JAC Advance Access originally published online on November 9, 2005
Journal of Antimicrobial Chemotherapy 2006 57(1):61-70; doi:10.1093/jac/dki401
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular characteristics of pbp1a and pbp2b in clinical Streptococcus pneumoniae isolates in Quebec, Canada
1 Laboratoire d'Immunogénétique, Centre de Recherche du Centre Hospitalier de l'Université de Montréal (CHUM), Hôpital Notre-Dame du CHUM, 1560 rue Sherbrooke est, Montréal, Québec, Canada H2L 4M1; 2 Département de Microbiologie-Immunologie de l'Université de Montréal, Montréal, Québec, Canada; 3 Département de Microbiologie, Hôpital Saint-Luc du CHUM, Montréal, Québec, Canada; 4 Département de Microbiologie, Hôpital Maisonneuve-Rosemont, Montréal, Québec, Canada
* Corresponding author. Tel: +1-514-890-8000 ext. 25802; Fax: +1-514-412-7512; E-mail: michel.roger{at}ssss.gouv.qc.ca
Received 20 May 2005; returned 25 June 2005; revised 15 August 2005; accepted 5 October 2005
| Abstract |
|---|
|
|
|---|
Objectives: To investigate the nature of the amino acid motifs found in penicillin-binding protein (PBP) 2b and PBP1a of penicillin-resistant Streptococcus pneumoniae isolates across Quebec (Canada), and to obtain preliminary information regarding the prevalence of these alterations.
Methods: DNA sequences of pbp2b (codons 210675) and pbp1a (codons 310682) transpeptidase domains were determined and compared in 48 clinical isolates comprising 17 penicillin-susceptible (PSSP), 19 penicillin-intermediate (PISP) and 12 penicillin-resistant (PRSP) pneumococci.
Results: The degree of diversity within PBP1a and PBP2b correlated with increased resistance to ß-lactam antibiotics. There were an average of 0.6 ± 0.4 and 2.9 ± 0.2 mutations in PSSP, 16.8 ± 1.4 and 36.3 ± 5.2 in PISP, and 18.7 ± 2.5 and 51.4 ± 1.3 in PRSP isolates compared with control penicillin-susceptible R6-PBP2b and R6-PBP1a sequences, respectively. At least seven PBP2b and six PBP1a distinct amino acid profiles were identified among intermediate or resistant strains isolated in Quebec. The pattern of distribution of the PBPs' altered amino acids differs from that of other countries, with pneumococci isolates from Quebec showing a unique genetic signature.
Conclusion: This study will serve as a basis for future monitoring of genetic changes associated with the emergence and spread of ß-lactam resistance in Quebec, Canada.
Keywords: penicillin-binding proteins , ß-lactams , pneumococci , serotypes , penicillin resistance , cefotaxime resistance
| Introduction |
|---|
|
|
|---|
Drug-resistant Streptococcus pneumoniae are a worldwide phenomenon. The rates of high-level penicillin resistance (MIC
2 mg/L) among pneumococci are increasing around the world,1 with a prevalence of 79.7% in Korea,2 followed by Japan and Spain, where 65.6% of isolates are resistant.3 In Canada, data from national surveillance studies have demonstrated that the proportion of isolates with high-level penicillin resistance rose dramatically from 2.4% in 1999 to 13.8% in 2002, and the proportion of multidrug-resistant S. pneumoniae isolates also increased from 2.7% to 8.8%.4 The prevalence of penicillin-resistant pneumococci (PRSP) varies considerably by geographic location in Canada, with higher rates in Ontario and Quebec (central Canadian provinces) compared with the eastern provinces.4,5 In clinical isolates, altered penicillin-binding protein (PBP) 2b and PBP2x are the primary penicillin-resistance determinants,6,7 while alteration of PBP1a is required for high-levels of penicillin810 and cephalosporin resistance.9,11 We have recently investigated the nature of the PBP2x amino acid motifs in 52 clinical pneumococci isolated across Quebec province, and we identified at least 6 distinct amino acid profiles among penicillin-intermediate (PISP) strains, whereas all PRSP isolates shared a similar pattern of altered amino acids compared with the sequence from penicillin-susceptible pneumococci (PSSP).12 We now report the PBP1a and PBP2b amino acid profiles of these S. pneumoniae isolates.
