Skip Navigation


JAC Advance Access originally published online on January 23, 2006
Journal of Antimicrobial Chemotherapy 2006 57(3):437-442; doi:10.1093/jac/dki487
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
57/3/437    most recent
dki487v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Davies, T. A.
Right arrow Articles by Evangelista, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davies, T. A.
Right arrow Articles by Evangelista, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Infrequent occurrence of single mutations in topoisomerase IV and DNA gyrase genes among US levofloxacin-susceptible clinical isolates of Streptococcus pneumoniae from nine institutions (1999–2003)

Todd A. Davies1,*, Y. Cheung Yee2, Raul Goldschmidt1, Karen Bush1, Daniel F. Sahm3 and Alan Evangelista2

1 Johnson & Johnson Pharmaceutical Research & Development L.L.C., 1000 Route 202, Raritan, NJ, USA; 2 Ortho-McNeil, Inc., 1000 Route 202, Raritan, NJ, USA; 3 Focus Bio-Inova, Inc., 13665 Dulles Technology Drive, Suite 200, Herndon, VA, USA


* Correspondence address. Tel: +1-908-707-3465; Fax: +1-908-707-3501; Email: tdavies{at}prdus.jnj.com

Received 30 September 2005; returned 7 November 2005; revised 9 December 2005; accepted 15 December 2005


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Transparency declarations
 References
 
Objectives: Prevalence of single quinolone-resistance determining region (QRDR) mutations in Streptococcus pneumoniae was studied from nine institutions over 5 years to track the incidence of single QRDR mutations.

Methods: All 1106 levofloxacin-susceptible pneumococci (MICs ≤2.0 mg/L) identified from 1112 total isolates (99.5% susceptibility) in TRUST 3 (1999), TRUST 5 (2001) and TRUST 7 (2003) surveillance studies from the same nine hospitals in nine states were screened for QRDR mutations. Using pyrosequencing, the strains were screened for mutations corresponding to hot spots Asp-78, Ser-79 and Asp-83 in ParC; Asp-80, Ser-81 and Glu-85 in GyrA; Asp-435 in ParE and Asp-435 in GyrB. DNA sequencing of QRDRs was performed to confirm mutations.

Results: No QRDR mutations were found in any of the isolates with levofloxacin MICs ≤0.5 mg/L and no gyrA or gyrB QRDR mutations were found in any of the screened isolates (MICs ≤2 mg/L). Four single-step QRDR mutants with the following amino acid substitutions were found: ParE Asp-435 to Asn (isolated in 1999 in Colorado); ParC Asp-83 to Asn (isolated in 2001 in Kentucky); ParC Ser-79 to Phe (isolated in 2003 in Indiana) and ParC Ser-79 to Tyr (isolated in 2003 in California). These non-clonal strains had levofloxacin MICs of 1 mg/L and were non-susceptible to ciprofloxacin (MIC 2–4 mg/L).

Conclusions: Overall prevalence of single QRDR mutations in levofloxacin-susceptible S. pneumoniae with MICs of ≤2 mg/L was 0.4% (4/1106) and has remained <1% within nine institutions over 5 years (1999–2003).

Keywords: fluoroquinolones , QRDRs , parC


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Transparency declarations
 References
 
Streptococcus pneumoniae is a leading bacterial cause of community-acquired pneumonia, acute sinusitis, otitis media and meningitis.1,2 According to the CDC in 2000, pneumococcal infections caused 100 000–135 000 hospitalizations for pneumonia, 6 million cases of otitis media, and 60 000 cases of invasive disease, 3300 of which were meningitis.3 Compounding this problem is that many pneumococci are resistant to many of the commonly prescribed antibiotics used to treat these infections. The CDC estimated that in 2002 34% of the 37 000 cases of invasive pneumococcal disease were due to S. pneumoniae resistant to at least one drug while 17% were caused by pneumococci resistant to ≥3 drugs.4

