Skip Navigation


JAC Advance Access originally published online on November 12, 2005
Journal of Antimicrobial Chemotherapy 2006 57(1):39-45; doi:10.1093/jac/dki400
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
57/1/39    most recent
dki400v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Herrero, A.
Right arrow Articles by Mendoza, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Herrero, A.
Right arrow Articles by Mendoza, M. C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Molecular epidemiology of emergent multidrug-resistant Salmonella enterica serotype Typhimurium strains carrying the virulence resistance plasmid pUO-StVR2

A. Herrero1, M. R. Rodicio1, M. A. González-Hevia2 and M. C. Mendoza1,*

1 Departamento de Biología Funcional, Área de Microbiología, Universidad de Oviedo, C/Julián Clavería 6, 33006 Oviedo, Spain; 2 Laboratorio de Salud Pública, Oviedo, Spain

* Corresponding author. Fax: +34-985103148; E-mail: cmendoza{at}uniovi.es

Received 21 July 2005; accepted 5 October 2005


   Abstract
Top
 Abstract
Introduction
 Materials and methods
 Results
 Discussion
 References
 
Objectives: To evaluate the incidence of a distinct multidrug-resistant (MDR) grouping of Salmonella serotype Typhimurium strains carrying the hybrid virulence resistance plasmid pUO-StVR2, and its possible evolution in the region where it was first detected [Principality of Asturias (PA), Spain].

Methods: pUO-StVR2-containing isolates were tentatively identified by two genetic markers: the blaOXA-30 gene and the class 1 integron InH:2000 bp/blaOXA-30-aadA1a. Positive isolates were examined for resistance profile (RP), plasmid content, virulence profile (VP) and genomic polymorphisms using macrorestriction–PFGE.

Results: A total of 182 out of 248 Typhimurium clinical isolates recorded in the PA over 2001–02 were ampicillin-resistant and could be distributed into several MDR groupings. A MDR grouping carrying pUO-StVR2, with a defined RP (AMP/blaOXA-30, CHL/catA1, [STR-SPT]/[strA/B,aadA1a], SUL/[sul1,sul2], TET/tet(B), qacE{Delta}1, merA, ±TMP/dfrA12, and containing InH), was represented by 49 isolates. The VPs of these isolates (24 genes screened) differed from that of the type strain LT2 by the absence of the sopE1 and pef genes. Macrorestriction analysis established six combined XbaI/BlnI PFGE profiles, and supported a clonal relationship among most of the isolates.

Conclusions: During 2001–02, the isolates carrying pUO-StVR2 constituted the second most frequent S. Typhimurium MDR grouping recorded in the PA, preceded only by the pandemic pentaresistant DT104. Polymorphisms on the genomic DNA, different phage types, different plasmid profiles and the detection of trimethoprim resistance in one isolate encoded by an additional plasmid, were consistent with both intra-cluster evolution and horizontal transfer of the hybrid plasmid.

Keywords: multidrug resistance , hybrid plasmid , PFGE , virulence genotype


   Introduction
Top
 Abstract
 Introduction
Materials and methods
 Results
 Discussion
 References
 
Salmonella enterica serotype Typhimurium (S. Typhimurium) is one of the most common bacteria causing food-borne disease in developed countries.1 As with many other non-typhoid serotypes, infection usually results in self-limited gastroenteritis, which does not require antimicrobial therapy. However, bacteria can occasionally be invasive, and even fatal, particularly for patients with underlying risk factors, such as immunosuppression. In these cases, effective antimicrobial therapy is necessary. A wide diversity of virulence (V) factors have been described for Salmonella, and they can be located on the bacterial chromosome, frequently as part of pathogenicity islands, on plasmids and prophages.2–4 The V plasmid of S. Typhimurium (pSLT) has a size of 94 kb, belongs to the incompatibility group IncFII and contains the spvABCDR locus (responsible for an increase in the bacterial growth rate in mice during the systemic phase of disease), the pefBACDI operon (for biosynthesis of fimbriae involved in adherence to the intestinal epithelium) and the rck and rsk genes (resistance to complement killing), in addition to genes encoding for essential plasmid functions (such as plasmid replication and maintenance).4,5