| Materials and methods |
|---|
|
|
|---|
Bacterial strains, growth conditions and DNA isolation
Forty-eight clinical isolates of pneumococci (17 penicillin-susceptible, 19 penicillin-intermediate and 12 penicillin-resistant strains, whose penicillin MICs were
0.06, >0.06 and <2 mg/L, and
2 mg/L, respectively), were randomly chosen to represent a range of MICs and a cross-Quebec geographic distribution, for molecular characterization. Pneumococci were obtained from the bacteria bank of the Reseau EQUERE (Etude QUEbecoise des pathogenes REspiratoires) at Hôpital Maisonneuve-Rosemont (Montreal) and from Hôpital St-Luc (Montreal). The R6 strain of S. pneumoniae (MIC of penicillin
0.016 mg/L) and laboratory strain ATCC 49619 (MIC of penicillin between 0.125 and 1 mg/L) were used as the penicillin-susceptible and penicillin-intermediate reference strains, respectively. The clinical and demographic parameters of the S. pneumoniae isolates analysed in this study are listed in Table 1. The procedures employed for bacterial growth, susceptibility testing, capsular typing and DNA isolation were described in our recent paper on the PBP2x analysis of these bacterial strains.12
|
Amplification of pbp2b and pbp1a genes and nucleotide sequencing
The coding regions of the transpeptidase domain of pbp2b and pbp1a of the S. pneumoniae isolates, listed in Table 1, were amplified and sequenced from bacterial DNA according to previously outlined methods.12 Primers for amplification and sequencing of the pbp2b gene were designed from the DNA sequence of the R6 strain (GenBank accession number X13137 [GenBank] ): amplification primers, pbp2b-F, 5'-1GATCCTCTAAATGATTCTCAGGTGG25-3' and pbp2b-R, 5'-1505CAATTAGCTTAGCAATAGGTGTTGG-1481-3. The inner primers for nucleotide sequencing were: pbp2b-Seq-F, 5'-657TGT(C/T)TTCCAAGGTTCAGCTC676-3' and pbp2b-Seq-R, 5'-812AACATATT(G/T)GGTTGATAGGT793-3'. The primer pairs used for amplification and sequencing of the pbp1a gene were designed from the DNA sequence of the R6 strain (GenBank accession number M90527 [GenBank] ): amplification primers, pbp1a-F, 5'-1818ACTCACAACTGGGATGGATG1837-3' and pbp1a-R, 5'-3105TTATGGTTGTGCTGGTTGAGG3085-3'. The inner primers for nucleotide sequencing were: pbp1a-Seq-F, 5'-2329KCAAAYGCCATTTCAAGTAA2348-3' and pbp1a-Seq-R, 5'-2463GACGACYTTATKGATATACA2444-3'.
Sequence analysis
Amino acid sequences were deduced and analysed by the MegAlign program (ClustalW) included in Lasergene software (version 5, DNAstar Inc., Madison, WI, USA). Nucleotide and deduced amino acid sequences were compared with those of the respective reference R6 strain; accession numbers X16022 [GenBank] for pbp2b and M90527 [GenBank] for pbp1a. Our sequences were compared with all other sequences by the Genetics Computer Group (GCG) package. The number of amino acid mutations are presented as mean ± SEM.
Nucleotide sequence accession numbers
The pbp2b and pbp1a gene sequences determined in this study have been deposited in the GenBank database and accession numbers DQ071914DQ071959 were assigned for pbp2b, and DQ071960DQ072004 for pbp1a.
| Results |
|---|
|
|
|---|
The characteristics of the clinical pneumococci are illustrated in Table 1. One isolate, 14759, can be classified either in the PSSP or PISP category, depending on the method used for MIC determination. We classified this strain as PISP by preferentially using MICs (>0.06 mg/L) obtained by Etest (Table 1). The majority of non-susceptible pneumococci (NSSP) isolates belonged to serogroup 23 (22.6%) followed by serogroups/types 6 (19.4%), 14 (16.1%), 19 (12.9%), 9 (6.5%) and 15 (3.3%).