TRUST 7 (Tracking Resistance in the US Today) surveillance data examining 4456 isolates of S. pneumoniae from the 2002 to 2003 respiratory season across the United States found that only 66% of isolates were susceptible to penicillin, 76% to cefuroxime, 72% azithromycin and erythromycin, and 70% to trimethoprim/sulfamethoxazole.5 Of the isolates 13% had a multidrug-resistant phenotype, with resistance to penicillin, azithromycin and trimethoprim/sulfamethoxazole being the most widespread.5 In contrast nearly 99% of isolates were susceptible to the respiratory fluoroquinolones levofloxacin, gatifloxacin and moxifloxacin.5

While US surveillance data has continually shown that resistance to the respiratory fluoroquinolones in S. pneumoniae is ≤1% with minimal or no yearly increase 59, there still is a concern that a rapid increase in resistance is on the horizon. This concern is fuelled largely by the way in which most pneumococci become resistant to these agents. Resistance occurs in a stepwise fashion with mutations being observed first in the quinolone-resistance determining region (QRDR) of either parC/E or gyrA/B (depending on the selecting fluoroquinolone) leading to decreased fluoroquinolone susceptibility.10 These isolates however are still fully susceptible to the respiratory fluoroquinolones according to CLSI susceptibility breakpoints. Strains usually become fully fluoroquinolone-resistant with the addition of a mutation in the paralogue gene.10 It is believed that the continued use of fluoroquinolones is selecting for an ever-increasing population of single-step mutants that will drive an increase in resistance. Attempts have been made by us11 and by others1217 to determine the prevalence of pneumococcal single-step mutants. These determinations are made difficult by the necessity to sequence or screen the QRDRs of hundreds of isolates at a minimum. Regular surveillance of single-step mutant prevalence not only helps to have a clearer understanding of fluoroquinolone resistance development in S. pneumoniae but also may help to monitor potential alterations leading to significant changes in the incidence of full resistance.

As such, we screened all 1106 levofloxacin-susceptible pneumococci (MICs ≤2.0 mg/L) identified in TRUST 3 (1999), TRUST 5 (2001) and TRUST 7 (2003) from the same nine hospitals in nine states for QRDR mutations. This allowed us to estimate the prevalence of single-step mutants across the US for each year as well as examine the dynamics of the same nine institutions over a 5 year period.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Transparency declarations
 References
 
Selection of institutions

A list of all institutions that participated in each of the TRUST 3 (1999), TRUST 5 (2001) and TRUST 7 (2003) studies was compiled, which included 51 institutions from 33 different states. From this list nine institutions, representing both teaching and community hospitals, were selected from nine different states [California (CA), Colorado (CO), Florida (FL), Indiana (IN), Kentucky (KY), Massachusetts (MA), Minnesota (MN), New York (NY) and Texas (TX)] so that one institution from each of the nine census regions was included.

Bacterial strains

Institutions participating in TRUST studies were requested to send their first 25 consecutive non-duplicate S. pneumoniae isolates collected during each respiratory season (November of the first year to April of the following year). A range of 18–101 isolates per site per year (1999, 2001, 2003) was received from the nine institutions in this study for a total of 1106 levofloxacin-susceptible S. pneumoniae isolates. Isolates were cultured from a variety of body sites including 61% respiratory (sputum, bronchoalveolar lavage, tracheal aspirate, sinus), 27% blood, 3% ear, 2% eye, 1% cerebrospinal fluid and 6% other or unknown. All isolates were screened for the presence of single-step QRDR mutations.

Antimicrobial susceptibility testing

MICs were determined by broth-microdilution using panels manufactured by Trek Diagnostic Systems (Cleveland, OH) according to CLSI recommendations using cation-adjusted Mueller-Hinton broth (MHB) with 5% lysed defibrinated horse blood.18,19 Drugs included in the panels were levofloxacin, ciprofloxacin, penicillin, azithromycin and trimethoprim/sulfamethoxazole.

