Skip Navigation


JAC Advance Access originally published online on September 8, 2005
Journal of Antimicrobial Chemotherapy 2005 56(5):847-855; doi:10.1093/jac/dki328
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
56/5/847    most recent
dki328v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Stevens, M.
Right arrow Articles by Pannecouque, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stevens, M.
Right arrow Articles by Pannecouque, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Cell-dependent interference of a series of new 6-aminoquinolone derivatives with viral (HIV/CMV) transactivation

Miguel Stevens1,*, Jan Balzarini1, Oriana Tabarrini2, Graciela Andrei1, Robert Snoeck1, Violetta Cecchetti2, Arnaldo Fravolini2, Erik De Clercq1 and Christophe Pannecouque1

1 Rega Institute for Medical Research, Katholieke Universiteit Leuven, B-3000 Leuven, Belgium; 2 Department of Chemistry and Technology of Drugs, University of Perugia, Via del Liceo, 06123 Perugia, Italy


* Corresponding author. Tel: +32-16-332171; Fax: +32-16-332131; E-mail: Miguel.Stevens{at}med.kuleuven.be

Received 29 June 2005; returned 12 June 2005; revised 10 August 2005; accepted 19 August 2005


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Objectives: Quinolone derivatives have been shown to inhibit human immunodeficiency virus (HIV) replication at the transcriptional level. Recently, a series of new 6-aminoquinolones that are endowed with more pronounced anti-HIV activities compared with the formerly reported quinolone derivatives have been published. These potent 6-aminoquinolones were further evaluated for their broad-spectrum antiviral properties.

Methods: Latently HIV-1-infected cell lines as well as cytomegalovirus (CMV)-infected fibroblasts were used to evaluate the antiviral potency of the 6-aminoquinolone derivatives. Additionally green fluorescent protein (GFP) transactivation experiments using different promoters were conducted.

Results: The compounds completely suppressed tumour necrosis factor alpha (TNF-{alpha})- and phorbol 12-myristate 13-acetate (PMA)-induced HIV-1 expression in latently HIV-1-infected OM-10.1 and U1 cell lines at non-toxic concentrations. In addition, HIV-1 mRNA production was dramatically suppressed in both cell lines in a dose-dependent manner. In the same concentration range, the compounds inhibited TNF-{alpha} release from PMA-induced OM-10.1 cells but allowed TNF-{alpha} production from PMA-induced U1 cells at all concentrations tested. The 6-aminoquinolone derivatives were not only inhibitory to the Tat-mediated transactivation of the HIV-1 LTR promoter, but were also found to interfere in a cell-dependent way with the transactivation process mediated from the human CMV immediate early and the human EF-1{alpha} promoter. Additionally, the 6-aminoquinolone derivatives were also found to be inhibitory to CMV replication in fibroblast cells.

Conclusions: It thus appears that the antiviral spectrum of this class of compounds is not confined to the specific inhibition of HIV but encompasses CMV as well. This broad-spectrum activity window might provide an interesting platform for future applications for the 6-aminoquinolone derivatives.

Keywords: Tat , TAR , latency


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The most clearly defined reservoir for HIV-1 is a small pool of latently infected resting CD4 + T cells with integrated provirus.14 This stable latent reservoir for HIV-1 remains a barrier to eradication of the virus infection even in patients on highly active antiretroviral therapy (HAART).5,6 The presence of short, abortive products of HIV-1 transcription in purified resting CD4 + T cells from patients on HAART,7 as well as the fact that Tat has been shown to up-regulate HIV-1 gene expression in peripheral blood mononuclear cells (PBMCs) from patients on HAART,8 signify the need for new anti-HIV treatment strategies. Although HAART cannot provide eradication, lifetime control of the infection with different antiretroviral drugs may be feasible. A unique class of drugs that may contribute to the control of the latent HIV-1 reservoir includes the quinolone derivatives. Quinolones were first reported as an important class of broad-spectrum antibacterials based on the inhibition of prokaryotic type II topoisomerases, namely DNA gyrase and topoisomerase IV.9 In addition to these interesting properties, quinolones have been shown to inhibit HIV-1 replication in both acutely and chronically HIV-infected cell lines.1014 Only recently has the inhibitory potential against HIV been ascribed to the inhibition of the complex formation between the protein Tat and the transactivation responsive element (TAR) of the viral RNA transcript.15 However, the 6-aminoquinolones seem to prevent this complex formation by binding to the bulge of TAR.16 Recently, a series of new 6-aminoquinolone derivatives were investigated for their inhibitory potential against HIV and were found to be more potent as compared with the existing (fluoro)quinolone derivatives.17 In this study, we examined these potent 6-aminoquinolone derivatives for their anti-HIV-1 and anti-cytomegalovirus (CMV) activities in vitro as well as for their inhibitory effects on Tat-mediated green fluorescent protein (GFP) gene expression from the HIV-1 LTR promoter and their effects on transactivation of the GFP reporter gene mediated from promoters of other species.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Compounds and plasmid constructs