The diversity of amino acids in PBP2b (codons 210675) and PBP1a (codons 310682) was determined for each clinical isolate. In total, we observed 76 and 103 amino acid changes compared with the R6-PBP2b and R6-PBP1a control sequences, respectively (Figures 1 and 2). Of those, 73 (96%) PBP2b and 102 (99%) PBP1a amino acid substitutions were noted in NSSP strains. We found an average of 0.6 ± 0.4 and 2.9 ± 0.2 mutations in PSSP, 16.8 ± 1.4 and 36.3 ± 5.2 in PISP, and 18.7 ± 2.5 and 51.4 ± 1.3 in PRSP isolates compared with the control penicillin-susceptible R6-PBP2b and R6-PBP1a sequences, respectively (Table 2).
|
|
|
Mutations at positions in or close to the conserved motifs are indicated in bold (Figures 1 and 2). No mutation is reported close to the SVVK (PBP2b) and KTG (PBP1a) conserved motifs. The Thr445
Ala substitution adjacent to the second PBP2b conserved motif (SSN) was observed in all NSSP isolates and in one PSSP strain, 14900 (Table 2). The Ala618
Gly substitution close to the third PBP2b conserved motif (KTG) was identified in only three PRSP isolates, 14738, 14901 and 14907. The Thr371
Ala/Ser mutation within the first PBP1a conserved motif (STMK) and the Pro432
Thr substitution close to the second PBP1a conserved motif (SRN) were observed in all PRSP isolates and in seven (36.8%) PISP strains. Mutations adjacent to PBP1a conserved motifs were not observed among PSSP isolates. We were unable to generate the pbp2b gene in one PISP (14763) isolate, and the pbp1a gene in three PISP (2089, 2255 and 2259) isolates, presumably due to mutations at the sites of primer annealing.
Most PSSP isolates had amino acid sequences highly homologous to the R6-PBP2b and R6-PBP1a control sequences. Amino acid sequences of NSSP isolates differed from 12 (2.6%) to 38 (8.2%) residues compared with the R6-PBP2b control sequence (Table 2). Baek et al.13 recently proposed a classification for NSSP isolates based on PBP2b amino acid motifs. Two PRSP isolates, 14760 and 14767, can be assembled in Baek's group I, which is characterized by the following 13 amino acid substitutions: Glu332
Gly, Ile360
Leu, Asn421
Tyr, Thr425
Lys, Gln426
Leu, Gln437
Glu, Thr445
Ala, Leu454
Ile, Ser472
Thr,Glu475
Gly, Ser479
Ala, Thr488
Ala and Asn537
Asp (Figure 1). Underlined substitutions correspond to the block A mutations described by Baek et al.13 Group II also had block A mutations and a divergent block localized at the 3' end of the sequence, which was identical with that of Streptococcus oralis 3626 (penicillin MIC = 4 mg/L). The PBP2b sequences of three PRSP isolates, 14907, 14901 and 14738, were classified within Baek's group II and were very similar to those of the Korean J2 isolate,13 an Iceland IC221 isolate14 and a French SP22861 isolate.15 Group III contained both block A mutations and an Ala515
Ser substitution, and corresponded to class B as reported by Dowson et al.16 Baek's group IV was absent among our isolates. Three isolates, 14902, 14608 and 14896, had the characteristic Thr488
Ser and Leu608
Ala substitutions of group V from Baek's classification. We identified only one isolate (2055) that could correspond to Baek's group VI. To classify all NSSP isolates, we added two new groups. Group VII, which includes isolates 14766, 14761, 2089, 2259 and the laboratory ATCC 49619 strain, shared six specific amino acid substitutions: Leu454
Ile, Gly466
Leu, Ser468
Asn, Gly482
Ala, Thr488
Ala and Ala489
Ser. The Korean J89 isolate13 contained all six mutations specific to group VII. Isolates containing the short mosaic sequence AFSVPM between residues 426 and 431 were assembled in group VIII, also described as class A by Dowson et al.16 The AFSVPM mosaic is known to originate from the Streptococcus mitis donor strain.17