S. Typhimurium LT2 (the type strain of Typhimurium) is susceptible to antimicrobial drugs, as were the majority of Salmonella strains circulating until the 1980s. Since then, multidrug-resistant (MDR) groupings have emerged and, nowadays, isolates pertaining to them are far more frequent than drug-susceptible isolates.1,6 A MDR clone, defined as S. Typhimurium DT104, with resistance (R) to ampicillin, chloramphenicol–florfenicol, streptomycin–spectinomycin, sulphonamides and tetracyclines (AMP-CHL-STR-SUL-TET phenotype), was initially detected in animals and later in humans. Today it is widely spread and could be considered as pandemic.1,6,7 In this MDR clone, the genes encoding the five antimicrobial-R [blaPSE-1-floR-aadA2-sul1-tet(G)] are located within a chromosomal island (SGI1), with different variants reported over time, which include two class 1 integrons (designated as InC:1200 bp/blaPSE-1 and InD:1000 bp/aadA2) described as In4-type integrons.6,8 In 1997, a new MDR grouping that is monophasic [4,(5),12:i:-] appeared in Spain.9 In general, it displays gentamicin-R and trimethoprim-R, in addition to the DT104 pentaresistant phenotype, with the R genes located on large plasmids carrying a class 1 integron (InI:1900 bp/dfrA12-aadA2). In 2002, our laboratory characterized 12 MDR clinical S. Typhimurium isolates collected during 1993–2000 in the Principality of Asturias (PA), Spain.10 They had the same R phenotype as the pentaresistant DT104 associated to a different R genotype [blaOXA-1-catA1-[strA/B-aadA1a]-[sul1-sul2]-tet(B)], with two of the genes pertaining to a distinctive integron (InH:2000 bp/blaOXA-1-aadA1a). The R genotype was conferred by pUO-StVR2, a hybrid self-transferable plasmid, apparently derived from pSLT. These isolates generated a common and distinctive XbaI macrorestriction profile and could be considered as clonally related. Recently, it was established that the blaOXA gene present in pUO-StVR2 was in fact blaOXA-30 that differs from blaOXA-1 by only 1 nt (GenBank accession number AY534545 [GenBank] ).

When pUO-StVR2 was first described,10 it was already highlighted that the coexistence of virulence and resistance genes in the same extrachromosomal element represents a serious threat for human health that deserves epidemiological surveillance. In the present work we aimed to follow the impact on human health of the S. Typhimurium clone carrying pUO-StVR2 during 2001–02, and to ascertain its possible evolution in the region where this hybrid plasmid was first detected.


   Materials and methods
Top
 Abstract
 Introduction
 Materials and methods
Results
 Discussion
 References
 
Bacterial isolates

A total of 182 S. Typhimurium ampicillin-R isolates (97 collected in 2001 and 85 in 2002, with 8 and 3 being assigned to the [4,(5),12:i:-] variant, each year) were analysed in this study (Table 1). They represented 73.4% of the total S. Typhimurium clinical isolates recorded at the ‘Laboratorio de Salud Pública’ (LSP, acting as Salmonella Reference Centre for the PA) during those 2 years. S. Typhimurium LT2 (pSLT), LSP 31/93 (pUO-StVR2), LSP 14/92 (blaPSE, InC and InD positive) and LSP 389/97 (blaTEM, InI and In0 positive) strains4,10,11 were used as controls in different experiments. Phage typing of the isolates and control strains was performed at the ‘Centro Nacional de Microbiología’ (Madrid, Spain).


View this table:
[in this window]
[in a new window]
  		Table 1.. Features of ampicillin-resistant Salmonella serotype Typhimurium isolates and control strains

 
Antimicrobial susceptibility

Antimicrobial susceptibility was tested according to NCCLS guidelines12 by a disc-diffusion technique using commercial discs (bioMérieux and Oxoid). The antimicrobials and quantities in micrograms tested were: ampicillin (AMP), 10; aztreonam (ATM), 30; cefotaxime (CTX), 30; ceftazidime (CAZ), 30; chloramphenicol (CHL), 30; co-amoxiclav (AMC), 30; gentamicin (GEN), 10; nalidixic acid (NAL), 30; spectinomycin (SPT), 10; streptomycin (STR), 10; sulfadiazine (SUL), 300; tetracycline (TET), 30; and trimethoprim (TMP), 5.