The 6-aminoquinolone derivatives studied are shown in Table 1 and were synthesized as previously described.17 Plasmids used in this study included pHIV-GFPemd that contains the GFP reporter gene driven by the HIV-1 LTR promoter,18 pCMV-GFPemd that contains the EcoRI–SmaI fragment from pCMVß (Becton Dickinson) inserted in the EcoRI–StuI sites of the pGFPemd-p vector (Packard), and pEF-GFPemd that contains the NheI–XhoI (XhoI blunt-ended with T4 DNA polymerase) fragment from pBudCE4.1 (Invitrogen, Merelbeke, Belgium) inserted in the NheI–StuI sites of the pGFPemd-p vector. The construct pLTR-Q was made as follows. After a reverse transcription reaction on total RNA isolated from OM-10.1 cells to cDNA, a PCR was performed with forward primer LTR-F GCTAACTAGGGAACCCACTGCTTA and reverse primer LTR-R TGAGGGATCTCTAGTTACCAGAGTCA in order to amplify a 105 bp fragment for cloning into the TOPO cloning vector (Invitrogen, Merelbeke, Belgium). The construct was checked by sequencing and used as standard for quantitative real-time PCR. pGAPDH-Q was used as internal control in the quantitative real-time PCR reaction and was constructed by cloning the complete GAPDH gene from the cDNA mix with forward primer GAPDH-F GACAGTCAGCCGCATCTTAT and reverse primer GAPDH-R CTTCCTCTTGTGCTCTTGCTG into the TOPO cloning vector. This construct was also verified by sequencing.


View this table:
[in this window]
[in a new window]
 
Table 1.. Structural formulae of 6-aminoquinolone derivatives

 
Cells and viruses

The latently HIV-1-infected promyelocytic OM-10.1 cell line19 and the latently HIV-1-infected promonocytic U1 cells20 were maintained in RPMI-1640 medium (Life Technologies, Merelbeke, Belgium), supplemented with 10% heat-inactivated fetal calf serum (FCS; Integro, Zaandam, The Netherlands), 2 mM L-glutamine (Life Technologies) and 0.1% NaHCO3 (Life technologies), and incubated at 37°C in a humidified CO2-controlled atmosphere. Human primary monocytes/macrophages (M/M) were prepared and purified as follows. PBMCs were isolated from healthy HIV-seronegative donor buffy coats using a Ficoll gradient (Lymphoprep; Nycomed Pharma, AS Diagnostics, Oslo, Norway), resuspended in RPMI-1640 supplemented with 2 mM L-glutamine, 15% FCS and 0.1% NaHCO3, and spread out on IgG-immobilized Petri dishes. After an incubation period of 3 days at 37°C, M/M were trypsinized and transferred into 24-well plates for antiviral activity assays with the HIV-1(BaL) strain. HLtat cells (contributed by Drs B. K. Felber and G. N. Pavlakis; National Institutes of Health, Bethesda, MD, USA) and Jurkattat cells21 are HeLa and Jurkat cells stably expressing HIV-1 Tat protein, respectively. HLtat cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FCS and Jurkattat cells were maintained in RPMI-1640 medium containing 10% FCS, 2 mM L-glutamine and 0.1% NaHCO3. Human embryonic lung (HEL) cells and murine embryo fibroblast C3H/3T3 cells were grown in minimum essential medium (MEM) supplemented with 10% heat-inactivated FCS, 2 mM L-glutamine and 0.3% NaHCO3. The human CMV strains AD-169 and Davis were used in the antiviral activity assays.

Cytotoxicity and antiviral activity assays

The activity values of the 6-aminoquinolone derivatives against chronic HIV-1 infection were based on the inhibition of p24 antigen production in OM-10.1 and U1 cells after stimulation with tumour necrosis factor alpha (TNF-{alpha}; Roche Diagnostics Belgium) and phorbol 12-myristate 13-acetate (PMA; Sigma Chemical Co., Bornem, Belgium). Briefly, OM-10.1 and U1 cells (5 x 105 cells/mL) were incubated in the presence or absence of the compounds for 2 h in 48-well plates. After this short incubation period, the cell cultures were stimulated with 1 ng/mL TNF-{alpha} or 0.02 µM PMA followed by transfer of 2 x 200 µL into a 96-well plate for cytotoxicity evaluation. After a 2 day incubation at 37°C, the cell culture supernatants were collected from the 48-well plates and examined for their p24 antigen levels with the HIV-1 p24 ELISA kit (NEN, Brussels, Belgium). Cytotoxicity of the compounds for both latently HIV-1-infected OM-10.1 and U1 cell lines in the 96-well plates evaluated after a 2 day incubation period at 37°C were based on 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell viability staining as described previously.22 For the antiviral activity assay in M/M, 24-well plates seeded with 150 000 cells per well were treated with various concentrations of compounds and infected with 100 TCID50/mL HIV-1(BaL). After a 5 day incubation, culture medium was replaced with fresh complete medium containing the appropriate compound concentration and the M/M were then cultured for an additional 8 days. Supernatants were finally collected for assessment of virus production by analysis of HIV-1 p24 antigen (NEN, Brussels, Belgium). For the anti-CMV assay, confluent HEL and C3H/3T3 cells grown in 96-well microtitre plates were inoculated with CMV at an input of 100 pfu (plaque forming units) per well. After a 1–2 h incubation period, residual virus was removed and the infected cells were further incubated with MEM (supplemented with 2% inactivated FCS, 2 mM L-glutamine and 0.3% NaHCO3) containing various concentrations of the test compounds. Antiviral activity was expressed as EC50 (50% effective concentration), or compound concentration required to reduce virus-induced cytopathicity by 50% after 7 days as compared with the untreated control. The 50% cytostatic concentration (CC50) was defined as the compound concentration required to reduce the cell growth by 50% after an incubation period of 3 days. The cell number was determined using a Coulter counter (model ZB; Coulter Electronics Ltd, Harpenden, Hertfordshire, England). The minimal cytotoxic concentration (MCC) was defined as the compound concentration that showed a microscopically visible alteration of normal cell morphology in the antiviral activity assays.

