JAC Advance Access originally published online on August 26, 2005
Journal of Antimicrobial Chemotherapy 2005 56(4):793-794; doi:10.1093/jac/dki290
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Correspondence |
Development of a real-time PCR assay on the Roche Light-Cycler for the detection of erm and mef erythromycin resistance genes in ß-haemolytic streptococci
1 Department of Microbiology, Health Protection Agency London, King's College Hospital, Denmark Hill, London SE5 9RS, UK; 2 South London Specialist Virology Centre, Health Protection Agency London, King's College Hospital (Dulwich Site), London SE22 8QF, UK
* Corresponding author. Tel: +44-20-8693-3005; Fax: +44-20-7346-6477; E-mail: Melvyn.Smith{at}kingsch.nhs.uk
Keywords: PCR , erythromycin , Streptococcus spp.
Sir,
Although erythromycin resistance in streptococci is predominantly due to target site modification by rRNA methylases (encoded by erm genes) or drug efflux (encoded by mef genes), novel resistance mechanisms continue to emerge.1 Furthermore, susceptibility to macrolides, lincosamides, streptogramins and ketolides varies depending on the distribution of different erythromycin resistance mechanisms.1 Therefore, phenotypic and genotypic erythromycin resistance surveillance data are required as an adjunct in determining therapy for streptococcal infections. In the UK, erythromycin resistance in Lancefield group B (GBS), C (GCS) and G (GGS) streptococci is increasing, but data on the molecular basis of resistance are limited.2
PCR with agarose gel analysis3 or microwell-format probe hybridization4 can be used to detect erm and mef genes; however, both require additional handling steps and gel analysis lacks the specificity of sequencing or hybridization analyses. Real-time PCR has the dual benefits of rapid amplification and specific detection, occurring simultaneously in the same tube, reducing the risks of contamination.
The aim of this study was to develop a real-time PCR assay to detect both erm and mef genes and characterize erythromycin resistance genes in GBS, GCS and GGS isolated from clinical samples. This approach has not been used before in detecting erm and/or mef genes in streptococci.
Positive control strains containing erm and mef genes used were: 02C1064 [Streptococcus pyogenes, mef(A/E)]; 02C1110 [S. pyogenes, erm(A) subclass erm(TR)]; RN1389 [Staphylococcus aureus, erm(A)]; JH2-2 [Enterococcus faecalis, erm(B)] and RN4220 [S. aureus, erm(C)]. Sixty-one erythromycin-resistant streptococci (14 GBS, four GCS and 43 GGS) collected from patients with community-acquired infections at two different hospitals during two different 6 month periods were also tested.
Standard disc testing was used to determine antibiotic susceptibility and erythromycin resistance phenotypes. DNA from test samples was prepared by both Qiagen extraction and rapid boiling. As the efficiencies of the two methods were comparable, the rapid boiling method was used throughout. Primers were as published for erm(A), erm(B), erm(C), mef(A/E)5 and erm(TR).4 Donor and acceptor probe-pairs were designed for erm(A), erm(TR), erm(B), erm(C) and mef(A/E) respectively: ERMADP1, CTGCAACGAGCTTTGGGTTTACTA and ERMAAP1, AATGGTGGAGATGGATATAAAAATGC; DF-ERMA1, GTCAAGCGAAATATAGCTACCTT and DR-ERMA1, TGTAGAGAGGGGATTTGCTA; ERMA/MD1, CGTGTCACTTTAATTCACCAAGAT and ERMA/MA1, TCTACAGTTTCAATTCCCTAACAAA; ERM/CD1, GTATGGTTCCAAGAGAATAT and ERM/CA1, TCATCCTAAACCTAAAGTGAA; MEFA/ED1, TATCCGTAGCATTGGAACAGCT and MEFA/EA1, TTCATACCCCAGCACTCAATGCGGT. All donor probes were 3' end-labelled with fluorescein. Acceptor probes specific for erm(A), erm(B), erm(C) and erm(TR) were 5' end-labelled with LC Red 640; for mef (A/E), LC Red 705. Each acceptor probe had a 3'-phosphate blocking group.