PCR and DNA sequencing analysis

Small PCR fragments encompassing a portion of the QRDRs of parC, gyrA, parE and gyrB were amplified using the primers described below. All reverse PCR primers had a 5' biotin label (Bio). For parC a 115 bp fragment was amplified with primers parCfor (position 190–208) 5'-AGTCAGTGGGAACATCAT-3' and parCrev (position 285–306) 5'-Bio-GCGTGCATTTCAACTAGAATCTC-3'. For gyrA a 95 bp fragment was amplified using PCR primers gyrAfor (position 203–223) 5'-AGGGGATGTCATGGGTAAATA-3' and gyrArev (position 278–297) 5'-Bio-GCATGTAACGGTAGCTCCAC-3'. For parE a 100 bp fragment was amplified using primers parEfor (position 1246–1266) 5'-GTACCCCAGCCCAATCTAAGAA-3' and parErev (position 1330–1346) 5'-Bio-GGAACTTGCGGTCACGA-3'. For gyrB a 115 bp fragment was amplified using gyrBfor (position 1237–1255) 5'-GTCCAGGGAAACTAGCAGACT-3' and gyrBrev (position 1338–1356) 5'-Bio-GATAGCCTGAAACTCACGG-3'. PCR was carried out in 50 µL reaction volumes using 1 µL of a 10 µM stock of each PCR primer. PCR cycling conditions were 1 cycle of 94°C for 5 min followed by 45 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s with a final extension of 1 cycle of 72°C for 5 min. Isolation of the biotin-tagged reverse strand, which served as the template for sequencing, was performed according to the manufacturer's instructions (Biotage AB, Uppsala, Sweden). Pyrosequencing20 was performed using the PSQ96MA instrument (Biotage AB) and the SQA software (Biotage AB) in accordance with the manufacturer's directions. Sequencing primers were chosen to correspond to the region immediately upstream (within 10 bp) of the region of interest. Dispensation order of the nucleotides mostly mimicked the wild-type sequence with some variation to allow for maximum read length. Sequencing (seq) primers and dispensation (dis) order were as follows: parC, (seq) 5'-ATTTCCACCCACACGG-3' (position 214–229) and (dis) GATCAGTCTCTATCTATGATGCGC; gyrA, (seq) 5'-GGTAAATACCACCCACACGG-3' (position 216–235) and (dis) GATACGTCTATATGATGCATGTC; parE, (seq) 5'-GAACTCTATCTAGTTGAGGG-3' (position 1266–1280) and (dis) GACGTCTAGCGTCA; and gyrB, (seq) 5'-AAACAGAACTCTTCATCGTC-3' (position 1277–1296) and (dis) GACTGAGACTCAGCTG. Using these methods ~30–40 bp of the PCR fragment DNA sequences were determined. This allowed isolates to be screened for all QRDR mutations known to contribute to decreased fluoroquinolone susceptibilities. In particular, we examined the mutations leading to amino acid substitutions at the following positions: ParC: Asp-78, Ser-79 and Asp-83; GyrA: Asp-80, Ser-81 and Glu-85; ParE: Asp-435; GyrB: Asp-435. To confirm pyrosequencing results, isolates identified with a single-step mutation had the QRDR of the appropriate gene amplified by PCR using primers and cycling conditions described by Pan and Fisher10 and then were sequenced in the forward and reverse directions by GeneWiz, Inc (North Brunswick, NJ).

Serotyping

Serotyping was performed with sera from Statens Seruminstitut (Copenhagen, Denmark) using a method based on the Quellung reaction.21

Pulsed-field gel electrophoresis

PFGE was performed on all isolates containing a single-step mutation as described previously.6

Statistical analysis

All statistical analysis was performed with the Fisher Exact test using the GraphPad Prism software (http://www.graphpad.com/).


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Transparency declarations
 References
 
From the same nine institutions screened over a 5 year period [TRUST 3 (1999), TRUST 5 (2001), TRUST 7 (2003)] a total of 1112 clinical S. pneumoniae isolates were collected. Among these, six (0.5%) were levofloxacin-resistant (MICs ≥8 mg/L); the remaining 1106 isolates (99.5%) were levofloxacin-susceptible (MICs ≤2 mg/L).

Four (0.4%) of the levofloxacin-susceptible isolates were found to contain a single-step QRDR mutation (Table 1). They had mutations in parC (3 isolates) or parE (1 isolate). The parC mutations led to Ser-79 to Phe/Tyr or Asp-83 to Asn substitutions, mutations routinely found among fluoroquinolone-resistant S. pneumoniae.1113,16,22 The ParE substitution of Asp-435 to Asn is also found among fluoroquinolone-resistant isolates, although to a lesser extent then those previously mentioned.1113,16,22 No mutations associated with reduced fluoroquinolone susceptibilities were found in gyrA or gyrB of any of the levofloxacin-susceptible isolates.