TNF-{alpha} quantification assay

The latently HIV-1-infected cell lines OM-10.1 and U1 were stimulated with 0.02 µM PMA and cultured in the presence of various concentrations of the test compounds. After a 24 h incubation period at 37°C, the cell culture supernatants were collected and examined for their TNF-{alpha} concentrations with the TNF-{alpha} ELISA kit (Roche Diagnostics Belgium).23

Quantitative real-time PCR

The quantitative determination of HIV transcripts in latently HIV-1-infected cell lines OM-10.1 and U1 was assessed by real-time detection based on the TaqMan technology using the plasmid pLTR-Q as standard and pGAPDH-Q as internal control. Cells were seeded in 24-well plates at a density of 750 000 cells per well and were exposed to different concentrations of the compounds for 1 h. Then, 1 ng/mL TNF-{alpha} or 0.02 µM PMA was added to the cell cultures and further incubated overnight at 37°C. The next day, cells were collected and RNA was extracted using the TRIzol method (Invitrogen, Merelbeke, Belgium). The PCR reactions were performed in 96-well optical reaction plates with final volumes of 25 µL per well. The PCR reaction contained a 5 µL RNA sample that was added to a mixture of 12.5 µL of TaqMan one-step RT-PCR master mix, 1.25 µL of endogenous GAPDH control mixture, 600 nM of each primer LTR-F and LTR-R and 250 nM of the TaqMan LTR probe CCTCAATAAAGCTTGCCTTGAGTGCTTCAA with the reporter dye 6-carboxyfluorescein (FAM) at the 5'-end and the quencher dye 6-carboxytetramethylrhodamine (TAMRA) at the 3'-end. The real-time PCR reaction on the ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) was as follows: 30 min at 48°C for reverse transcription, 10 min at 95°C for enzyme activation, 45 cycles of amplification (15 s at 95°C and 1 min at 60°C each) with measurement of fluorescence at the end of each elongation step. All assays included two negative controls (water) and a dilution series of the plasmid pLTR-Q that contained a 105 bp fragment from the TAR region of HIV, as well as the endogenous control plasmid pGAPDH-Q containing the complete gene of human GAPDH. The detection of GAPDH RNA was conducted using a TaqMan Pre-Developed Assay Reagent containing a VIC/TAMRA-labelled TaqMan probe (Applied Biosystems, Foster City, CA, USA). The standard curve of the threshold cycle (CT) values was constructed for each PCR assay in order to automatically calculate the sample quantities using the software for data analysis.24 All samples were performed in duplicate.

Transactivation assays

Transactivation studies in HLtat cells were performed as described previously.25 Briefly, the HeLa-derived HLtat cells were transfected in 0.7 mL of medium with 8 µg of pHIV-GFPemd, pCMV-GFPemd or pEF-GFPemd plasmid DNA by electroporation with an Easyject One electroporator (Cell one, Belgium) in a 4 mm cuvette at 200 V, 1650 µF and infinite R. The electroporated cells (70 x 103/well) were incubated in 96-well microtitre plates for 24 h in the presence of various concentrations of the test compounds. Then, medium was removed by gentle aspiration, and the monolayers were washed with PBS. Inhibition of transactivation was measured with the Fluorocount (Packard) by quantification of GFP reporter gene activity at 24 h after transfection. The 50% inhibitory concentration (IC50) was calculated as the inhibitor concentration that reduced GFP expression by 50%. Cytotoxicity of the test compounds to the cells was determined in the same cell cultures by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide method. The experiments to determine the IC50 and CC50 values of the test compounds were performed in quadruplicate.