PCR procedures and DNA sequencing

Single and multiple PCRs, using specific primers and conditions previously described,10,13–16 were performed for detection of V-pSLT genes (spvC, rck, pefA and pefC), V chromosomal genes (iroB, phoP/Q, agfA, stn, slyA, invE/A, sopE1 and sefD), R genes [blaOXA, blaPSE, blaTEM, catA1, strA/B, aadA1a, sul1, sul2, tet(B), dfrA1 and dfrA12] and Class 1 integrons. Primers for other pSLT and chromosomal V genes were designed for the present work: pefB (GGCACTCAGGGACTACCTTG/TGATGCGTGACAGGCGGTTC), pefD (CTTTAAGGTCAGGCCCAAGG/TCCGTTCAGCGACAGTTTCC), parA (GAAGTACGCGATGACGATTC/GGTGCTTCCATCATAGGTTG), parB (GAGATGACTGACACCCAAAG/GAGCTATCAATGCCTGAGAG), sodCI (CCAGTGGAGCAGGTTTATCG/GGTGCGCTCATCAGTTGTTC), orgA (GATAAGGCGAAATCGTCAAATG/GTAAGGCCAGTAGCAAAATTG), ttrC (GTGGGCGGTACAATATTTCTTTT/TCACGAATAATAATCAGTAGCGC), ssaQ (GAATAGCGAATGAAGAGCGTCC/CATCGTGTTATCCTCTGTCAGC), mgtC (TGACTATCAATGCTCCAGTGAAT/ATTTACTGGCCGCTATGCTGTTG), misL (GACGTTGATAGTCTGCCATCCAG/CAATGCCGCCAGTCTCCGTGC), spi4R (GATATTTATCAGTCTATAACAGC/ATTCTCATCCAGATTTGATGTTG), spi4D (GAATAGAAGACAAAGCGATCATC/GCTTTGTCCACGCCTTTCATC), sopB (GATGTGATTAATGAAGAAATGCC/GCAAACCATAAAAACTACACTCA) and pipA (CTCTTGGATGATTTTCTTCTTTA/CTTATCTCAGGCGCGGGTGG).

For a correct description of the type of blaOXA gene carried by pUO-StVR2/InH, the 708 bp amplicons obtained with the blaOXA primers13 from LSP 31/93 and LSP 153/02 were sequenced. In both cases the gene was identified as blaOXA-30. Confirmation of the insertion of blaOXA-30 and aadA1a into the 2000 bp amplicons generated with the 5'CS/3'CS primers was achieved by nested-PCR, using the 2000 bp amplicon as the template DNA, and primers specific for the blaOXA and aadA1a genes.17

Plasmid analysis and Southern hybridization

Plasmid DNA was routinely purified by the method of Kado and Liu.18 However, for a better resolution of large plasmids with a similar size, plasmid extraction from selected isolates was also performed by S1-PFGE.19 Plasmids ranging in size from 7 to 150 kb extracted from Escherichia coli 39R861 (NCTC 50192) and {lambda} Ladder PFG Marker (New England BioLabs) were used as molecular size standards for undigested and S1-digested DNA, respectively. Selected plasmid profiles were sequentially hybridized with probes specific for spvC, blaOXA-30 and dfrA12. The probes were obtained from LT2 (spvC), LSP 31/93 (blaOXA-30) and LSP 174/01 (dfrA12) by PCR amplification using DIG-labelled dNTPs (PCR DIG labelling mix; Roche Applied Science), followed by gel extraction and purification with the GFXTM DNA and Gel Band Purification Kit (Amersham Biosciences).

Genomic macrorestriction–PFGE analysis

S. Typhimurium isolates were analysed by macrorestriction and PFGE. Slices of the DNA-containing plugs were subjected to XbaI (Takara Biomedicals, 30 U; 4 h at 37°C) and BlnI (Takara Biomedicals, 20 U; overnight at 37°C) digestion. A CHEF-DRIII system (Bio-Rad Laboratories) was used to separate the fragments under the standardized conditions recommended by ‘The Salm-gene project’.20 The LT2 isolate was used as PFGE marker.21 Similarity between XbaI–BlnI profiles was evaluated by the Jaccard's coefficient (S), and cluster analysis was performed by the unweighted pair group method with arithmetic averages, using the software program MVSP (Multivariate Statistics Package for PCs, RockWare Inc.). Strains showing profiles with similarity coefficients of ≥0.70 were considered members of the same cluster.


   Results
Top
 Abstract
 Introduction
 Materials and methods
 Results
Discussion
 References
 
S. Typhimurium ampicillin resistance in the Principality of Asturias

A total of 1427 S. enterica isolates causing human disease were recorded at the LSP over the period 2001–02 (702 in 2001 and 725 in 2002), corresponding to rates of 66.2 and 68.4 per 105 inhabitants/year, during 2001 and 2002, respectively. Of them, 248 belonged to S. Typhimurium [rates of 10.2 and 13.2 per 105 inhabitants/year, during 2001 (108 isolates) and 2002 (140 isolates), respectively]. Regarding the antigenic formula the S. Typhimurium isolates could be subdivided into typical or biphasic [4,(5),12:i:1,2] and atypical or monophasic [4,(5),12:i:-] variants, with 231 and 17 isolates, respectively.