View this table:
[in this window]
[in a new window]
 
Table 1.. Occurrence of single-step mutants in nine US institutions

 
In a previous study we did not observe any gyrA mutations in levofloxacin-susceptible S. pneumoniae collected in 2000 during the TRUST 4 study.11 Similarly, there were no levofloxacin-susceptible isolates with gyrA mutations observed in other studies.12,13,15,16 However, there are a few reports of an occasional fluoroquinolone-susceptible or resistant S. pneumoniae with only a gyrA QRDR mutation.13,14,16,22,23 This scarcity of single-step gyrA mutations may be because most fluoroquinolones approved for use in the US prior to 2000 (levofloxacin, ofloxacin, ciprofloxacin, trovafloxacin and grepafloxacin) had topoisomerase IV (parC/E) as their primary S. pneumoniae target.24,25 Since 2000 gyrA targeting fluoroquinolones, i.e. gatifloxacin and moxifloxacin, 2629 and dual targeting fluoroquinolones, i.e. gemifloxacin,30 have been introduced into the clinic, but the topoisomerase IV targeting fluoroquinolones (levofloxacin and ciprofloxacin) continue to be the primary fluoroquinolones used to treat bacterial infections in the US.31

In this study single-step mutants were not found among isolates having a levofloxacin MIC of ≤0.5 mg/L. This is in agreement with previous studies that have found single-step QRDR mutations associated with reduced fluoroquinolone susceptibilities only in isolates with levofloxacin MICs ≥1 mg/L.11,32

All four single-step mutants in this study were isolated from respiratory sources (sputum or tracheal aspirate). Since most of the isolates from the three TRUST studies were from respiratory sources (61%) we do not know whether this finding suggests that there is a stronger selection for single-step mutations among respiratory isolates or whether this observation merely reflects the sample distribution. Single-step mutants were isolated from patients aged 39–82 years with three of the patients >60 years of age. Chen et al. observed an increased prevalence of pneumococci in Canada with reduced susceptibility to fluoroquinolones (ciprofloxacin MICs ≥4 mg/L) in adults, especially older adults (≥65 years of age), between 1993 and 1998.33 The four mutants in this study had ciprofloxacin MIC of 2–4 mg/L and levofloxacin MIC of 1.0 mg/L. These isolates were non-susceptible to ciprofloxacin using FDA breakpoints as a reference but were susceptible to levofloxacin. Three of the four mutants were susceptible to penicillin and azithromycin while one mutant was penicillin-intermediate and azithromycin-resistant. All four mutants were susceptible to trimethoprim/sulfamethoxazole.

There was no evidence of clonal spread of the single-step mutants as none of the mutants had the same PFGE pattern (data not shown) and none was isolated from the same institution. Two of the mutants were serotype 23F, one serotype 1 and one non-typeable. Analogous findings are reported for fluoroquinolone-resistant pneumococci in the US, which are genetically diverse with limited clonality and rarely persist in the same institution in consecutive years.6,16,34,35

The prevalence of single-step QRDR mutants in levofloxacin-susceptible S. pneumoniae from the nine sampled institutions was 0.2% (1/580), 0.3% (1/304) and 0.9% (2/222) for TRUST 3 (1999), TRUST 5 (2001) and TRUST 7 (2003), respectively (Table 1). Given the low incidence of single-step mutants and the number of clinical isolates analysed per year at the nine institutions monitored, the observed increases in prevalence of single-step mutants from 0.3% in 2001 to 0.9% in 2003, or from 0.2% in 1999 to 0.9% in 2003, were not statistically significant (P = 0.384 and P = 0.187, respectively). In order to generate data strong enough to convincingly demonstrate that the null hypothesis is wrong (i.e. that the yearly prevalences observed for single-step mutants are different), ~1900 isolates would need to been screened per year. The incidence of single-step mutants from this study was lower than that we previously reported for the TRUST 4 study conducted in 2000, in which the prevalence was estimated as 4.5%.11 A possible explanation for this discrepancy could be that different selection criteria were used to choose the isolates for screening, e.g. penicillin susceptibilities for the first study conducted in 2000 (TRUST 4) compared with geographic distribution for this study.11