For Jurkattat transfection, 30 x 106 cells were resuspended in 400 µL of medium together with 40 µg of pHIV-GFPemd, pCMV-GFPemd or pEF-GFPemd plasmid DNA and electroporated in a 4 mm cuvette at 250 V, 1050 µF and infinite R. Then, electroporated cells were resuspended in 2.5 mL of fresh medium, and 100 µL of the obtained cell suspension was transferred to 96-well plates containing various concentrations of the test compounds and subsequently incubated for 24 h.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The 6-aminoquinolone derivatives inhibit HIV-1 replication in acutely and latently infected cells

The 6-aminoquinolone derivatives were examined for their inhibitory effects on acutely HIV-1-infected human primary M/M as well as in latently HIV-1-infected promyelocytic cells (OM-10.1) and latently HIV-1-infected promonocytic cells (U1). Upon TNF-{alpha} and PMA exposure, both latently HIV-1-infected cell lines showed a dramatic (~1000-fold) increase in HIV-1 expression, which was set as one hundred percent (Figure 1). In the presence of various concentrations of different quinolone derivatives, a dose-dependent inhibition of p24 production was observed from both cell lines. This inhibition was similar in both stimulation conditions and took place at compound concentrations far below cytotoxicity. For example, the most potent quinolone derivatives, WM-16 and WC-13, inhibited HIV production in OM-10.1 cell cultures by 50% (EC50) at a concentration of 0.010 µg/mL and 0.0056 µg/mL, respectively, when stimulated with TNF-{alpha}, while stimulation with PMA resulted in EC50 values of 0.0081 µg/mL and 0.0033 µg/mL, respectively. The 50% cytotoxic concentration (CC50) of WM-16 and WC-13 in OM-10.1 cells was about 1.25 µg/mL and 0.69 µg/mL, respectively, resulting in a selectivity index (CC50/EC50) of ~120–210 for both compounds (Figure 1a). For U1 cells, a similar concentration-dependent inhibition of virus production was observed for all compounds tested after TNF-{alpha} and PMA stimulation. Similar selectivity indices in the range of 100–200 were found in this cell line with either TNF-{alpha} or PMA stimulation (Figure 1b).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 1.. Inhibitory effect of 6-aminoquinolone derivatives on TNF-{alpha}- and PMA-induced expression of HIV-1 in (a) OM-10.1 and (b) U1 cells. The cells were incubated with the compounds for 2 h, stimulated with either 1 ng/mL TNF-{alpha} (grey bars) or 0.02 µM PMA (white bars) and further incubated for 48 h. Supernatants were then collected for p24 antigen quantification and the p24 levels are expressed as the percentage of control (no compound). Cell cultures were examined for cell viability (filled diamonds) using the MTT method after a 2 day incubation period. All experiments were carried out in quadruplicate, and results are presented as mean values with standard deviation.

 
Next, the three most potent 6-aminoquinolone derivatives were selected for analysis on TNF-{alpha} production from PMA-stimulated OM-10.1 and U1 cells (Figure 2). All three compounds WM-14, WM-16 and WC-13 displayed an inhibitory effect on the production of this cytokine from OM-10.1 cells at subtoxic concentrations, but allowed TNF-{alpha} production from U1 cells at all concentrations tested.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2.. Effect of 6-aminoquinolone derivatives WM-14 (black bars), WM-16 (grey bars) and WC-13 (white bars) on TNF-{alpha} production released upon stimulation of OM-10.1 and U1 cells with 0.02 µM PMA.

 
In order to examine the antiviral potential of WM-14, WM-16 and WC-13 in acutely HIV-infected cells, human primary M/M were isolated and exposed to various concentrations of the test compounds after infection with the HIV-1(BaL) strain. All three compounds proved inhibitory against HIV-1 replication in M/M with EC50 values of 0.06, 0.02 and 0.005 µg/mL, respectively (Figure 3). Complete suppression of the virus replication was found at concentrations as low as 0.31 µg/mL for WM-14, 0.078 µg/mL for WM-16 and 0.020 µg/mL for WC-13 (Figure 3).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3.. Inhibitory effect of 6-aminoquinolone derivatives WM-14 (black bars), WM-16 (grey bars) and WC-13 (white bars) on acutely HIV-1(BaL)-infected human primary M/M.

 
The 6-aminoquinolone derivatives inhibit the production of HIV transcripts in latently infected cells

Studies in PBMCs from HIV-infected individuals have shown that the HIV-1 LTR produces two distinct populations of transcripts, a set of short, prematurely terminated transcripts of about 60 nucleotides and a set of full-length HIV-1 transcripts. In the absence of Tat, the short abortive transcripts predominate, whereas in the presence of Tat, a dramatic increase in the levels of long transcripts is observed. Activation of the full-length transcripts by Tat is mediated by interaction with a secondary RNA stem loop structure TAR (transactivation responsive element) formed from the first 59 nucleotides of the RNA. As a result, the rate of transcriptional elongation beyond position +59 is increased by inducing hyperphosphorylation at the carboxy terminal domain of the RNA polymerase II. In order to investigate the effect of the 6-aminoquinolone derivatives on the production of full-length HIV-1 transcripts in TNF-{alpha}- and PMA-induced latently HIV-1-infected OM-10.1 and U1 cell lines, we performed an HIV-1 RNA quantification with the TaqMan technology directed to the TAR region from position +42 to position +147.7,26 As HIV-1 transcriptional elongation beyond position +59 is seen only in the presence of Tat,27 we could evaluate the inhibitory potential of the 6-aminoquinolone derivatives on this process.

