancomycin resistance of enterococci and ampicillin resistance of H. influenzae and M. catarrhalis, similar to published reports.17,19,2123 LBM415 is known to lack appreciable activity against the Enterobacteriaceae or P. aeruginosa.17,20

Aside from the activity against organisms associated with CARTI, LBM415 also exhibited promising activity Neisseria meningitidis.26 This recent study tested LBM415 in vitro activity against 100 N. meningitidis and 157 N. gonorrhoeae clinical isolates.26 The agent displayed acceptable activity against N. meningitidis with an MIC50 of 1 mg/L and MIC90 of 2 mg/L; all isolates were inhibited by 4 mg/L. Unfortunately, potency levels were lower for N. gonorrhoeae by 4-fold (MIC50, 4 mg/L and MIC90, 8 mg/L). One gonococcal strain exhibited high-level PDFI resistance with an MIC of >16 mg/L.26

The maturation of certain proteins following translation is essential for bacterial survival. Key components of the protein maturation process include PDF (encoded by defB) and formyltransferase (encoded by fmt).8,14,17 LBM415 specifically inhibits PDF activity. Spontaneous resistance to PDFIs has been documented in vitro and is associated with the selection of mutants with alterations in one of these genes. Margolis et al.27,28 demonstrated that defB mutations in S. pneumoniae result in amino acid substitutions close to conserved domains involved in the binding of the substrate which are critical to PDF activity. Further study also showed that PDFI-resistant mutants of E. coli and S. aureus lack formyltransferase activity, which bypasses the need for deformylase activity.27,28 When E. coli or S. aureus mutants with fmt alterations are selected, the mutations often impose a fitness cost on the cell and published accounts of in vivo infection models demonstrate that these mutants are less virulent than the PDFI-sensitive parental strains.27

The single LBM415-resistant S. aureus isolate recovered from a clinical specimen was the first observation of a clinical strain that is fully resistant to PDFIs. Sequence analysis revealed multiple missense mutations in fmt. In a laboratory setting, single-step loss of function mutations in fmt are typically selected in S. aureus exposed to PDFIs. The PDFI-resistant clinical S. aureus strain also harboured a single nucleotide change in defB, resulting in a single amino acid substitution in PDF. There are no previously reported data describing the selection for mutations in S. aureus defB upon exposure to a PDFI in the laboratory setting. The contribution of the defB mutation to the resistance profile of this strain remains unknown.

PDFIs are a novel class of bacteriostatic agents being developed for the treatment of infections in the community setting.5,7,17,20 LBM415 demonstrates antimicrobial activity against the common Gram-positive pathogens, including resistant subsets, with no apparent differences in potency against strains from diverse geographical regions. The majority of Gram-negative fastidious species (H. influenzae, M. catarrhalis) were also inhibited by LBM415 although other Gram-negative species (Enterobacteriaceae and P. aeruginosa) are not within the antimicrobial spectrum of this agent. As a class of antimicrobials, the PDFI compounds exhibit a spectrum of activity and unique mode of action that promises to be a significant advance in chemotherapy targeting infections of the respiratory tract and skin and soft tissues. The examination of additional candidate compounds to optimize antimicrobial spectrum and potency remains warranted.


    Transparency declarations
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
T. R. F. and R. N. J. are the recipients of an educational/research grant from Novartis Institute for Biomedical Research.


    Acknowledgements
 
We express our appreciation to the following individuals for assistance with technical support, manuscript preparation and editorial processing: G. Moet, J. Ross, M. Stilwell, S. Esterow, J. Dzink-Fox and P. Strabala.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Transparency declarations
 References
 
1. Jones RN. Resistance patterns among nosocomial pathogens: trends over the past few years. Chest 2001; 119: 397S–404S.[CrossRef][Web of Science][Medline]

2. Weinstein RA. Nosocomial infection update. Emerg Infect Dis 1998; 4: 416–20.[Web of Science][Medline]

3. Cosgrove SE, Carmeli Y. The impact of antimicrobial resistance on health and economic outcomes. Clin Infect Dis 2003; 1433–7.