Amino acid sequences of NSSP isolates differed from 2 (0.5%) to 61 (16.4%) residues compared with the R6-PBP1a control sequence (Table 2), and we distinguished at least six distinct groups (Figure 2). The first group was characterized by 24 amino acid substitutions and included all PSSP and three PISP (14759, 14634 and 14680). Group II contained the amino acid substitutions Thr371
Ala and Pro432
Thr within penicillin-binding motifs and shared four amino acid substitutions between these two conserved motifs: Ile393
Met, His395
Asn, Glu397
Ile and Asn405
Ser. The majority of our NSSP (38.7%) were assembled in group II. Group III was characterized by the same short mosaic sequence MNIS between residues 393 and 405 without the Thr371
Ala mutation within the STMK penicillin-binding motif. Groups IV and V presented another mutated amino acid motif in the same region: Thr392
Ser, Glu397
Val, Asn405
Aspand Val408
Leu. However, the amino acid threonine at position 371 was replaced by an alanine residue in group IV, and by a serine residue in group V. The other four NSSP clinical and ATCC reference strains did not contain amino acid mutations within conserved motifs. However, three isolates (2076, 14761 and 14763) had a deletion of one amino acid (Gln663) in the N-terminal portion of the protein and were assembled in group VI. The short mosaic sequence NTGY between residues 574 and 577 was observed in all PRSP isolates and 75% of PISP strains.
Finally, we compared the pbp2b and pbpb1a nucleotide sequences of the 48 clinical isolates analysed in the present study to other published sequences in the GCG database and identified six PBP2b and four PBP1a novel amino acid sequence variants in our samples. PBP2b amino acid substitution Ser294
Arg was observed in three PISP isolates (14634, 14680 and 14759), and Gln410
Pro/Arg substitution was found in one PISP (2055) and in one PSSP (14636) strain. Each of the following new PBP2b amino acid substitutions, Ala344
Thr, Val448
Ile, Asp496
Tyr and Ala637
Gly, was observed in isolates 14895, 14736, 2076 and 2089, respectively. Three novel PBP1a amino acid substitutions, Leu327
Met, Leu452
Ile and Ser679
Ala, were detected in the same PISP isolate (14751), whereas Ser508
Arg mutation was observed in one PRSP (14760). These new mutations are not frequent and are probably the result of point mutations.
| Discussion |
|---|
|
|
|---|
The PBP2b amino acid sequence of NSSP strains can be classified according to sequence relatedness of their mosaic blocks. They were originally grouped into two classes: class A and class B.16,18 Class A strains contain a characteristic altered sequence that resulted in the substitution of six contiguous residues: AFSVPM or AFSRPM (amino acids 426431).16 Class B PBP2b sequences are more divergent and include different strains that have several identical block mutations. According to this classification, 5 (16.7%) isolates had class A mutations (Group VIII in Figure 1), and 12 (40%) isolates had class B mutations (Group III in Figure 1). The remaining 13 NSSP strains (43.3%) did not have either class A or class B mutation blocks. Recently, Baek et al.13 classified the PBP2b amino acid sequence of Korean clinical S. pneumoniae isolates into six groups. However, this classification method is not sufficient to include all NSSP strains isolated in Quebec. Accordingly, we now propose that the PBP2b amino acid sequence of NSSP isolates can be classified into eight groups. Currently, there is no such classification system for PBP1a. We identified the presence of at least six distinct PBP1a amino acid profiles among NSSP strains isolated in Quebec. These observations suggest that pbp mosaic genes can arise by multiple acquisition of divergent blocks, and NSSP isolates from different countries show unique patterns of mosaic mutation blocks due to horizontal DNA transfer from indigenous strains.19,20
Analysis of PBP2b penicillin-binding motifs revealed the absence of substitution in or close to the active site serine of the first conserved (SVVK) motif in pneumococci from Quebec. These findings are in agreement with results from other studies,13,15,2022 suggesting that the catalytic motif of PBP2b is not involved in the development of penicillin resistance.16,23 On the other hand, the Thr445