The low amounts of HIV-1 transcripts quantified in unstimulated conditions were subtracted from all stimulated samples once all data were normalized using the quantification results obtained for the endogenous control GAPDH. We detected about 500-fold less HIV-1 transcripts in unstimulated conditions in both cell lines OM-10.1 and U1 as compared with the stimulated condition without addition of compound. The samples reflecting the stimulation condition without compound were expressed as one hundred percent and used as reference to investigate the effect of the compounds on HIV-1 transcriptional level in latently HIV-1-infected cells. All three compounds WM-14, WM-16 and WC-13 showed remarkable suppressive effects on HIV-1 transcription in OM-10.1 and U1 cells after stimulation with TNF-{alpha} and PMA at non-cytotoxic concentrations. The 50% inhibitory concentration (IC50) of WM-14, WM-16 and WC-13 in OM-10.1 cells was 0.055 µg/mL, 0.020 µg/mL and 0.009 µg/mL, respectively, after TNF-{alpha} stimulation, and 0.056 µg/mL, 0.016 µg/mL and 0.010 µg/mL, respectively, after PMA stimulation (Figure 4). These data correlated well with the p24 quantification data found for WM-14, WM-16 and WC-13 in OM-10.1 cells after stimulation with TNF-{alpha} and PMA. In U1 cells, a similar dose-dependent decrease in HIV-1 mRNA production was observed, similar to that for OM-10.1 cells, although this was slightly more pronounced for the PMA stimulation conditions compared with TNF-{alpha} exposure. These data were also in agreement with the p24 quantification data found for WM-14, WM-16 and WC-13 in TNF-{alpha}- and PMA-induced U1 cells.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4.. Inhibitory effect of 6-aminoquinolone derivatives on HIV-1 RNA transcription in latently HIV-1-infected OM-10.1 and U1 cell lines after stimulation with 1 ng/mL TNF-{alpha} (black bars) and 0.02 µM PMA (white bars). Total RNA was isolated from the cells by the TRIzol RNA extraction method. Quantification of total viral RNA was assessed by real-time PCR amplifying a 105 bp fragment of the TAR region using the TaqMan technology. In order to obtain the right HIV RNA amounts, correction was included using GAPDH as endogenous control. All experiments were carried out in quadruplicate, and results are presented as mean values with standard deviation.

 
Inhibitory effects of 6-aminoquinolone derivatives on human and murine CMV replication in HEL and C3H/3T3 cells

To further investigate the therapeutic potential of the 6-aminoquinolones, the compounds were evaluated for their anti-human CMV activity in HEL cell cultures (Table 2) and anti-murine CMV activity in C3H/3T3 cell cultures (Table 3). Interestingly, the compounds that were most active against HIV-1, namely WM-16 and WC-13, were also found to be the most potent inhibitors of replication of both human and murine CMV in cell culture. For example, WC-13 showed very potent activity against human CMV at a concentration that was ≥100-fold lower than the cytotoxic concentration in stationary HEL cells (i.e. the same condition as used for measuring the antiviral activity). However, the cytostatic activity of the two above mentioned compounds is at a lower concentration than the cytotoxic activity.


View this table:
[in this window]
[in a new window]
 
Table 2.. Antiviral activity and cytotoxicity of 6-aminoquinolone derivatives against human cytomegalovirus in human embryonic lung (HEL) cells

 

View this table:
[in this window]
[in a new window]
 
Table 3.. Antiviral activity and cytotoxicity of 6-aminoquinolone derivatives against murine cytomegalovirus in murine embryo fibroblast C3H/3T3 cells

 
Interference of 6-aminoquinolone derivatives with the GFP transactivation process mediated from the HIV-1 LTR promoter, the human CMV immediate early (IE) promoter and the human EF-1{alpha} promoter