4. Nichols RL. Optimal treatment of complicated skin and skin structure infections. J Antimicrob Chemother 1999; 44: 19–23.[Abstract/Free Full Text]

5. Apfel CM, Locher H, Evers S et al. Peptide deformylase as an antibacterial drug target: target validation and resistance development. J Antimicrob Chemother 2001; 45: 1058–64.

6. Huntington KM, Yi T, Wei Y et al. Synthesis and antibacterial activity of peptide deformylase inhibitors. Biochemistry 2000; 39: 4543–51.[CrossRef][Medline]

7. Giglione C, Pierre M, Meinnel T. Peptide deformylase as a target for new generation, broad spectrum antimicrobial agents. Mol Microbiol 2000; 36: 1197–205.[CrossRef][Web of Science][Medline]

8. Apfel CM, Evers S, Hubschwerlen C et al. Peptide deformylase as an antibacterial drug target: assays for detection of its inhibition in Escherichia coli cell homogenates and intact cells. Antimicrob Agents Chemother 2001; 45: 1053–7.[Abstract/Free Full Text]

9. Becker A, Schlichting I, Kabsch W et al. Structure of peptide deformylase and identification of the substrate binding site. J Biol Chem 1998; 273: 11413–6.[Abstract/Free Full Text]

10. Chen D, Hackbarth C, Ni ZJ et al. Peptide deformylase inhibitors as antibacterial agents: identification of VRC3375, a proline-3-alkylsuccinyl hydroxamate derivative, by using an integrated combinatorial and medicinal chemistry approach. Antimicrob Agents Chemother 2004; 48: 250–61.[Abstract/Free Full Text]

11. Smith KJ, Petit CM, Aubart K et al. Structural variation and inhibitor binding in polypeptide deformylase from four different bacterial species. Protein Sci 2003; 12: 349–60.[CrossRef][Medline]

12. Hao B, Gong W, Ravi Rajagopalan PT et al. Structural basis for the design of antibiotics targeting peptide deformylase. Biochemistry 1999; 38: 4712–9.[CrossRef][Medline]

13. Fieulaine S, Juillan-Binard C, Serero A et al. The crystal structure of mitochondrial (type 1A) peptide deformylase provides clear guidelines for the design of inhibitors specific for the bacterial forms. J Biol Chem 2005; 280: 4231–24.

14. Hackbarth CJ, Chen DZ, Lewis JG et al. N-alkyl urea hydroxamic acids as a new class of peptide deformylase inhibitors with antibacterial activity. J Antimicrob Chemother 2002; 46: 2752–64.

15. Chen DZ, Patel DV, Hackbarth CJ et al. Actinonin, a naturally occurring antibacterial agent, is a potent deformylase inhibitor. Biochemistry 2000; 39: 1256–62.[CrossRef][Medline]

16. Jones RN, Rhomberg PR. Comparative spectrum and activity of NVP PDF386 (VRC4887), a new peptide deformylase inhibitor. J Antimicrob Chemother 2003; 51: 157–61.[Abstract/Free Full Text]

17. Fritsche TR, Sader HS, Cleeland R et al. Comparative antimicrobial characterization of LBM415 (NVP PDF-713), a new peptide deformylase inhibitor of clinical importance. Antimicrob Agents Chemother 2005; 49: 1468–76.[Abstract/Free Full Text]

18. Anderegg TR, Jones RN, The Quality Control Working Group. Disk diffusion quality control guidelines for NVP PDF-713: a novel peptide deformylase inhibitor. Diagn Microbiol Infect Dis 2004; 48: 55–7.[CrossRef][Medline]

19. Jones RN, Fritsche TR, Sader HS. Antimicrobial spectrum and activity of NVP PDF-713, a novel peptide deformylase inhibitor, tested against 1837 recent Gram-positive clinical isolates. Diagn Microbiol Infect Dis 2004; 49: 63–5.[CrossRef][Medline]