Both studies attempted to have broad geographical representation by sampling isolates from all nine census regions. The previous study (TRUST 4) sampled isolates from many institutions from each census region while the current study sampled isolates from the same institution in each census region. As a result, in both studies the levofloxacin MIC distribution among the sampled isolates reflected the MIC distribution of all the TRUST isolates for the corresponding year as shown in Figure 1(a) for the current study.


Figure 1
View larger version (27K):
[in this window]
[in a new window]
 
Figure 1.. (a) Comparison of levofloxacin MIC distribution of isolates from the nine institutions (sampled) with all isolates from over 200 institutions that were collected for each TRUST study (all). (b) Comparison of penicillin susceptibility distribution of isolates from the nine institutions (sampled) with all isolates from over 200 institutions that were collected for each TRUST study (all).

 
The major difference between the two studies concerned the penicillin susceptibilities of the analysed isolates. For the TRUST 4 study, the sampled isolates with levofloxacin MIC <2 mg/L were evenly distributed among penicillin-susceptible, penicillin-intermediate and penicillin-resistant strains.11 At that time this seemed a reasonable a priori approach since there was little basis to suspect an association between penicillin and fluoroquinolone susceptibilities. However, recently an association between penicillin and fluoroquinolone non-susceptibilities has been demonstrated.16,36 Thus, the approach taken for the TRUST 4 study overestimated the incidence of single-step mutants by skewing the analysis of the results in favour of penicillin-non-susceptible isolates (~67%), whereas the TRUST 4 study overall had a 34% incidence of penicillin-non-susceptibility (18% penicillin-intermediate, 16.0% penicillin-resistant).36 As shown in Figure 1(b) the penicillin susceptibility distribution of the sampled isolates from the current study closely matched the distribution for each entire TRUST study, thus avoiding any bias predicated on penicillin susceptibility. The last notable difference between the two studies involves the methodology of detection of the single-step mutations. The previous study used dot-blot hybridization in which specific QRDR probes were hybridized to genomic DNA.37 In the current study we used a more sensitive and rapid method combining PCR with pyrosequencing.20

We feel that our study gives a more accurate representation of the prevalence of single-step QRDR mutations in levofloxacin-susceptible S. pneumoniae in the US. This assertion seems to be warranted, especially in light of data from two recent North American studies, one from Canada17 and one from the US,14 that reported a low prevalence of single-step QRDR mutations. The Canadian study showed that the incidence of single parC QRDR mutations (which are known to contribute to reduced fluoroquinolone susceptibility) among S. pneumoniae isolates with a levofloxacin MIC of 1 mg/L was 1.4 and 1.3% in 1997 and 2003, respectively.17 In the US study, the prevalence of parC single-step mutants was estimated as 21% by screening for QRDR mutations in 301 pneumococcal isolates out of 1771 isolates (ciprofloxacin MICs 0.5–8 mg/L) collected during the winter of 2002–2003.14 However, this estimation included parC mutations leading to amino acid substitutions not known to be associated with reduced fluoroquinolone susceptibilities such as Ser-52 to Gly, Asn-91 to Asp, Gly-128 to Asp, Lys-137 to Asn and Asp-147 to Ile.25,28,38,39 If only parC mutations leading to substitutions known to contribute to fluoroquinolone resistance are included, e.g. Asp-78 to Ala; Ser-79 to Phe/Tyr; Asp-83 to Gly, then the estimated single-step prevalence drops to 0.8%, in line with our observations.

It should be noted that there is a high prevalence of QRDR mutations among isolates with a levofloxacin MIC of 2 mg/L, ~50–70% in our experience.11 Despite this high incidence, the impact of these isolates on the overall prevalence of single QRDR mutations among all levofloxacin-susceptible isolates is minimal. This is due to the scarcity of isolates with a levofloxacin MIC of 2 mg/L. In the TRUST 3–7 studies their incidence ranged from 0.2 to 0.7%.5,36 In this study, of the 1106 susceptible isolates screened only one isolate had a levofloxacin MIC of 2 mg/L and no QRDR mutation.