We investigated the effect of 6-aminoquinolones on gene expression mediated from different transactivation systems. This was accomplished by linking GFP to the HIV-1 LTR promoter, the human CMV IE promoter and the human EF-1{alpha} promoter. The first two promoters represent strong viral promoters, whereas the human EF-1{alpha} promoter represents a strong cellular promoter that transcribes EF-1{alpha}, one of the most abundant proteins in eukaryotic cells, in almost all types of mammalian cells.28 As shown in Figure 5, the 6-aminoquinolone derivatives WM-14, WM-16 and WC-13 inhibited the Tat-mediated GFP gene expression from the HIV-1 LTR promoter in HLtat cells in a dose-dependent manner. When transfection was carried out with the two other constructs, a similar dose-dependent decrease could be observed, although less pronounced for WM-14. However, as demonstrated in Figure 5, GFP gene expression from the CMV IE promoter was variably affected depending on the cell line used. Indeed, in HLtat cells, a dose-dependent inhibition could be noted as found with the other two GFP-expressing constructs. In contrast, when transfection was performed in Jurkattat cells, the compounds WM-16 and WC-13 showed an induction of GFP expression mediated from the CMV IE promoter. Although this stimulatory effect was observed only at relatively high concentrations (2 and 4 µg/mL), lower compound concentrations afforded a slight inhibition. This effect could only be ascribed to the transactivation assay mediated from the CMV IE promoter, as the GFP gene expression from the two other promoters showed a dose-dependent inhibition as noted also for HLtat cells. In Jurkattat cells, WM-14 showed only a slight, if any, effect on GFP transactivation mediated from HIV-1 LTR, but dramatic stimulation when GFP expression was measured from the CMV IE promoter, or, to a minor extent, when determined from the human EF-1{alpha} promoter (Figure 5).



View larger version (72K):
[in this window]
[in a new window]
 
Figure 5.. Effect of 6-aminoquinolones on transactivation of a the GFP reporter gene transcribed from the human IV-1 LTR (black bars), the human CMV IE (grey bars) and the human EF-1{alpha} (white bars) promoters. HLtat and Jurkattat cells were transfected with the GFP-expressing constructs and incubated in the absence or presence of the compounds for 1 day. Quantification of GFP production was measured with the Fluorocount and expressed as the percentage of control. Cell viability (filled diamonds) was determined in the same cell cultures by the MTT method. All experiments were carried out in quadruplicate, and results are presented as mean values with standard deviation.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Transcription is an essential step in the replication cycle of HIV-1 that involves a complex interplay of viral and multiple cellular proteins.29 Several cellular factors are involved in the activation of HIV transcription resulting in the expression of Tat. The Tat protein subsequently interacts with a secondary RNA stem loop structure (TAR) transcribed from the LTR. As a result, the rate of transcriptional elongation is increased by inducing hyperphosphorylation at the carboxy terminal domain (CTD) of the RNA polymerase II. This crucial step in the Tat-mediated transactivation process is performed by the CTD kinase cdk9 subunit of p-TEFb.30 Human cyclin T1, as a component of p-TEFb together with cdk9, interacts directly with Tat and dramatically enhances its affinity for TAR RNA.31

Previously, it was shown that the 6-aminoquinolone derivative WM5 can inhibit Tat-mediated HIV-1 LTR-driven gene expression.14 In particular, WM5 binds with high affinity to the bulge of the TAR element, which results in inhibition of the Tat–TAR complex formation.15,16 These observations are in full agreement with our findings on the ability of different quinolone derivatives to mediate dose-dependent inhibition of the LTR-driven transactivation. The most potent 6-aminoquinolone derivatives, WM-16 and WC-13, inhibited HIV p24 production in OM-10.1 and U1 cells upon TNF-{alpha} or PMA stimulation with EC50 values in the range 0.002–0.01 µg/mL. Quantification of HIV transcripts in OM-10.1 and U1 cells with real-time PCR directed to the TAR region from position +42 to position +147 of viral mRNA, made it possible to evaluate the effect of the compounds on Tat-mediated transcriptional elongation. Upon stimulation with TNF-{alpha} or PMA, HIV transcripts increased about 500-fold. Both compounds, WM-16 and WC-13, caused dramatic inhibition of this transcription process, with IC50 values in the range 0.003–0.02 µg/mL. As clearly observed, these data correlated perfectly with the p24 quantification data found for both compounds. When the 6-aminoquinolone derivatives WM-16 and WC-13 were evaluated in a GFP transactivation assay, we observed dose-dependent inhibition of GFP gene expression mediated from the HIV-1 LTR promoter in HLtat cells. Surprisingly, as shown in the present study, this inhibitory potential was not restricted to inhibition of the transactivation process from the LTR promoter, but also applied to the transcription process mediated from other promoters. Using the human CMV IE and the human EF-1{alpha} promoter we found inhibition of transcription in HLtat cells that was at least as equally pronounced as observed for the HIV-1 LTR promoter. When the transactivation experiments were performed in Jurkattat cells, WM-16 and WC-13 proved inhibitory against the transactivation process mediated from the HIV-1 LTR and the EF-1{alpha} promoter, as observed with the HLtat cells. In contrast, the transcription of the GFP reporter gene from the CMV IE promoter was increased in a concentration-dependent manner in Jurkattat cells. Our observations indicate that the activity spectrum of the 6-aminoquinolones is not limited to the transactivation of HIV, but also extends to other viral and/or cellular transcription processes (i.e. those involved in CMV). In this way, we found that the inhibitory potential of the 6-aminoquinolone derivatives is not restricted to inhibition of Tat–TAR complex formation, but may also involve other cellular factors or secondary RNA structures as targets of inhibition. The fact that the 6-aminoquinolones not only interfere with the transactivation process mediated from two different viral promoters, but also with the gene expression mediated from a cellular promoter, not surprisingly revealed cell-dependent effects. For example, this effect was not only seen with the GFP transactivation experiments but could also be observed when TNF-{alpha} was quantified in the supernatants of PMA-stimulated OM-10.1 and U1 cells. We clearly observed an inhibitory effect on the production of this cytokine from OM-10.1 cells at subtoxic concentrations, whereas TNF-{alpha} production from U1 cells was allowed at all concentrations tested.