20. Fritsche TR, Moet GJ, Jones RN. Commercial broth microdilution panel validation and reproducibility trials for NVP PDF-713 (LBM415), a novel inhibitor of bacterial peptide deformylase. Clin Microbiol Infect 2004; 10: 843–60.[CrossRef][Web of Science][Medline]

21. Jones RN, Moet GJ, Sader HS et al. Potential utility of a peptide deformylase inhibitor (NVP PDF-713) against oxazolidinone-resistant or streptogramin-resistant Gram-positive organism isolates. J Antimicrob Chemother 2004; 53: 804–7.[Abstract/Free Full Text]

22. Credito K, Lin G, Ednie LM et al. Antistaphylococcal activity of LBM415, a new peptide deformylase inhibitor, compared with those of other agents. Antimicrob Agents Chemother 2004; 48: 4033–6.[Abstract/Free Full Text]

23. Ednie LM, Pankuch G, Appelbaum PC. Antipneumococcal activity of LBM415, a new peptide deformylase inhibitor, compared with those of other agents. Antimicrob Agents Chemother 2004; 48: 4027–32.[Abstract/Free Full Text]

24. National Committee for Clinical Laboratory Standards. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically. Document M7-A6. NCCLS, Wayne, PA, USA, 2003.

25. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing. Document M100-S15. CLSI, Wayne, PA, USA, 2005.

26. Jones RN, Sader HS, Fritsche TR. Antimicrobial activity of LBM415 (NVP PDF-713) tested against pathogenic Neisseria spp. (Neisseria gonorrhoeae and Neisseria meningitidis). Diagn Microbiol Infect Dis 2005; 51: 139–41.[Medline]

27. Margolis PS, Hackbarth CJ, Young DC et al. Peptide deformylase in Staphylococcus aureus: resistance to inhibition is mediated by mutations in the formyltransferase gene. Antimicrob Agents Chemother 2000; 44: 1825–31.[Abstract/Free Full Text]

28. Margolis PS, Hackbarth CJ, Lopez S et al. Resistance of Streptococcus pneumoniae to deformylase inhibitors is due to mutations in defB. Antimicrob Agents Chemother 2001; 45: 2432–5.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Antimicrob ChemotherHome page
D. C. Draghi, B. M. Benton, K. M. Krause, C. Thornsberry, C. Pillar, and D. F. Sahm
In vitro activity of telavancin against recent Gram-positive clinical isolates: results of the 2004-05 Prospective European Surveillance Initiative
J. Antimicrob. Chemother., July 1, 2008; 62(1): 116 - 121.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
D. C. Draghi, B. M. Benton, K. M. Krause, C. Thornsberry, C. Pillar, and D. F. Sahm
Comparative Surveillance Study of Telavancin Activity against Recently Collected Gram-Positive Clinical Isolates from across the United States
Antimicrob. Agents Chemother., July 1, 2008; 52(7): 2383 - 2388.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
C. R. Dean, S. Narayan, J. Richards, D. M. Daigle, S. Esterow, J. A. Leeds, H. Kamp, X. Puyang, B. Wiedmann, D. Mueller, et al.
Reduced Susceptibility of Haemophilus influenzae to the Peptide Deformylase Inhibitor LBM415 Can Result from Target Protein Overexpression Due to Amplified Chromosomal def Gene Copy Number
Antimicrob. Agents Chemother., March 1, 2007; 51(3): 1004 - 1010.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
K. Kosowska-Shick, K. L. Credito, G. A. Pankuch, B. DeWasse, P. McGhee, and P. C. Appelbaum
Multistep Resistance Selection and Postantibiotic-Effect Studies of the Antipneumococcal Activity of LBM415 Compared to Other Agents
Antimicrob. Agents Chemother., February 1, 2007; 51(2): 770 - 773.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
57/5/914    most recent
dkl093v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Watters, A. A.
Right arrow Articles by Fritsche, T. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watters, A. A.
Right arrow Articles by Fritsche, T. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?