Skip Navigation


JAC Advance Access originally published online on September 26, 2005
Journal of Antimicrobial Chemotherapy 2005 56(5):836-840; doi:10.1093/jac/dki337
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
56/5/836    most recent
dki337v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Culebras, E.
Right arrow Articles by Picazo, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Culebras, E.
Right arrow Articles by Picazo, J. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Differences in the DNA sequence of the translational attenuator of several constitutively expressed erm(A) genes from clinical isolates of Streptococcus agalactiae

Esther Culebras*, Iciar Rodríguez-Avial, Carmen Betriu and Juan J. Picazo

Servicio de Microbiología, Hospital Clínico San Carlos, Plaza Cristo Rey s/n, Madrid, 28040, Spain


* Corresponding author. Tel: +34-91-3303269; Fax: +34-91-3303478; E-mail: eculebras.hcsc{at}salud.madrid.org

Received 16 May 2005; returned 11 June 2005; revised 8 August 2005; accepted 24 August 2005


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Objectives: To study the regulatory region of a constitutively expressed erm(A) gene in Streptococcus agalactiae clinical isolates.

Methods: Thirty clinical isolates of S. agalactiae which were cross-resistant to erythromycin and clindamycin and with a clindamycin MIC higher than that of erythromycin were studied by PCR, sequencing and molecular typing.

Results: PCR analysis revealed that all the strains harboured the erm(A) gene, either alone (26 isolates) or in combination with erm(B) (four isolates). Sequencing of the region upstream of erm(A) showed that all isolates possessed two types of genetic alteration. Most of the strains showed point mutations in the second leader peptide (mainly A137C) and, in four isolates (two clones), an insertion fragment with high homology to IS1381 and transposase genes was detected. Epidemiological analysis of strains indicated several clonal origins of isolates.

Conclusions: The mutations described here are thought to result in increased or constitutive expression of the erm(A) gene.

Keywords: clindamycin resistance , Group B streptococci , gene regulation


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Streptococcus agalactiae or group B Streptococcus (GBS) is emerging as a cause of serious infection worldwide. GBS is one of the pathogens most frequently responsible for peripartum maternal and neonatal infections.

Aminopenicillin is recommended as first-line chemoprophylaxis and erythromycin and clindamycin are the second-line choice of drug used in penicillin-hypersensitive patients.1 Whereas clinical isolates of S. agalactiae usually remain susceptible to penicillins, the rates of erythromycin resistance among GBS isolates have been increasing in recent years.2,3

Two principal mechanisms have been found to be responsible for acquired erythromycin resistance in S. agalactiae, namely target site modification and active efflux. Drug efflux, also referred to as the M phenotype, is encoded by the mef(A) gene and results in low-level resistance to erythromycin but not to clindamycin. Target site modification is mostly based on N6 dimethylation of an adenine residue (A2058) in the peptidyl transferase circle of 23S rRNA domain V through the action of a family of enzymes encoded by erm class genes. Methylation results in reduced binding and cross-resistance to macrolide, lincosamide and streptogramin B (MLS) antibiotics. It is well established that MLS resistance can be expressed either constitutively (cMLS phenotype) or by induction (iMLS phenotype) in streptococci and in S. agalactiae it is mediated by two classes of methylase genes, the conventional erm(B) and that which was recently described in S. pyogenes, erm(A).46 Information on the molecular basis of constitutive erm(A) gene expression is derived from studies of S. pyogenes strains which showed that changes in the sequence of the regulatory region of the methylase gene are associated with a constitutive phenotype. To our knowledge, there is no information available concerning S. agalactiae strains. However, S. agalactiae strains with phenotypes similar to S. pyogenes constitutively expressing erm(A) have also been reported.1,7 Our study analysed the regulatory region of a constitutively expressed, naturally occurring erm(A) gene from S. agalactiae clinical isolates with clindamycin MIC values higher than erythromycin MIC values.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bacterial strains

A total of 35 clinical isolates of erythromycin-resistant S. agalactiae were studied. Of these, 30 isolates were more resistant to clindamycin than to erythromycin. Isolates were obtained from skin and soft tissues (n = 13), urine (n = 10), vagina (n = 4) and various other sites (n = 8). Isolates were identified by a commercial latex agglutination technique (Slidex Strepto B; bioMérieux, Marcy L'Étoile, France).