In summary, S. pneumoniae single-step QRDR mutations were only found in parC and parE. No QRDR mutations were found in gyrA or gyrB or in isolates with levofloxacin MICs ≤0.5 mg/L. Overall, the prevalence of single-step QRDR mutants in levofloxacin-susceptible S. pneumoniae remained <1% over the 5 year study period. Among the institutions sampled there was no evidence of clonal spread of single-step QRDR mutants. Continued monitoring through surveillance of not only fluoroquinolone-resistant S. pneumoniae isolates but also fluoroquinolone-susceptible single-step mutants is warranted for this important class of agents.


    Transparency declarations
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Transparency declarations
 References
 
T. A. D., R. G. and K. B. are employees of Johnson & Johnson Pharmaceutical Research & Development, L.L.C.; Y. C. Y. and A. E. are employees of Ortho-McNeil, Inc.; D. F. S. has received research grants from Ortho-McNeil, Inc.


    Acknowledgements
 
We thank Brian Morrow for his helpful discussions. Financial support for this work was provided by Johnson & Johnson Pharmaceutical Research and Development, L.L.C. and Ortho-McNeil, Inc.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 Transparency declarations
 References
 
1. Bartlett JG, Dowell SF, Mandell LA et al. Practice guidelines for the management of community-acquired pneumonia in adults. Clin Infect Dis 2000; 31: 347–82.[CrossRef][Medline]

2. Niederman MS, Mandell LA, Anzueto A et al. Guidelines for the management of adults with community-acquired pneumonia. Diagnosis, assessment of severity, antimicrobial therapy, and prevention. Am J Respir Crit Care Med 2001; 163: 1730–54.[Free Full Text]

3. Centers for Disease Control and Prevention. Streptococcus pneumoniae Disease. http://www.cdc.gov/ncidod/dbmd/diseaseinfo/streppneum_t.htm (26 September 2005, date last accessed).

4. Centers for Disease Control and Prevention. Drug-resistant Streptococcus pneumoniae Disease. http://www.cdc.gov/ncidod/dbmd/diseaseinfo/drugresisstreppneum_t.htm (26 September 2005, date last accessed).

5. Sahm DF. Resistance issues and community-acquired respiratory infections. Clin Cornerstone 2003; 5, Suppl 3: S4–11.

6. Davies TA, Goldschmidt R, Pfleger S et al. Cross-resistance, relatedness and allele analysis of fluoroquinolone-resistant United States clinical isolates of Streptococcus pneumoniae (1998-2000). J Antimicrob Chemother 2003; 52:168–175.[Abstract/Free Full Text]

7. Jacobs MR, Bajaksouzian S, Zilles A et al. Susceptibilities of Streptococcus pneumoniae and Haemophilus influenzae to 10 oral antimicrobial agents based on pharmacodynamic parameters: 1997 U.S. surveillance study. Antimicrob Agents Chemother 1999; 43: 1901–8.[Abstract/Free Full Text]

8. Jones RN, Pfaller MA. In vitro activity of newer fluoroquinolones for respiratory tract infections and emerging patterns of antimicrobial resistance: data from the SENTRY antimicrobial surveillance program. Clin Infect Dis 2000; 31 Suppl 2: S16–23.

9. Whitney CG, Farley MM, Hadler J et al. Increasing prevalence of multidrug-resistant Streptococcus pneumoniae in the United States. New Engl J Med 2000; 343: 1917–24.[Abstract/Free Full Text]

10. Pan XS, Ambler J, Mehtar S et al. Involvement of topoisomerase IV and DNA gyrase as ciprofloxacin targets in Streptococcus pneumoniae. Antimicrob Agents Chemother 1996; 40: 2321–6.[Abstract]

11. Davies TA, Evangelista A, Pfleger S et al. Prevalence of single mutations in topoisomerase type II genes among levofloxacin-susceptible clinical strains of Streptococcus pneumoniae isolated in the United States in 1992 to 1996 and 1999 to 2000. Antimicrob Agents Chemother 2002; 46: 119–24.[Abstract/Free Full Text]