Regarding ampicillin, 182 (73.4%) out of the 248 S. Typhimurium isolates were resistant. All of them were tested for the presence of three bla genes and for In profile by PCR procedures. Results showed that 91, 37 and 49 isolates generated the expected amplicons for blaPSE (419 bp), blaTEM (503 bp) and blaOXA (708 bp), respectively, while in the remaining five, the ampicillin-R determinants were not identified. In addition, 151 isolates were In-positive, and could be differentiated into four In profiles, In-P1 (1200 + 1000 bp); In-P2 (1900 ± 150 bp); In-P3 (2000 bp); and In-P4 (1600 bp), with 91, 10, 49 and 1 isolate(s), respectively. Both traits, bla gene and In profile, together with the antigenic formula, were used to discriminate the isolates into three major groupings: G1 (blaPSE, In-P1), G2 (blaTEM, In-P2) and G3 (blaOXA, In-P3), apart from other, as yet undefined, groupings (Table 1). The presence of blaOXA and the aadA1a gene within the 2000 bp amplicon characteristic of In-P3 (InH) was confirmed by nested-PCR amplification using specific primers for each gene (not shown).

Characterization of G3 isolates

The 49 isolates belonging to G3 and the control strains LT2 and LSP 31/93 were tested for the presence of pSLT determinants, plasmid profile, resistance profile (RP) and virulence profile (VP). All these, as well as the control LSP 31/93 strain, were spvC-, rck- and parA/B-positive and pefABCD-negative, and carried a plasmid of the size expected for pUO-StVR2 (~140 kb; readily visualized after extraction by the Kado and Liu method). In addition, some G3 isolates contained one or more plasmids of smaller size and unknown function (data not shown). As expected, G3 isolates showed the RP conferred by pUO-StVR2, but one of them (LSP 174/01) was also trimethoprim-R. PCR amplification revealed that dfrA12 was the gene responsible for such resistance (not shown). Plasmid extraction from this and several other isolates (LSP 31/93, LSP 238/02 and LT2) by S1-PFGE, followed by Southern hybridizations, demonstrated that, together with pUO-StVR2, a plasmid of ~110 kb (labelled pUO-StR12) was present in LSP 174/01, and the dfrA12 mapped on it (Figure 1a and d). In contrast, the blaOXA and spvC probes mapped on the 140 kb plasmid from the G3 isolates (LSP 31/93 and LSP 238/02) and the second also on the 94 kb plasmid from LT2 (Figure 1b and c).



View larger version (67K):
[in this window]
[in a new window]
  		Figure 1.. Plasmid analysis by S1-PFGE and hybridizations. (a) Plasmid profiles obtained by S1-PFGE. Lanes 1–4: LT2 (pSLT), LSP 31/93 (pUO-StVR2), LSP 238/02 and LSP 174/01, respectively. M, {lambda} ladder PFGE marker. (b–d) Hybridization of (a) with spvC, blaOXA-30 and dfrA12 probes, mapping on fragments of (140 and 94 kb), (140 kb) and (110 kb), respectively.

 
To further characterize the isolates belonging to G3, they were analysed for VP. Results revealed that all of them, as well as the control strains, were positive for the genes used as indicators of five Salmonella pathogenicity islands (invE/A and orgA, SPI1; ttrC and ssaQ, SPI2; mgtC and misL, SPI3; spi4R and spi4D, SPI4; and sopB and pipA, SPI5). In addition, they were also positive for seven out of nine other V genes tested (phoP/Q, agfA, slyA, stn, iroB and sodCI). However, all were negative for sefD and all except LT2 were also negative for sopE1.

Dispersion of pUO-StVR2 between genomic types of S. Typhimurium

By XbaI-macrorestriction PFGE analysis the clinical isolates could be discriminated into five XbaI profiles (X1–X5), with most isolates (85.7%) belonging to X1 and X2. LSP 31/93, the G3 strain from the previous period, generated the X1 profile while LT2 gave a distinct profile, here termed X0 (Table 2 and Figure 2a). Total DNA from representative isolates of the different XbaI profiles (6, 6, 1, 1 and 2 belonging to X1–X5, respectively; Table 2), and the controls LSP 31/93 and LT2, were also analysed by BlnI macrorestriction (Figure 2b). In general, results obtained with the second endonuclease matched those obtained with XbaI. In fact, all except one of the isolates tested with BlnI could be assigned to the B0–B5 profiles, which corresponded to the X0–X5 profiles. The exception was LSP 174/01 (dfrA12-positive) that generated the X2 profile but a distinct BlnI profile, termed B6 (Table 2 and Figure 2b), which differed from B2 by the presence of an additional ~110 kb fragment (probably corresponding to pUO-StR12). The XbaI and BlnI profiles were combined, and a dendrogram of similarity was constructed (Figure 2c). At a cut-off point of S = 0.73 all profiles from pUO-StVR2 isolates fall into a single cluster, which was related to LT2 at S = 0.54. It is interesting to note that the newly described profiles differed from the earliest X1–B1 by 2–6 bands. Moreover, the two combined profiles that included most of the analysed isolates (X1–B1 and X2–B2) differed only by three bands. Accordingly, the G3 grouping appears to be highly clonal.22