Determination of macrolide resistance phenotype

The erythromycin–clindamycin double-disc test was carried out as described by Seppälä et al.8 Commercial discs (Oxoid Ltd, Basingstoke, UK) of erythromycin (15 µg) and clindamycin (2 µg) were used.

Susceptibility tests

Antimicrobial susceptibility testing was performed by the standard agar dilution method.9 Agar plates were incubated overnight at 37°C in ambient air. The following organisms were included as control strains: Streptococcus pneumoniae ATCC 49619 and Enterococcus faecalis ATCC 29212.

Antibiotics

Erythromycin and clindamycin were provided by Sigma Chemical Co. (St Louis, MO, USA). The other antibiotics were obtained as follows: clarithromycin (Abbott Laboratories, Abbott Park, IL, USA); azithromycin (Pfizer Inc., New York, NY, USA), josamycin (Ferrer Grupo, Barcelona, Spain), and telithromycin and quinupristin–dalfopristin (Aventis Pharma S.A., Madrid, Spain).

Detection of erythromycin resistance genes

The erm(B) and mef(A) genes were detected by PCR with the oligonucleotide primer pairs reported by Sutcliffe et al.10 The erm(A) gene was detected with primers designed by Seppälä et al.11 DNA preparation and amplification, and electrophoresis of PCR products were carried out by established procedures.1012 Briefly, PCR mixtures of 50 µL contained 1.5 mM, 2 mM, 4 mM MgCl2 [erm(A), erm(B) and mef(A), respectively], 20 pmol of each primer, 200 µM deoxynucleotides, 5 µL of Taq polymerase buffer, 2.5 U of Taq polymerase and 300 ng of DNA template. A total of 35 cycles was performed with denaturation at 94°C for 1 min, annealing at 42°C [erm(A)] or 51°C [erm(B) and mef(A)] for 1 min and extension at 72°C for 1 min. PCR products were resolved by electrophoresis on 1.5% agarose gels.

Analysis of the regulatory regions of erm(A)

The sequences of the erm attenuator were amplified from bacterial DNA by PCR as described by Fines et al.13 PCR products were resolved by electrophoresis on 1.5% agarose gels; the expected size was 340 bp. PCR products were then purified on UltraClean PCR Clean-up columns (MO BIO Laboratories Inc., Solana Beach, CA, USA) and sequenced on an ABI PRISM 310 automated sequencer (Applied Biosystems, Foster City, CA, USA).

Typing methods

Epidemiological relatedness of all isolates was studied by randomly amplified polymorphic DNA (RAPD) as described elsewhere.12,14 Molecular typing was performed at least twice on each isolate with two different primers (M13: TTATGTAAAAACGACGGCCAGT and H2: CCTCCCGCCACC) and Ready-To-Go Analysis Beads (Pharmacia Biotech, Piscataway, NJ, USA). Fifty nanograms of purified DNA was used per assay. After agarose gel electrophoresis, the gel was stained with ethidium bromide and visualized under UV light. Fingerprint patterns were photographed and compared visually. Strains showing identical profiles were considered to be clonal.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Identification of macrolide resistance phenotypes

On the basis of the erythromycin/clindamycin double disc test, four strains were assigned to the M phenotype, one (HCSC 1134) was assigned to the iMLS phenotype, and 30 were assigned to the cMLS phenotype (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1.. Summary of phenotypic and genotypic characteristics and changes in the attenuator erm(A) of S. agalactiae clinical isolates

 
The MICs of two 14-membered (erythromycin and clarithromycin), one 15-membered (azithromycin), and one 16-membered (josamycin) macrolide, clindamycin, the ketolide telithromycin and quinupristin–dalfopristin were determined and compared (Table 1). Homogeneous susceptibility patterns were observed for isolates of the cMLS phenotype in all but one of the strains (HCSC 407). This pattern of resistance to MLS antibiotics was characterized by high resistance to clindamycin (range 16–>256 mg/L) and low resistance to erythromycin (range 1–16 mg/L). MICs for clarithromycin ranged from 2 to 32 mg/L, for azithromycin from 1 to 128 mg/L, and for josamycin from 2 to 64 mg/L. All isolates were susceptible to telithromycin and quinupristin–dalfopristin (Table 1).