Ala substitution adjacent to the second conserved (SSN) motif was found in all NSSP strains, confirming previous investigations that demonstrated its importance in ß-lactam resistance. 6,13,15,16,18,2022,2426 The Thr445
Ala substitution in PBP2b decreases the affinity for penicillin by 60% compared with the wild-type protein.26 The Asn residue in the SSN motif has been proposed to form a hydrogen bond with the carbonyl group of the penicillin R1 side chain, and Thr445
Ala substitution presumably disrupts this hydrogen bond, leading to a reduction in the affinity of PBP2b.27 Surprisingly, although this mutation was confirmed by site-directed mutagenesis to be associated with ß-lactam resistance, it was recently reported in PSSP isolates from the United States, Korea,13,22 and now from Quebec (isolate #14900). Interestingly, this Quebec PSSP isolate also contained the Thr338
Ala substitution, adjacent to the active serine site in the first conserved motif (STMK) of PBP2x.12 It is not clear how some PSSP isolates can harbour these two mutations without becoming resistant. The amino acid substitution Ala618
Gly adjacent to the third conserved (KTG) motif was found in three PRSP isolates with penicillin MICs
2 mg/L. This mutation has also been reported in high-level penicillin-resistant strains (penicillin MICs of 28 mg/L) from other countries.11,13,18,21,26,28 Analysis of PBP2b amino acid sequences revealed other substitutions that occurred among NSSP isolates. All of our NSSP strains containing the Thr445
Ala mutation also had the amino acid substitutions Glu475
Gly and Thr488
Ala/Ser (Figure 1). The latter two mutations have previously been identified as important determinants of penicillin resistance in pneumococci.18,20,25,26,29
All PRSP isolates with cefuroxime MICs
2 mg/L and cefotaxime MICs
0.5 mg/L harboured amino acid substitutions close to both PBP1a conserved motifs STMK and SRN, confirming that alteration of PBP1a is required for high levels of penicillin810 and cephalosporin resistance.9,11 Thr371
Ala/Ser mutation, adjacent to the active serine site in the first PBP1a conserved motif (STMK), is known to decrease ß-lactam affinity to PBP1a and has been associated with high levels of penicillin resistance in laboratory mutants and clinical isolates.3032 The Leu539
Trp substitution in PBP1a reported by Smith and Klugman33 as an important site for penicillin and cefotaxime resistance was not observed among our isolates. This substitution has been found in highly resistant pneumococcal strains (penicillin MICs >16 mg/L) of serotype 19A from Hungary. The short mosaic sequence formed by four adjacent amino acids, TSQF (positions 574577), was changed to NTGY in the PBP1a sequence of all strains with penicillin MICs
2 mg/L (by broth microdilution), and in the majority (80%) of strains with MICs
0.125 mg/L. Thr371
Ser/Ala and TSQF
NTGY substitutions were confirmed to be essential for penicillin resistance by reverse amino acid substitution under site-directed mutagenesis.32,33
The development of resistance to ß-lactams is a complex mechanism and can be influenced by mutations in other pbp and non-pbp genes. In fact, PBP1b and PBP2a of low affinity have been reported in penicillin- and cefotaxime-resistant pneumococcal isloates.10,34 A mutation in PBP3 has been shown to confer cefotaxime resistance in laboratory mutants.35 Mutations in the histidine protein kinase CiaH36 and the glycosyltransferase CpoA37 are associated with a very low level of penicillin resistance in laboratory mutants. Moreover, Smith and Klugman38 have demonstrated that alteration in MurM (a cell wall muropeptide branching enzyme) is required for maximal expression of penicillin- and cefotaxime-resistance in pneumococci.