View this table:
[in this window]
[in a new window]
  		Table 2.. Differential traits of G3 isolates

 


View larger version (37K):
[in this window]
[in a new window]
  		Figure 2.. Macrorestriction–PFGE analysis of representative S. Typhimurium pUO-StVR2 isolates. (a) XbaI profiles: lanes 1–6, profiles showed by LSP strains 31/93, 60/01, 174/01, 353/01, 509/01 and 238/02, respectively. L, X0-profile generated by LT2. The arrow indicates the fragment corresponding to pSLT. (b) BlnI profiles: lanes 1–7, profiles shown by LSP strains 31/93, 60/01, 137/01, 353/01, 509/01, 238/01 and 174/01, respectively. L, B0-profile generated by LT2. The arrow indicates the fragment corresponding to pSLT. (c) Dendogram of similarity of XbaI–BlnI profiles corresponding to G3 isolates. At S = 0.73, the six profiles generated by G3 isolates were clustered, while the LT2 profile remains out of the group (S = 0.54). Asterisk indicates the branch in which the G3 prototype strain (LSP 31/93) was also included.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
References
 
Using two genetic markers, type of bla gene and In profile, three well-defined MDR groupings (G1–G3), together with other not well-defined groupings of S. Typhimurium could be distinguished as a cause of human salmonellosis in the PA over the period 2001–02. As in other countries,23 the pentaresistant DT104 clone (here defined as G1: blaPSE, InC:1200 bp and InD:1000 bp), was the most frequent. It was involved in at least 89 salmonellosis episodes associated with 91 clinical isolates [89 collected from faeces and two from patients suffering from bacteraemia secondary to gastroenteritis (with positive blood and faeces cultures)]. They represented 6.4 and 36.7% of the S. enterica and S. Typhimurium clinical isolates recorded in the LSP, respectively. The second most frequent grouping was G3, identified as positive for blaOXA, InH:2000 bp (containing the blaOXA-aadA1a gene cassettes) and pUO-StVR2. It was implicated in at least 44 sporadic episodes including 47 isolates, and one family outbreak (here represented by two isolates with the same macrorestriction profiles). Apart from the outbreak, 38 sporadic episodes were of gastroenteritis (two isolates were collected at different days from the same patient, and showed different phage type: DT104 and DT193). The remaining four corresponded to bacteraemia, and isolates with identical traits were recovered from both blood and ascitic fluid in one patient, and from blood and faeces in the other three. The 49 G3-isolates represented 3.4 and 19.7% of S. enterica and S. Typhimurium, respectively, recorded at the LSP during 2001–02. A third MDR grouping, G2, corresponding to the [4,(5),12:i:-] variant (here identified as positive for blaTEM and InI:1900 bp ± In0:150 bp) was related to 10 sporadic episodes of gastroenteritis, representing 0.7 and 4.0% of S. enterica and serotype Typhimurium, respectively. It should be kept in mind that the actual frequency of salmonellosis and of the three major ampicillin-R groupings in the PA could be much higher, since in intestinal disease episodes, only some people require hospital attention, and, usually, Salmonella organisms are only collected from them. In addition, not all the isolates collected in the PA Microbiology Laboratories are forwarded to the LSP.