In conclusion, the transcription-inhibitory properties of the 6-aminoquinolone derivatives are not only restricted to a specific interaction with the Tat–TAR binding but are apparently much broader, thereby extending the activity spectrum of 6-aminoquinolone derivatives to viruses other than HIV, i.e. CMV. These broad-spectrum antiviral properties should be further explored in order to assess the potential of 6-aminoquinolone derivatives in the treatment of viral infections.


    Acknowledgements
 
We thank Mrs Lies Vandenheurck, Mr Steven Carmans and Mrs Stefanie Van Meensel for excellent technical assistance. These investigations were supported by grants from the Ministero dell'Università e della Ricerca (grant PRIN 2002 038878–004), the European commission (Credit No. QLRT 2000–00291, QLRT 2001–01311 and the Rene Descartes Prize 2001 No. HPAW-2002–90001), the Geconcerteerde Onderzoeksacties Vlaanderen (Project No. GOA-2005/19) and the Fonds voor Wetenschappelijk Onderzoek Vlaanderen (FWO Project No. G.0267.04).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1. Chun TW, Carruth L, Finzi D et al. Quantification of latent reservoirs and total body viral load in HIV-1 infection. Nature 1997; 387: 183–8.[CrossRef][Medline]

2. Chun TW, Stuyver L, Mizell SB et al. Presence of an inducible HIV-1 latent reservoir during highly active antiretroviral therapy. Proc Natl Acad Sci USA 1997; 94: 13193–7.[Abstract/Free Full Text]

3. Chun TW, Justement JS, Lempicki RA et al. Gene expression and viral production in latently infected, resting CD4+ T cells in viremic versus aviremic HIV-infected individuals. Proc Natl Acad Sci USA 2003; 100: 1908–13.[Abstract/Free Full Text]

4. Wong JK, Hezareh M, Günthard HF et al. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 1997; 278: 1291–5.[Abstract/Free Full Text]

5. Finzi D, Blankson J, Siliciano JD et al. Latent infection of CD4+ T cells provides a mechanism for lifelong persistence of HIV-1, even in patients on effective combination therapy. Nat Med 1999; 5: 512–17.[CrossRef][Web of Science][Medline]

6. Siliciano JD, Kajdas J, Finzi D et al. Long-term follow-up studies confirm the stability of the latent reservoir for HIV-1 in resting CD4+ T cells. Nat Med 2003; 9: 727–8.[CrossRef][Web of Science][Medline]

7. Lassen KG, Bailey JR, Siliciano RF. Analysis of human immunodeficiency virus type 1 transcriptional elongation in resting CD4+ T cells in vivo. J Virol 2004; 78: 9105–14.[Abstract/Free Full Text]

8. Lin X, Irwin D, Kanazawa S et al. Transcriptional profiles of latent human immunodeficiency virus in infected individuals: effects of Tat on the host and reservoir. J Virol 2003; 77: 8227–36.[Abstract/Free Full Text]

9. Andriole VT, ed. The Quinolones. London: Academic Press, 1988.

10. Baba M, Okamoto M, Makino M et al. Potent and selective inhibition of human immunodeficiency virus type 1 transcription by piperazinyloxoquinoline derivatives. Antimicrob Agents Chemother 1997; 41: 1250–5.[Abstract]

11. Baba M, Okamoto M, Kawamura M et al. Inhibition of human immunodeficiency virus type 1 replication and cytokine production by fluoroquinoline derivatives. Mol Pharmacol 1998; 53: 1097–1103.[Abstract/Free Full Text]

12. Kashiwase H, Momota K, Ohmine T et al. A new fluoroquinolone derivative exhibits inhibitory activity against human immunodeficiency virus type 1 replication. Chemotherapy 1999; 45: 48–55.[Web of Science][Medline]

13. Okamoto H, Cujec TP, Okamoto M et al. Inhibition of the RNA-dependent transactivation and replication of human immunodeficiency virus type 1 by a fluoroquinoline derivative K-37. Virology 2000; 272: 402–8.[CrossRef][Web of Science][Medline]

14. Parolin C, Gatto B, Del Vecchio C et al. New anti-human immunodeficiency virus type 1 6-aminoquinolones: mechanism of action. Antimicrob Agents Chemother 2003; 47: 889–96.[Abstract/Free Full Text]