12. Bast DJ, Low DE, Duncan CL et al. Fluoroquinolone resistance in clinical isolates of Streptococcus pneumoniae: contributions of type II topoisomerase mutations and efflux to levels of resistance. Antimicrob Agents Chemother 2000; 44: 3049–54.[Abstract/Free Full Text]

13. Brueggemann AB, Coffman SL, Rhomberg P et al. Fluoroquinolone resistance in Streptococcus pneumoniae in the United States since 1994–1995. Antimicrob Agents Chemother 2002; 46: 680–8.[Abstract/Free Full Text]

14. Doern GV, Richter SS, Miller A et al. Antimicrobial resistance among Streptococcus pneumoniae in the United States: have we begun to turn the corner on resistance to certain antimicrobial classes? Clin Infect Dis 2005; 41: 139–48.[CrossRef][ISI][Medline]

15. Lim S, Bast D, McGeer A et al. Antimicrobial susceptibility breakpoints and first-step parC mutations in Streptococcus pneumoniae: redefining fluoroquinolone resistance. Emerg Infect Dis 2003; 9: 833–7.[ISI][Medline]

16. Richter SS, Heilmann KP, Beekmann SE et al. The molecular epidemiology of Streptococcus pneumoniae with quinolone resistance mutations. Clin Infect Dis 2005; 40: 225–35.[CrossRef][ISI][Medline]

17. Smith HJ, Siemens CG, Schurek K et al. Is the prevalence of silent quinolone-resistance determining region (QRDR) mutations in Streptococcus pneumoniae isolates changing? Analysis between 1997 and 2003 in Canada. In: Abstracts of the Forty-forth Interscience Conference on Antimicrobial Agents and Chemotherapy, Washington, DC, 2004. Abstract, C2-1723, p. 122. American Society for Microbiology, Washington, DC, USA.

18. Clinical Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing- Fifteenth informational supplement: CLSI document M100-S15. CLSI, Wayne, PA, USA, 2005.

19. National Committee for Clinical Laboratory Standards. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically-Sixth Edition. Approved Standard M7-A6. NCCLS, Wayne, PA, USA, 2003.

20. Ronaghi M, Elahi E. Pyrosequencing for microbial typing. J Chromatogr B 2002; 782: 67–72.

21. Sorensen UB. Typing of pneumococci by using 12 pooled antisera. J Clin Microbiol 1993; 31: 2097–100.[Abstract/Free Full Text]

22. Jones ME, Sahm DF, Martin N et al. Prevalence of gyrA, gyrB, parC, and parE mutations in clinical isolates of Streptococcus pneumoniae with decreased susceptibilities to different fluoroquinolones and originating from worldwide surveillance studies during the 1997–1998 respiratory season. Antimicrob Agents Chemother 2000; 44: 462–6.[Abstract/Free Full Text]

23. Canton R, Morosini M, Enright MC et al. Worldwide incidence, molecular epidemiology and mutations implicated in fluoroquinolone-resistant Streptococcus pneumoniae: data from the global PROTEKT surveillance programme. J Antimicrob Chemother 2003; 52: 944–52.[Abstract/Free Full Text]

24. Fukuda H, Hiramatsu K. Primary targets of fluoroquinolones in Streptococcus pneumoniae. Antimicrob Agents Chemother 1999; 43: 410–12.[Abstract/Free Full Text]

25. Munoz R, De La Campa AG. ParC subunit of DNA topoisomerase IV of Streptococcus pneumoniae is a primary target of fluoroquinolones and cooperates with DNA gyrase A subunit forming resistance phenotype. Antimicrob Agents Chemother 1996; 40: 2252–7.[Abstract]

26. Fukuda H, Kishii R, Takei M et al. Contributions of the 8-methoxy group of gatifloxacin to resistance selectivity, target preference, and antibacterial activity against Streptococcus pneumoniae. Antimicrob Agents Chemother 2001; 45: 1649–53.[Abstract/Free Full Text]

27. Kishii R, Takei M, Fukuda H et al. Contribution of the 8-methoxy group to the activity of gatifloxacin against type II topoisomerases of Streptococcus pneumoniae. Antimicrob Agents Chemother 2003; 47: 77–81.[Abstract/Free Full Text]