It is of note that direct information about the distribution of G3 in places other than the PA is not available. However, recent studies from different Spanish laboratories have demonstrated the presence of InH:2000 bp/blaOXA-aadA1a integrons in isolates of S. Typhimurium,24–26 although its relation with hybrid plasmids has not been investigated, or could not be demonstrated. Noteworthy, one of the analysed isolates yielded a PFGE profile similar to X1.25 In studies from four other European countries (Albania, Italy, Portugal and Norway), MDR plasmids carrying InH-type integrons were reported in S. Typhimurium. The Albanian isolates, which were associated with sporadic cases of acute gastroenteritis in children, carried self-transferable R plasmids of ~140 kb, belonging to the incompatibility group IncFI, and conferring the AMP-CHL-KAN-STR-SUL-TMP ± TET MDR phenotype.27 More recently, a blaOXA-containing integron was found in the virulence plasmid of an MDR S. Typhimurium strain collected in Italy.28 This plasmid, apparently non-conjugative, was of ~110 kb in size, conferred the AMP-GEN-KAN-STR-SPT-SUL-TMP phenotype, and belonged to the incompatibility group IncFII. The Portuguese isolates,29 recovered from humans and pork, carried InH-type integrons on self-transferable plasmids (reported as >70 kb and showing different restriction profiles), which encoded the AMP-STR-SUL-TET ± CHL R phenotype. These isolates generated XbaI profiles similar to X1 and X2 found in the PA isolates. Finally, blaOXA-aadA1 integrons were also detected in four AMP-CHL-STR-SUL-TET strains from patients hospitalized in Norway.30 Interestingly, although one of the strains was reported as domestically acquired, the remaining three were acquired in Spain.

With respect to virulence, V determinants common to LT2 and G3 included 10 chromosomal genes representing the 5 SPIs as well as 6 non-SPI located genes (phoP/Q, agfA, slyA, stn and iroB)31–35 and the bacteriophage-associated sodCI gene.36 However, the sopE1 gene was present in LT2 but not in pUO-StVR2-positive isolates. This gene, located on a temperate bacteriophage, encodes an effector protein of the SPI1 type III secretion system, which contributes to host cell invasion and intestinal inflammation in animal models.37 As expected, LT2 and G3 isolates were negative for sefD, a gene of the sef operon, which encodes the SEF18 fimbriae in Salmonella Enteritidis.16,32 With respect to plasmid genes, all G3 isolates contained spvC, rck, parA and parB but lacked the pef operon, while LT2 was positive for all these genes. According to this, deletions in the pef operon could have occurred when the R region was inserted into pSLT to originate the hybrid plasmid. Such a possibility is currently being investigated.

It is interesting to note that 12 G3 isolates, collected during 1993–2000, and previously subjected to PFGE analysis, showed a single XbaI profile (X1).10 In contrast, the 49 isolates recovered over 2001–02 generated five XbaI profiles (X1–X5), although >85% belonged to X1 and X2. Comparisons of these, and the corresponding BlnI profiles, supported that most G3 isolates are clonally related. Accordingly, vertical transmission could be the main way for the spread of pUO-StRV2, although horizontal transfer of the plasmid cannot be ruled out. In fact, the observed polymorphisms on the genomic DNA, together with the different phage types, the different plasmid profiles and the acquisition of a new trimethoprim-R determinant (dfrA12), are compatible not only with the evolution of the progeny of an original G3 strain, but also with the transfer of the plasmid to relatively related S. Typhimurium strains. Further epidemiological surveillance will be required to determine the potential of a wider distribution of the emergent MDR cluster carrying pUO-StRV2.


   Acknowledgements
 
We thank the personnel of the Microbiology Laboratories of the ‘Hospital Central de Asturias’ (Oviedo), ‘Hospital San Agustín’ (Avilés), ‘Hospital de Jarrio’, ‘Hospital de Cabueñes’ (Gijón), and ‘Hospital Carmen and Severo Ochoa’ (Cangas de Narcea) for their invaluable collaboration with the LSP in registering clinical isolates of Salmonella. We also thank Dr B. Guerra for his helpful comments. This work has been supported by a grant from the ‘Fondo de Investigación Sanitaria’ (ref. 02/0172). A. H. is the recipient of a grant from the ‘Fundación para el Fomento en Asturias de la Investigación Científica Aplicada y la Tecnología’ (FICYT, ref. BP04-086).


   References
Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1. Threlfall EJ, Fisher IST, Berghold C et al. Antimicrobial drug resistance in isolates of Salmonella enterica from cases of salmonellosis in humans in Europe in 2000: results of international multi-centre surveillance. Euro Surveill 2003; 8: 41–4.[Medline]

2. Marcus SL, Brumell JH, Pfeifer CG et al. Salmonella pathogenicity islands: big virulence in small packages. Microbes Infect 2000; 2: 145–56.[CrossRef][Web of Science][Medline]

3. Fierer J, Guiney DG. Diverse virulence traits underlying different clinical outcomes of Salmonella infection. J Clin Invest 2001; 107: 775–80.[Web of Science][Medline]

4. McClelland M, Sanderson KE, Spieth J et al. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 2001; 413: 852–6.[CrossRef][Medline]