Erythromycin resistance genes

The presence of the erythromycin resistance genes erm(B), erm(A) and mef(A) in the MLS-resistant strains was investigated primarily by PCR. The erm(B) gene was detected in four strains [always associated with the erm(A) gene], and the mef(A) gene was detected in all strains with the M-resistant phenotype.

The situation was initially less clear for the erm(A) gene. With the primer pair described by Seppälä et al.,11 an amplicon of the expected size was detected in 27 strains (26 cMLSB and one iMLSB), whereas in four isolates, a longer amplicon was obtained. Attenuators of erm(A) were amplified by PCR with a specific primer13 in all erm(A)-positive isolates and similar results were found. One of the amplification products obtained from 27 isolates was of the expected size (340 bp) and another amplicon from four isolates was larger than expected (1204 bp). The overall results of the distribution of erythromycin resistance genes among the S. agalactiae test strains are summarized in Table 1.

Analysis of the regulatory regions of erm(A)

Attenuators of the erm(A) region of S. agalactiae HCSC 1134 and of 30 isolates with a clindamycin MIC higher than that of erythromycin were purified and sequenced. The erm(A) attenuator sequence of HCSC 1134 showed 100% identity with the corresponding previously determined sequence.11 All the other isolates showed alterations in the upstream region of the gene. Most of the changes were in the ORF of the second leader peptide (LP2) in the erm(A) attenuator. The four isolates with a longer amplicon carried an insertion in position 90 of LP2. Sequencing of the insertion fragment showed 98% identity with SAG2002,15 and with several other insertion sequences, IS1381 and the transposase gene (GenBank access numbers: AE014282 [GenBank] , AE014262 [GenBank] , AE014258 [GenBank] , AE014236 [GenBank] , AE014216 [GenBank] , AE014203 [GenBank] , AF367974 [GenBank] , AY598359 [GenBank] , AF064785 [GenBank] ). Strains with longer amplicons had an identical 864 bp insertion. The sequence flanking the point of insertion was duplicated to form two repeats in the same orientation at the ends of the transposon (Figure 1). With the exception of strain HCSC636, all the other clindamycin-resistant mutants showed an A137C (Q15P) mutation. Several additional mutations appear in most of the isolates (Table 1).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1.. Mutation detected in erm(A) attenuator in S. agalactiae under study. (a) mRNA of the attenuator of erm(A). Inverted repeats (IR) are numbered from 1 to 6. RBS1 and RBS2, ribosome-binding sites for leader peptides 1 and 2 (LP1 and LP2), respectively; RBS3, ribosome-binding site for Erm(A) methylase. Nucleotides composing the RBS are underlined. ORFs of LP1, LP2 and erm(A) are in bold. Nucleotides changed in different isolates are in shaded boxes. Sequence duplicated is in italics. (b) Point of insertion and sequence surrounding it. Duplications are in italics. RBS2, ribosome-binding sites for leader peptide 2. ORF of LP2 is in bold.

 
Clonal relationship of clindamycin-resistant mutants

A total of 19 different RAPD patterns were observed among the 35 isolates under study. Three of the four isolates with an insertion in the attenuator region shared the same clonal pattern. Thirteen different RAPD patterns were observed among the other isolates with an MIC to clindamycin higher than that of erythromycin. One profile appeared in nine isolates, a different profile appeared in four isolates and two different profiles appeared in two isolates each. All of the remaining nine isolates had individual patterns. Isolates with the M phenotype also showed four different RAPD patterns.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The attenuator region of the erm group has been studied in several bacterial groups,13,16,17 but not in S. agalactiae. In all previous studies, several deletion, insertion and point mutations are responsible for constitutive expression of erm-type genes.

Regulation of erm(A) by structural alterations in the translational attenuator was first found in Staphylococcus aureus.18 The structural alterations observed included deletions, different tandem duplications, and point mutation as well as insertion. Since then, similar results have been obtained with S. intermedius,17 S. pneumoniae19 and S. pyogenes.20 All the alterations observed either completely prevented the formation of mRNA secondary structures in the erm(A) regulatory region or favoured the formation of those mRNA secondary structures that allowed translation of the erm(A) transcripts.