28. Pestova E, Beyer R, Cianciotto NP et al. Contribution of topoisomerase IV and DNA gyrase mutations in Streptococcus pneumoniae to resistance to novel fluoroquinolones. Antimicrob Agents Chemother 1999; 43: 2000–4.[Abstract/Free Full Text]

29. Smith, HJ, Nichol KA, Hoban DJ et al. Dual activity of fluoroquinolones against Streptococcus pneumoniae: The facts behind the claims. J Antimicrob Chemother 2002; 49: 893–5.[Free Full Text]

30. Heaton VJ, Ambler JE, Fisher LM. Potent antipneumococcal activity of gemifloxacin is associated with dual targeting of gyrase and topoisomerase IV, an in vivo target preference for gyrase, and enhanced stabilization of cleavable complexes in vitro. Antimicrob Agents Chemother 2000; 44: 3112–17.[Abstract/Free Full Text]

31. Linder JA, Huang ES, Steinman MA et al. Fluoroquinolone prescribing in the United States: 1995 to 2002. Am J Med 2005; 118: 259–68.[CrossRef][ISI][Medline]

32. Smith HJ, Noreddin AM, Siemens CG et al. Designing fluoroquinolone breakpoints for Streptococcus pneumoniae by using genetics instead of pharmacokinetics-pharmacodynamics. Antimicrob Agents Chemother 2004; 48: 3630–5.[Abstract/Free Full Text]

33. Chen DK, McGeer A, De Azavedo JC et al. Decreased susceptibility of Streptococcus pneumoniae to fluoroquinolones in Canada. N Engl J Med 1999; 341: 233–9.[Abstract/Free Full Text]

34. Brown SD, Farrell DJ, Morrissey I. Prevalence and molecular analysis of macrolide and fluoroquinolone resistance among isolates of Streptococcus pneumoniae collected during the 2000-2001 PROTEKT US study. J Clin Microbiol 2004; 42: 4980–7.[Abstract/Free Full Text]

35. Johnson CN, Benjamin WH Jr, Moser SA et al. Genetic relatedness of levofloxacin-nonsusceptible Streptococcus pneumoniae isolates from North America. J Clin Microbiol 2003; 41: 2458–64.[Abstract/Free Full Text]

36. Karlowsky JA, Thornsberry C, Jones ME, et al. Factors associated with relative rates of antimicrobial resistance among Streptococcus pneumoniae in the United States: results from the TRUST Surveillance Program (1998-2002). Clin Infect Dis 2003; 36: 963–70.[CrossRef][ISI][Medline]

37. Davies TA, Goldschmidt R. Screening of large numbers of Streptococcus pneumoniae isolates for mutations associated with fluoroquinolone resistance using an oligonucleotide probe assay. FEMS Microbiol Letters 2002; 217: 219–24.[CrossRef][ISI][Medline]

38. Balsalobre L, Ferrandiz MJ, Linares J. et al. Viridans group streptococci are donors in horizontal transfer of topoisomerase IV genes to Streptococcus pneumoniae. Antimicrob Agents Chemother 2003; 47: 2072–81.[Abstract/Free Full Text]

39. Korzheva N, Davies TA, Goldschmidt R. Novel Ser79Leu and Ser81Ile substitutions in the quinolone resistance-determining regions of ParC topoisomerase IV and GyrA DNA gyrase subunits from recent fluoroquinolone-resistant Streptococcus pneumoniae clinical isolates. Antimicrob Agents Chemother 2005; 49: 2479–86.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
T. A. Davies, E. Leibovitz, G. J. Noel, D. F. McNeeley, K. Bush, and R. Dagan
Characterization and Dynamics of Middle Ear Fluid and Nasopharyngeal Isolates of Streptococcus pneumoniae from 12 Children Treated with Levofloxacin
Antimicrob. Agents Chemother., January 1, 2008; 52(1): 378 - 381.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
57/3/437    most recent
dki487v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Davies, T. A.
Right arrow Articles by Evangelista, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davies, T. A.
Right arrow Articles by Evangelista, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?