5. Rotger R, Casadesús J. The virulence plasmids of Salmonella. Int Microbiol 1999; 2: 177–84.[Medline]

6. Threlfall EJ. Antimicrobial drug resistance in Salmonella: problems and perspectives in food- and water-borne infections. FEMS Microbiol Rev 2002; 26: 141–8.[CrossRef][Web of Science][Medline]

7. Davis MA, Hancock DD, Besser TE. Multiresistant clones of Salmonella enterica: the importance of dissemination. J Lab Clin Med 2002; 140: 135–41.[CrossRef][Web of Science][Medline]

8. Boyd D, Cloeckaert A, Chaslus-Dancla E et al. Characterization of variant Salmonella genomic island 1 multidrug resistance regions from serovars Typhimurium DT104 and Agona. Antimicrob Agents Chemother 2002; 46: 1714–22.[Abstract/Free Full Text]

9. Echeita MA, Aladueña A, Cruchaga S et al. Emergence and spread of an atypical Salmonella enterica subsp. enterica serotype 4,5,12:i:- strain in Spain. J Clin Microbiol 1999; 37: 3425.[Free Full Text]

10. Guerra B, Soto S, Helmuth R et al. Characterization of a self-transferable plasmid from Salmonella enterica serotype Typhimurium clinical isolates carrying two integron-borne gene cassettes together with virulence and drug resistance genes. Antimicrob Agents Chemother 2002; 46: 2977–81.[Abstract/Free Full Text]

11. Guerra B, Soto S, Arguelles JM et al. Multidrug resistance is mediated by large plasmids carrying a class 1 integron in the emergent Salmonella enterica serotype [4,5,12:i:-]. Antimicrob Agents Chemother 2001; 45: 1305–8.[Abstract/Free Full Text]

12. National Committee for Clinical Laboratory Standards. Performance Standards for Antimicrobial Susceptibility Testing: Eleventh Informational Supplement M100-S12. NCCLS, Wayne, PA, USA, 2002.

13. Guerra B, Junker E, Miko A et al. Characterization and localization of drug resistance determinants in multidrug-resistant, integron-carrying Salmonella enterica serotype Typhimurium strains. Microb Drug Resist 2004; 10: 83–91.[CrossRef][Web of Science][Medline]

14. del Cerro A, Soto SM, Mendoza MC. Virulence and antimicrobial-resistance gene profiles determined by PCR-based procedures for Salmonella isolated from samples of animal origin. Food Microbiol 2003; 20: 431–8.[CrossRef]

15. Pasmans F, Van Immerseel F, Heyndrickx M et al. Host adaptation of pigeon isolates of Salmonella enterica subsp. enterica serovar Typhimurium variant Copenhagen phage type 99 is associated with enhanced macrophage cytotoxicity. Infect Immun 2003; 71: 6068–74.[Abstract/Free Full Text]

16. Baumler AJ, Gilde AJ, Tsolis RM et al. Contribution of horizontal gene transfer and deletion events to development of distinctive patterns of fimbrial operons during evolution of Salmonella serotypes. J Bacteriol 1997; 179: 317–22.[Abstract/Free Full Text]

17. Guerra B, Soto S, Cal S et al. Antimicrobial resistance and spread of class 1 integrons among Salmonella serotypes. Antimicrob Agents Chemother 2000; 44: 2166–9.[Abstract/Free Full Text]

18. Kado CL, Liu ST. Rapid procedure for detection and isolation of large and small plasmids. J Bacteriol 1981; 145: 1365–73.[Abstract/Free Full Text]

19. Barton BM, Harding GP, Zuccarelli AJ. A general method for detecting and sizing large plasmids. Anal Biochem 1995; 226: 235–40.[CrossRef][Web of Science][Medline]

20. Peters TM, Maguirre C, Threlfall EJ et al. The Salm-gene project: a European collaboration for DNA fingerprinting for food related salmonellosis. Euro Surveill 2003; 8: 46–50.[Medline]

21. Liu, S-L, Hessel A, Sanderson KE. The XbaI-BlnI-CeuI genomic cleavage map of Salmonella typhimurium LT2 determined by double digestion, end labelling, and pulsed-field gel electrophoresis. J Bacteriol 1993; 175: 4104–20.[Abstract/Free Full Text]

22. Tenover FC, Arbeit RD, Goering RV et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995; 33: 2233–9.[Web of Science][Medline]

23. Helms M, Ethelberg S, Molbak K et al. International Salmonella Typhimurium DT104 infections, 1992-2001. Emerg Infect Dis 2005; 11: 859–67.[Web of Science][Medline]

24. Pérez MO, Carulla M, Pérez M et al. Diseminación de integrones de clase I entre cepas de Salmonella enterica productoras de diferentes tipos de ß-lactamasas aisladas en la región sanitaria de Tortosa. Enferm Infecc Microbiol Clin 2004; 22: Suppl 1: 21.