In our study, we selected S. agalactiae clinical isolates with clindamycin MICs higher than those of erythromycin. This phenomenon has been detected previously by our group,12 and by other authors,1,7 and in all cases, the strains carried the erm(A) gene.

The attenuator of erm(A) has been studied in S. pyogenes and it is known to contain two ORFs, each preceded by a ribosome-binding site (RBS) which could encode two leader peptides, LP1 and LP2, with 15 and 19 amino acids, respectively. In addition, the mRNA sequence contains a series of inverted repeats that could form stem–loop structures that sequester the RBS and the initiation codons of the methylase gene.13 Destabilization of the stem–loop would lead to the translation of the erm(A) gene. Thus, mutations in the gene attenuator might be responsible for constitutive expression of methylase.

A comparison of sequences between one of our inducible erm(A) strains and 30 clindamycin-resistant isolates showed that all constitutive strains possessed mutations in the attenuator region. The most frequent change occurred in position 137, as has been described in some S. pyogenes strains.21 This change has been proven to be enough to decrease the stability of the stem–loop and allow constitutive expression of the methylase gene. Even so, some other mutations have been detected.

The presence of IS1381 and transposase gene in two strains indicated that the attenuator region is susceptible to this type of alteration. The sequence of serotype V, S. agalactiae strain 2603V/R, identified several of these mobile genetic elements located elsewhere in its genome.15 This kind of sequence is also identified in other group B streptococci.22 The possibility of inserting mobile elements in the attenuator region and distribution of these elements in the genome of streptococci gives cause for concern.

Molecular typing of our GBS indicated that attenuator changes are not unusual, because most of the S. agalactiae studied are not related to each other. The number of clonal origins, types of mutation and frequency of IS1381 elements have to be taken into account as factors which contributed to selection of constitutively resistant derivatives.

Studies developed with S. pyogenes revealed that constitutive mutants could be selected on agar medium containing clindamycin. No data are yet available for S. agalactiae strains but similarities between the two species have led us to suppose that clindamycin may be responsible for some genetic alterations. Therefore the use of clindamycin to treat infections caused by streptococci strains harbouring an inducible erm(A) gene should be discouraged. It would be necessary to check the role of some other macrolide–lincosamide–streptogramin compounds as inducers of erm(A) promoter alterations.


    Acknowledgements
 
This work was supported by grant FIS PI0 20037 from the Fondo de Investigación Sanitaria, Madrid, Spain and by the Red Respira C03/11 (Red Temática de Investigación Cooperativa del FIS).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1. Schrag S, Gorwitz R, Fultz-Butts K et al. Prevention of perinatal group B streptococcal disease. Revised guidelines from CDC. MMWR Recomm Rep 2002; 51: 1–22.[Medline]

2. Betriu C, Culebras E, Gomez M et al. Erythromycin and clindamycin resistance and telithromycin susceptibility in Streptococcus agalactiae. Antimicrob Agents Chemother 2003; 47: 1112–4.[Abstract/Free Full Text]

3. Murdoch DR, Reller LB. Antimicrobial susceptibility of group B streptococci isolated from patients with invasive disease: 10-years perspective. Antimicrob Agents Chemother 2001; 45: 1040–4.

4. Giovanetti E, Brenciani A, Burioni R et al. A novel efflux system in inducible erythromycin-resistant strains of Streptococcus pyogenes. Antimicrob Agents Chemother 2002; 46: 3750–5.[Abstract/Free Full Text]

5. Leclercq R. Mechanisms of resistance to macrolides and lincosamides: nature of the resistance elements and their clinical implications. Clin Infect Dis 2002; 34: 482–92.[CrossRef][ISI][Medline]

6. Roberts MC, Sutcliffe J, Courvalin P et al. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrob Agents Chemother 1999; 43: 2823–30.[Free Full Text]

7. Fitoussi F, Loukil C, Gros I et al. Mechanisms of macrolide resistance in clinical group B Streptococci isolated in France. Antimicrob Agents Chemother 2001; 45: 1889–91.[Abstract/Free Full Text]

8. Seppälä H, Nissinen A, Yu Q et al. Three different phenotypes of erythromycin-resistant Streptococcus pyogenes in Finland. J Antimicrob Chemother 1993; 32: 885–91.[Free Full Text]

9. National Committee for Clinical Laboratory Standards. Methods for Dilution Antimicrobial Susceptibility Test for Bacteria that Grow AerobicallySixth Edition: Approved Standard M7-A6. NCCLS, Wayne, PA, USA.