The present study reveals that NSSP strains isolated in Quebec share most PBP2b and PBP1a amino acid substitutions of those reported worldwide. However, the pattern of distribution of the PBPs' altered amino acids differs from that of other countries, showing a unique genetic signature of pneumococci isolates from Quebec (Canada). This study will permit us to monitor the genetic changes associated with the emergence and spread of ß-lactam resistance in Quebec and Canada.
| Transparency declarations |
|---|
|
|
|---|
None to declare.
| Acknowledgements |
|---|
We thank Marthe Bernier from the Centre de recherche en infectiologie (CRI) (Sainte-Foy, Quebec, Canada), Christiane Restieri from Banque du reseau EQUERE, Hôpital Maisonneuve-Rosemont (Montreal, Quebec, Canada) and the Department of Microbiology of the Hôpital Saint-Luc (Montreal) for providing pneumococcal isolates. We are grateful to Dr Ann Huletsky for the primer sequences. We thank France Dion and Julie Lacaille for their technical help, Carmen Fleury and C. Restieri for MIC determinations, and Louise Jetté and François Robillard from Laboratoire de la Santé Publique du Québec (Sainte-Anne-de-Bellevue, Quebec, Canada) for their help in capsular typing. We are indebted to Dr Paul H. Roy for his expertise with the GCG package. The editorial assistance of Ovid DaSilva, Research support office, CHUM Research Centre, is acknowledged. This work was partly supported by a grant from Valorisation Recherche Québec. M. R. is the recipient of a career award from Fonds de la recherche en santé du Quebec (FRSQ).
| References |
|---|
|
|
|---|
1. Felmingham D, Gruneberg RN. The Alexander Project 1996-1997: latest susceptibility data from this international study of bacterial pathogens from community-acquired lower respiratory tract infections. J Antimicrob Chemother 2000; 45: 191203.
2. Song JH, Lee NY, Ichiyama S et al. Spread of drug-resistant Streptococcus pneumoniae in Asian countries: Asian Network for Surveillance of Resistant Pathogens (ANSORP) Study. Clin Infect Dis 1999; 28: 120611.[Web of Science][Medline]
3.
Oteo J, Alos JI, Gomez-Garces JL. Antimicrobial resistance of Streptococcus pneumoniae isolates in 1999 and 2000 in Madrid, Spain: a multicentre surveillance study. J Antimicrob Chemother 2001; 47: 21518.
4.
Zhanel GG, Palatnick L, Nichol KA et al. Antimicrobial resistance in respiratory tract Streptococcus pneumoniae isolates: results of the Canadian Respiratory Organism Susceptibility Study, 1997 to 2002. Antimicrob Agents Chemother 2003; 47: 186774.
5.
Zhanel GG, Karlowsky JA, Palatnick L et al. Prevalence of antimicrobial resistance in respiratory tract isolates of Streptococcus pneumoniae: results of a Canadian national surveillance study. The Canadian Respiratory Infection Study Group. Antimicrob Agents Chemother 1999; 43: 25049.
6.
Grebe T, Hakenbeck R. Penicillin-binding proteins 2b and 2x of Streptococcus pneumoniae are primary resistance determinants for different classes of ß-lactam antibiotics. Antimicrob Agents Chemother 1996; 40: 82934.
7. Krauss J, van der LM, Grebe T et al. Penicillin-binding proteins 2x and 2b as primary PBP targets in Streptococcus pneumoniae. Microb Drug Resist 1996; 2: 1836.[Web of Science][Medline]
8.
Dowson CG, Johnson AP, Cercenado E et al. Genetics of oxacillin resistance in clinical isolates of Streptococcus pneumoniae that are oxacillin resistant and penicillin susceptible. Antimicrob Agents Chemother 1994; 38: 4953.