25. Güerri ML, Aladueña A, Echeita A et al. Detection of integrons and antibiotic-resistance genes in Salmonella serovar Typhimurium isolates with resistance to ampicilin and variable susceptibility to amoxicilin-clavulanate. Int J Antimicrob Agents 2004; 24: 327–33.[CrossRef][Web of Science][Medline]

26. Gallardo F, Ruiz J, Soto SM et al. Distintos mecanismos de resistencia asociados a integrones en aislamientos clínicos de Salmonella Typhimurium. Rev Esp Quimioter 2003; 16: 398–402.[Medline]

27. Tosini F, Visca P, Dionisi AM et al. Class 1 integron-borne multiple antibiotic resistance carried by IncFI and IncL/M plasmids in Salmonella enterica serotype Typhimurium. Antimicrob Agents Chemother 1998; 42: 3053–8.[Abstract/Free Full Text]

28. Villa L, Carattoli A. Integrons and transposons on the Salmonella enterica serovar Typhimurium virulence plasmid. Antimicrob Agents Chemother 2005; 49: 1194–7.[Abstract/Free Full Text]

29. Antunes P, Machado J, Sousa JC et al. Dissemination amongst humans and food products of animal origin of Salmonella typhimurium clone expressing an integron-borne OXA-30 ß-lactamase. J Antimicrob Chemother 2004; 54: 429–34.[Abstract/Free Full Text]

30. Lindstedt B-A, Heir E, Nygard I et al. Characterization of class I integrons in clinical strains of Salmonella enterica subsp. enterica serovars Typhimurium and Enteritidis from Norwegian hospitals. J Med Microbiol 2003; 52: 141–9.[Abstract/Free Full Text]

31. Miller SI. PhoP/PhoQ: macrophage-specific modulators of Salmonella virulence? Mol Microbiol 1991; 5: 2073–8.[Web of Science][Medline]

32. Collinson SK, Liu SL, Clouthier SC et al. The location of four fimbrin-encoding genes, agfA, fimA, sefA and sefD, on the Salmonella enteritidis and/or S. typhimurium XbaI-BlnI genomic restriction maps. Gene 1996; 169: 75–80.[CrossRef][Web of Science][Medline]

33. Watson PR, Paulin SM, Bland AP et al. Differential regulation of enteric and systemic salmonellosis by slyA. Infect Immun 1999; 67: 4950–4.[Abstract/Free Full Text]

34. Prager R, Fruth A, Tschäpe H. Salmonella enterotoxin (stn) gene is prevalent among strains of Salmonella enterica, but not among Salmonella bongori and other Enterobacteriaceae. FEMS Immunol Med Microbiol 1995; 12: 47–50.[CrossRef][Web of Science][Medline]

35. Baümler AJ, Heffron F, Reissbrodt R. Rapid detection of Salmonella enterica with primers specific for iroB. J Clin Microbiol 1997; 35: 1224–320.[Abstract]

36. Fang FC, DeGroote MA, Foster JW et al. Virulent Salmonella typhimurium has two periplasmic Cu,Zn-superoxide dismutases. Proc Natl Acad Sci USA 1999; 96: 7502–7.[Abstract/Free Full Text]

37. Mirold S, Rabsch W, Rohde M et al. Isolation of a temperate bacteriophage encoding the type III effetor protein SopE from an epidemic Salmonella typhimurium strain. Proc Natl Acad Sci USA 1999; 96: 9845–50.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Antimicrob. Agents Chemother.Home page
A. Herrero, M. C. Mendoza, R. Rodicio, and M. R. Rodicio
Characterization of pUO-StVR2, a Virulence-Resistance Plasmid Evolved from the pSLT Virulence Plasmid of Salmonella enterica Serovar Typhimurium
Antimicrob. Agents Chemother., December 1, 2008; 52(12): 4514 - 4517.
[Abstract] [Full Text] [PDF]

Home page
 J Antimicrob ChemotherHome page
N. Martinez, M. C. Mendoza, I. Rodriguez, S. Soto, M. Bances, and M. R. Rodicio
Detailed structure of integrons and transposons carried by large conjugative plasmids responsible for multidrug resistance in diverse genomic types of Salmonella enterica serovar Brandenburg
J. Antimicrob. Chemother., December 1, 2007; 60(6): 1227 - 1234.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
57/1/39    most recent
dki400v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Herrero, A.
Right arrow Articles by Mendoza, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Herrero, A.
Right arrow Articles by Mendoza, M. C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?