Each 20 µL PCR mixture consisted of: 2 µL of FastStart DNA Master Hybridisation Probes (Roche Applied Sciences), 1.6 µL of 25 mM MgCl2, 50 pmol of primers, 10 pmol of each probe pair, 8.4 µL of (PCR standard) water and 5 µL of bacterial DNA preparation. Two negative controls (PCR standard water and an erythromycin-sensitive GBS) were included in each run. Cycling conditions were: 95°C for 10 min, temperature transition rate (TTR) 20°C/s; 60 cycles 95°C for 0 s, TTR 20°C/s, annealing at 60°C for 10 s, TTR 20°C/s, and 72°C for 15 s, TTR 2°C/s; followed by a melting curve of: 99°C for 15s, TTR 20°C/s, 40°C for 15s, TTR 0.2°C/s to 95°C with continuous fluorescent acquisition. Fluorescence was measured on channel F2 for probes labelled with LC Red 640 and channel F3 for the LC Red 705-labelled probe.
Clinical isolates were tested four times using primers and probes specific for either mef(A/E), erm(A), erm(TR) or erm(B) genes. The erm(C) gene was not sought as its presence has only been reported in staphylococci.
Figure 1 shows the characteristic melting peaks for the positive controls; similar peaks were produced by the clinical isolates. erm(TR) and erm(B) were detected as the only erythromycin resistance genes in 41 (67%) and five (8%), respectively, of clinical strains with the MLSB phenotype. All strains with the M-phenotype contained mef(A/E) only, while among those with the MLSB phenotype, seven (11%) possessed double mechanisms of resistance: erm(TR) + erm(B), erm(TR) + mef(A/E) or erm(B) + mef(A/E). Two (3%) clinical strains expressing MLSB phenotype were negative for erythromycin resistance genes. No isolate carried the erm(A) gene.
|
This assay, with the rapid boiling method for DNA extraction, provides results within 1 h of sample preparation. It is sensitive and specific, successfully identifying resistance genes in 97% of the erythromycin-resistant clinical strains of group B, C and G streptococci. With the increasing availability of Light-Cyclers, the assay can be used as a rapid tool for local, national and international surveillance of erythromycin resistance in streptococci, thereby guiding therapy.
In agreement with a previous study,6 we found erm(TR) to be the most frequent resistance gene. However, for definitive erythromycin resistance genotyping, isolates should be tested for the most common mef and erm genes, as more than one resistance gene may be present.4 Many of the existing PCR assays are multiplex,3,4 reducing the number of reactions required. The characteristic melting peaks detected in the different channels are being exploited in developing a multiplex assay, which will reduce further the turn-around time and cost.
References
1
Leclercq R, Courvalin P. Resistance to macrolides and related antibiotics in Streptococcus pneumoniae. Antimicrob Agents Chemother 2002; 46: 272734.
2 Health Protection Agency. CDR Weekly. Online. http://www.hpa.org.uk/cdr/PDFfiles/2004/cdr1604.pdf (March 2005, date last accessed).
3 Sutcliffe J, Grebe T, Tait-Kamradt A, Wondrack L. Detection of erythromycin-resistant determinants by PCR. Antimicrob Agents Chemother 1996; 40: 25626.[Abstract]
4
Farrell DJ, Morrissey I, Bakker S et al. Detection of macrolide resistance mechanisms in Streptococcus pneumoniae and Streptococcus pyogenes using multiplex rapid cycle PCR with microwell-format probe hybridisation. J Antimicrob Chemother 2001; 48: 5414.
5 King A, Bathgate T, Phillips I. Erythromycin susceptibility of viridans streptococci from normal throat flora of patients treated with azithromycin or clarithromycin. Clin Microbiol Infect 2000; 8: 8592.
6
Kataja J, Seppala H, Skurnik M et al. Different erythromycin resistance mechanisms in group C and group G streptococci. Antimicrob Agents Chemother 1998; 42: 14934.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