10. Sutcliffe J, Grebe T, Tait-Kamradt A et al. Detection of erythromycin-resistant determinants by PCR. Antimicrob Agents Chemother 1996; 40: 2562–6.[Abstract]

11. Seppälä H, Skurnik M, Soini H et al. A novel erythromycin resistance methylase gene (ermTR) in Streptococcus pyogenes. Antimicrob Agents Chemother 1998; 42: 257–62.[Abstract/Free Full Text]

12. Culebras E, Rodríguez-Avial I, Betriu C et al. Macrolide and tetracycline resistance and molecular relationships of clinical strains of Streptococcus agalactiae. Antimicrob Agents Chemother 2002; 46: 1574–6.

13. Fines M, Gueudin M, Ramon A et al. In vitro selection of resistance to clindamycin related to alterations in the attenuator of the erm(TR) gene of Streptococcus pyogenes UCN1 inducibly resistant to erythromycin. J Antimicrob Chemother 2001; 48: 411–6.[Abstract/Free Full Text]

14. Seppälä H, He Q, Österblad M et al. Typing of group A streptococci by random amplified polymorphic DNA analysis. J Clin Microbiol 1994; 32: 1945–8.[Abstract/Free Full Text]

15. Tettelin H, Masignani V, Cieslewicz MJ et al. Complete genome sequence and comparative genomic analysis of an emerging human pathogen, serotype V Streptococcus agalactiae. Proc Natl Acad Sci USA 2002; 99: 12391–6.[Abstract/Free Full Text]

16. Rosato A, Vicarini H, Leclercq R. Inducible or constitutive expression of resistance in clinical isolates of streptococci and enterococci cross-resistant to erythromycin and lincomycin. J Antimicrob Chemother 1999; 43: 559–62.[Abstract/Free Full Text]

17. Werckenthin C, Schwarz S. Molecular analysis of the translational attenuator of a constitutively expressed erm(A) gene from Staphylococcus intermedius. J Antimicrob Chemother 2000; 46: 785–8.[Abstract/Free Full Text]

18. Murphy E. Nucleotide sequence of ermA, a macrolide-lincosamide-streptogramin B determinant in Staphylococcus aureus. J Bacteriol 1985; 162: 633–40.[Abstract/Free Full Text]

19. Walsh F, Willcock J, Amyes S. High-level telithromycin resistance in laboratory-generated mutants of Streptococcus pneumoniae. J Antimicrob Chemother 2003; 52: 345–53.[Abstract/Free Full Text]

20. Doktor SZ, Shortridge V. Differences in the DNA sequences in the upstream attenuator region of erm(A) in clinical isolates of Streptococcus pyogenes and their correlation with macrolide/lincosamide resistance. Antimicrob Agents Chemother 2005; 49: 3070–2.[Abstract/Free Full Text]

21. Malhotra-Kumar S, Mazzariol A, Lammens C et al. Unusual resistance patterns related to alterations in the erm(A) attenuator in macrolide-resistant (MAC-R) Streptococcus pyogenes (SPY). In: Programs and Abstracts of the Forty-Fourth Interscience Conference on Antimicrobial Agents and Chemotherapy, Washington, 2004. Abstract C1-411, p. 68. American Society for Microbiology, Washington, DC, USA.

22. Tamura GS, Herndon M, Przekwas J et al. Analysis of restriction fragment length polymorphisms of the insertion sequence IS1381 in group B Streptococci. J Infect Dis 2000; 181: 364–8.[CrossRef][ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Clin. Microbiol.Home page
A. Sigge, M. Schmid, S. Mauerer, and B. Spellerberg
Heterogeneity of Hemolysin Expression during Neonatal Streptococcus agalactiae Sepsis
J. Clin. Microbiol., February 1, 2008; 46(2): 807 - 809.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
56/5/836    most recent
dki337v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Culebras, E.
Right arrow Articles by Picazo, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Culebras, E.
Right arrow Articles by Picazo, J. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?