9. Munoz R, Dowson CG, Daniels M et al. Genetics of resistance to third-generation cephalosporins in clinical isolates of Streptococcus pneumoniae. Mol Microbiol 1992; 6: 24615.[Web of Science][Medline]
10. Reichmann P, Konig A, Marton A et al. Penicillin-binding proteins as resistance determinants in clinical isolates of Streptococcus pneumoniae. Microb Drug Resist 1996; 2: 17781.[Web of Science][Medline]
11.
Coffey TJ, Daniels M, McDougal LK et al. Genetic analysis of clinical isolates of Streptococcus pneumoniae with high-level resistance to expanded-spectrum cephalosporins. Antimicrob Agents Chemother 1995; 39: 130613.
12.
Granger D, Boily-Larouche G, Turgeon P et al. Genetic analysis of pbp2x in clinical Streptococcus pneumoniae isolates in Quebec, Canada. J Antimicrob Chemother 2005; 55: 8329.
13.
Baek JY, Ko KS, Oh WS et al. Unique variations of pbp2b sequences in penicillin-nonsusceptible Streptococcus pneumoniae isolates from Korea. J Clin Microbiol 2004; 42: 174650.
14. Sa-Leao R, Vilhelmsson SE, de Lencastre H et al. Diversity of penicillin-nonsusceptible Streptococcus pneumoniae circulating in Iceland after the introduction of penicillin-resistant clone Spain(6B)-2. J Infect Dis 2002; 186: 96675.[CrossRef][Web of Science][Medline]
15.
Ferroni A, Berche P. Alterations to penicillin-binding proteins 1A, 2B and 2X amongst penicillin-resistant clinical isolates of Streptococcus pneumoniae serotype 23F from the nasopharyngeal flora of children. J Med Microbiol 2001; 50: 82832.
16.
Dowson CG, Hutchison A, Brannigan JA et al. Horizontal transfer of penicillin-binding protein genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Proc Natl Acad Sci USA 1989; 86: 88426.
17. Overweg K, Bogaert D, Sluijter M et al. Molecular characteristics of penicillin-binding protein genes of penicillin-nonsusceptible Streptococcus pneumoniae isolated in the Netherlands. Microb Drug Resist 2001; 7: 32334.[CrossRef][Web of Science][Medline]
18.
Smith AM, Klugman KP. Alterations in penicillin-binding protein 2B from penicillin-resistant wild-type strains of Streptococcus pneumoniae. Antimicrob Agents Chemother 1995; 39: 85967.
19.
Ubukata K, Asahi Y, Yamane A et al. Combinational detection of autolysin and penicillin-binding protein 2B genes of Streptococcus pneumoniae by PCR. J Clin Microbiol 1996; 34: 5926.
20.
Yamane A, Nakano H, Asahi Y et al. Directly repeated insertion of 9-nucleotide sequence detected in penicillin-binding protein 2B gene of penicillin-resistant Streptococcus pneumoniae. Antimicrob Agents Chemother 1996; 40: 12579.
21.
duPlessis M, Bingen E, Klugman KP. Analysis of penicillin-binding protein genes of clinical isolates of Streptococcus pneumoniae with reduced susceptibility to amoxicillin. Antimicrob Agents Chemother 2002; 46: 234957.
22.
Nagai K, Davies TA, Jacobs MR et al. Effects of amino acid alterations in penicillin-binding proteins (PBPs) 1a, 2b, and 2x on PBP affinities of penicillin, ampicillin, amoxicillin, cefditoren, cefuroxime, cefprozil, and cefaclor in 18 clinical isolates of penicillin-susceptible, -intermediate, and -resistant pneumococci. Antimicrob Agents Chemother 2002; 46: 127380.
23. Laible G, Spratt BG, Hakenbeck R. Interspecies recombinational events during the evolution of altered PBP 2x genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Mol Microbiol 1991; 5: 19932002.[Web of Science][Medline]
24. Dowson CG, Coffey TJ, Kell C et al. Evolution of penicillin resistance in Streptococcus pneumoniae; the role of Streptococcus mitis in the formation of a low affinity PBP2B in S. pneumoniae. Mol Microbiol 1993; 9: 63543.[Web of Science][Medline]
25.