15. Cecchetti V, Parolin C, Moro S et al. 6-Aminoquinolones as new potential anti-HIV agents. J Med Chem 2000; 43: 3799–3802.[CrossRef][Web of Science][Medline]

16. Richter S, Parolin C, Gatto B et al. Inhibition of human immunodeficiency virus type 1 Tat-trans-activation-responsive region interaction by an antiviral quinolone derivative. Antimicrob Agents Chemother 2004; 48: 1895–9.[Abstract/Free Full Text]

17. Tabarrini O, Stevens M, Cecchetti V et al. Structure modifications of 6-aminoquinolones with potent anti-HIV activity. J Med Chem 2004; 47: 5567–78.[CrossRef][Web of Science][Medline]

18. Daelemans D, De Clercq E, Vandamme AM. A quantitative GFP-based bioassay for the detection of HIV-1 Tat transactivation inhibitors. J Virol Methods 2001; 96: 183–8.[CrossRef][Web of Science][Medline]

19. Butera ST, Perez VL, Wu BY et al. Oscillation of the human immunodeficiency virus surface receptor is regulated by the state of viral activation in a CD4+ cell model of chronic infection. J Virol 1991; 65: 4645–53.[Abstract/Free Full Text]

20. Caputo A, Sodroski JG, Haseltine WA. Constitutive expression of HIV-1 Tat protein in human Jurkat T cells using a BK virus vector. J Acquir Immune Defic Syndr 1990; 3: 372–9.

21. Folks TM, Justement J, Kinter A et al. Cytokine-induced expression of HIV-1 in a chronically infected promonocyte cell line. Science 1987; 238: 800–2.[Abstract/Free Full Text]

22. Pauwels R, Balzarini J, Baba M et al. Rapid and automated tetrazolium-based colorimetric assay for the detection of anti-HIV compounds. J Virol Methods 1988; 20: 309–21.[CrossRef][Web of Science][Medline]

23. Poli G, Kinter A, Justement JS et al. Tumor necrosis factor {alpha} functions in an autocrine manner in the induction of human immunodeficiency virus expression. Proc Natl Acad Sci USA 1990; 87: 782–5.[Abstract/Free Full Text]

24. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 {Delta}{Delta}CT method. Methods 2001; 25: 402–8.[CrossRef][Web of Science][Medline]

25. Stevens M, Pannecouque C, De Clercq E et al. Novel human immunodeficiency virus (HIV) inhibitors that have a dual mode of anti-HIV action. Antimicrob Agents Chemother 2003; 47: 3109–16.[Abstract/Free Full Text]

26. Hermankova M, Siliciano JD, Zhou Y et al. Analysis of human immunodeficiency virus type 1 gene expression in latently infected resting CD4+ T lymphocytes in vivo. J Virol 2003; 77: 7383–92.[Abstract/Free Full Text]

27. Kao SY, Calman AF, Luciw PA et al. Anti-termination of transcription within the long terminal repeat of HIV-1 by tat gene product. Nature 1987; 330: 489–93.[CrossRef][Medline]

28. Uetsuki T, Naito A, Nagata S et al. Isolation and characterization of the human chromosomal gene for polypeptide chain elongation factor-1{alpha}. J Biol Chem 1989; 264: 5791–8.[Abstract/Free Full Text]

29. Karn J. Tackling Tat. J Mol Biol 1999; 293: 235–54.[CrossRef][Web of Science][Medline]

30. Kim YK, Bourgeois CF, Isel C et al. Phosphorylation of the RNA polymerase II carboxyl-terminal domain by CDK9 is directly responsible for human immunodeficiency virus type 1 Tat-activated transcriptional elongation. Mol Cell Biol 2002; 22: 4622–37.[Abstract/Free Full Text]

31. Wei P, Garber ME, Fang SM et al. A novel CDK9-associated C-type cyclin interacts directly with HIV-1 Tat and mediates its high-affinity, loop-specific binding to TAR RNA. Cell 1998; 92: 451–62.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
B. Mercorelli, G. Muratore, E. Sinigalia, O. Tabarrini, M. A. Biasolo, V. Cecchetti, G. Palu, and A. Loregian
A 6-Aminoquinolone Compound, WC5, with Potent and Selective Anti-Human Cytomegalovirus Activity
Antimicrob. Agents Chemother., January 1, 2009; 53(1): 312 - 315.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
M. Stevens, M. Pollicita, C. Pannecouque, E. Verbeken, O. Tabarrini, V. Cecchetti, S. Aquaro, C. F. Perno, A. Fravolini, E. De Clercq, et al.
Novel In Vivo Model for the Study of Human Immunodeficiency Virus Type 1 Transcription Inhibitors: Evaluation of New 6-Desfluoroquinolone Derivatives
Antimicrob. Agents Chemother., April 1, 2007; 51(4): 1407 - 1413.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
56/5/847    most recent
dki328v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Stevens, M.
Right arrow Articles by Pannecouque, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stevens, M.
Right arrow Articles by Pannecouque, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?