Nichol KA, Zhanel GG, Hoban DJ. Penicillin-binding protein 1A, 2B, and 2X alterations in Canadian isolates of penicillin-resistant Streptococcus pneumoniae. Antimicrob Agents Chemother 2002; 46: 326164.
26.
Pagliero E, Chesnel L, Hopkins J et al. Biochemical characterization of Streptococcus pneumoniae penicillin-binding protein 2b and its implication in ß-lactam resistance. Antimicrob Agents Chemother 2004; 48: 184855.
27.
Herzberg O, Moult J. Bacterial resistance to ß-lactam antibiotics: crystal structure of ß-lactamase from Staphylococcus aureus PC1 at 2.5 Å resolution. Science 1987; 236: 694701.
28.
Sanbongi Y, Ida T, Ishikawa M et al. Complete sequences of six penicillin-binding protein genes from 40 Streptococcus pneumoniae clinical isolates collected in Japan. Antimicrob Agents Chemother 2004; 48: 224450.
29. Dowson CG, Hutchison A, Spratt BG. Extensive re-modelling of the transpeptidase domain of penicillin-binding protein 2B of a penicillin-resistant South African isolate of Streptococcus pneumoniae. Mol Microbiol 1989; 3: 95102.[Web of Science][Medline]
30.
Asahi Y, Ubukata K. Association of a Thr-371 substitution in a conserved amino acid motif of penicillin-binding protein 1A with penicillin resistance of Streptococcus pneumoniae. Antimicrob Agents Chemother 1998; 42: 226773.
31. Martin C, Sibold C, Hakenbeck R. Relatedness of penicillin-binding protein 1a genes from different clones of penicillin-resistant Streptococcus pneumoniae isolated in South Africa and Spain. EMBO J 1992; 11: 38316.[Web of Science][Medline]
32.
Smith AM, Klugman KP. Alterations in PBP 1A essential for high-level penicillin resistance in Streptococcus pneumoniae. Antimicrob Agents Chemother 1998; 42: 132933.
33.
Smith AM, Klugman KP. Site-specific mutagenesis analysis of PBP 1A from a penicillin-cephalosporin-resistant pneumococcal isolate. Antimicrob Agents Chemother 2003; 47: 3879.
34.
Chalkley LJ, Koornhof HJ. Intra- and inter-specific transformation of Streptococcus pneumoniae to penicillin resistance. J Antimicrob Chemother 1990; 26: 218.
35.
Krauss J, Hakenbeck R. A mutation in the D,D-carboxypeptidase penicillin-binding protein 3 of Streptococcus pneumoniae contributes to cefotaxime resistance of the laboratory mutant C604. Antimicrob Agents Chemother 1997; 41: 93642.
36. Guenzi E, Gasc AM, Sicard MA et al. A two-component signal-transducing system is involved in competence and penicillin susceptibility in laboratory mutants of Streptococcus pneumoniae. Mol Microbiol 1994; 12: 50515.[Web of Science][Medline]
37.
Grebe T, Paik J, Hakenbeck R. A novel resistance mechanism against ß-lactams in Streptococcus pneumoniae involves CpoA, a putative glycosyltransferase. J Bacteriol 1997; 179: 33429.
38.
Smith AM, Klugman KP. Alterations in MurM, a cell wall muropeptide branching enzyme, increase high-level penicillin and cephalosporin resistance in Streptococcus pneumoniae. Antimicrob Agents Chemother 2001; 45: 23936.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
R. Izdebski, J. Rutschmann, J. Fiett, E. Sadowy, M. Gniadkowski, W. Hryniewicz, and R. Hakenbeck Highly Variable Penicillin Resistance Determinants PBP 2x, PBP 2b, and PBP 1a in Isolates of Two Streptococcus pneumoniae Clonal Groups, Poland23F-16 and Poland6B-20 Antimicrob. Agents Chemother., March 1, 2008; 52(3): 1021 - 1027. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


