JAC Advance Access originally published online on August 11, 2005
Journal of Antimicrobial Chemotherapy 2005 56(4):773-776; doi:10.1093/jac/dki281
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Global distribution of TEM-1 and ROB-1 ß-lactamases in Haemophilus influenzae
GR Micro Limited, 7–9 William Road, London NW1 3ER, UK
* Corresponding author. Tel: +44-20-73887320; Fax: +44-20-73887324; E-mail: D.Farrell{at}grmicro.co.uk
Received 12 April 2005; returned 19 May 2005; revised 30 June 2005; accepted 14 July 2005
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Objectives: To determine the global distribution of TEM-1 and ROB-1 ß-lactamases in Haemophilus influenzae isolated from patients with community-acquired respiratory tract infection during the first 4 years of the PROTEKT study (1999–2003). To investigate the activities of commonly used antibiotics against these isolates.
Methods: For 14 870 H. influenzae, MIC testing was performed using NCCLS broth microdilution methodology. For 2225 ß-lactamase-positive (BLP) H. influenzae, TEM-1 and ROB-1 genes were detected using a Taqman PCR method.
Results: ß-Lactamase positivity was 15.0% overall but varied greatly by country (<5% in several countries to 67.9% in Taiwan). Prevalences of TEM-1 and ROB-1 BLP H. influenzae were 93.7% and 4.6%, respectively, however almost all ROB-1 isolates were found in Canada, the USA and Mexico. ROB-1 isolates (n = 102) were less susceptible against cefaclor (29.4% versus 87.6%) and cefprozil (42.2% versus 91.9%) than TEM-1 (n = 2085) isolates. Differences in susceptibility rates for chloramphenicol, co-trimoxazole and tetracycline were also found between the two groups.
Conclusions: The ROB-1 ß-lactamase was found almost exclusively in North America and was more active against cefaclor and cefprozil than the TEM-1 ß-lactamase.
Keywords: surveillance , resistance genes , cefaclor , cefprozil
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Haemophilus influenzae is a major causative agent in community-acquired respiratory tract infections (CARTIs). Approximately 0–30% of isolates (average
15%) are ß-lactamase-positive (BLA+).1 The TEM-1 enzyme has been reported to be responsible in 90–95% of isolates and the ROB-1 enzyme in 5–10%, with isolates with both enzymes being reported rarely.2,3 ROB-1 isolates have been reported to be more resistant to cefaclor.3 Previous reports on the distribution of ß-lactamase genes have only contained data from Canada, Japan, Italy and the USA.2–5 Hence, global prevalence and distribution are unknown. The aim of this study was to determine the global distribution of ROB-1 and TEM-1 and to investigate any differences in in vitro antibacterial efficacy associated with each enzyme.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
A total of 137 centres in 38 countries contributed H. influenzae isolates to the PROTEKT (Prospective Resistant Organism Tracking and Epidemiology for the Ketolide Telithromycin) study during 1999–2003. Bacterial isolates were collected from patients with one of the following types of infection: pneumonia, acute bacterial exacerbation of chronic bronchitis, acute exacerbation of chronic obstructive airways disease, acute/chronic sinusitis, and acute/chronic otitis media.6
MICs were determined at a central reference laboratory (GR Micro Ltd, London, UK) using the NCCLS broth microdilution method.7 Breakpoints were established using Clinical Laboratory Standards Institute (CLSI) criteria.8 ß-Lactamase production was determined for isolates of H. influenzae using nitrocefin reagent as per the manufacturer's instructions (Oxoid Ltd, Basingstoke, UK).
Primers and probes for the ROB-1 and TEM-1 genes were designed using Primer Express software (Applied Biosystems, Warrington, UK). For ROB-1, oligonucleotides used were: primers MGROB31F 5'GCGCCTGTGCAACAATCA3' and MGROB87R 5'CAAATTCGCCAAAGTCTGTTGA3' and probe MGROB50T 5'VIC-CCACACAAGCCACCTT-MGB3'. For TEM-1, oligonucleotides used were: primers MGTEM35F 5'AAGTTGGCCGCAGTGTTATCA3' and MGTEM101R 5'ATGGCATGACAGTAAGAGAATTATGC3' and probe MGTEM56T 5'FAM-CTCATGGTTATGGCAGCAC-MGB3'. Amplification was performed as a duplex PCR in an ABI 2700 thermocycler (Applied Biosystems) using the following cycling parameters: 50°C for 2 min, 95°C for 10 min, and 30 cycles of 95°C for 15 s and 60°C for 1 min. Allelic discrimination was performed using an ABI PRISM 7000 Sequence Detection System (Applied Biosystems). In our laboratory, this methodology for large-scale gene detection has proven to be the most time efficient and cost-effective approach. In addition, no post-amplification manipulation of amplified material occurs minimizing laboratory and specimen contamination.
Statistical analysis was performed using the 
2 test and InStat software (GraphPad Software, Inc., San Diego, CA, USA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Of the 14 870 H. influenzae tested, 2225 (15.0%) were ß-lactamase-positive (Table 1). Of the 2225 (15.0%) ß-lactamase-positive H. influenzae, 2085 (93.7%) were positive for TEM-1, 102 (4.6%) for ROB-1, 27 (1.2%) for neither gene, 1 (0.04%) for both genes and 10 (0.45%) were not viable for further testing. The distribution of TEM-1 and ROB-1 genes varied widely from country to country (Table 1). ROB-1 was rarely found outside North America. In contrast, the prevalence of ROB-1 amongst ß-lactamase-positive H. influenzae was 31.6%, 13.2% and 9.2% in Mexico, USA and Canada, respectively.
|
A comparison of MIC results for various antimicrobials by ß-lactamase genotype revealed variability in the ROB-1 parameters between two cephalosporins, tetracycline, chloramphenicol and co-trimoxazole when compared with TEM-1 results (Table 2). Cefaclor and cefprozil had raised MIC50/MIC90s and lower susceptibility rates (P < 0.0001 for both) in ROB-1 isolates whilst cefuroxime, cefdinir, cefpodoxime and cefditoren parameters showed no significant changes. TEM-1 isolates were more resistant to chloramphenicol and tetracycline whilst, conversely, ROB-1 isolates were more resistant to co-trimoxazole.
|
A total of 40 isolates were ß-lactamase-negative and ampicillin-resistant (ampicillin MIC
4 mg/L) (BLNAR) whilst 222 were ß-lactamase-negative and ampicillin-intermediate (ampicillin MIC = 2 mg/L) (BLNAI). Twenty-three of the 40 BLNAR were isolated in Japan as were 176/222 BLNAI. Of the 262 BLNAI/BLNAR isolates, non-susceptibility rates were: cefaclor 50.4%, cefuroxime 26.0%, cefprozil 32.4%, cefdinir 56.1%, and amoxicillin/clavulanate 9.2% (57.5% in the 40 BLNAR). The overall prevalence of BLNAI/BLNAR increased from 0.6% in 1999–2000 to 3.0% in 2002/2003. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Overall, the prevalences of TEM-1 and ROB-1 ß-lactamases were similar to previous reports.2,3 However, the global distribution of these enzymes was highly variable with ROB-1 being found almost exclusively in North America—Canada (nine centres), USA (nine centres) and Mexico (six centres). Similar to previously reported results, the ROB-1 subpopulation showed increased cefaclor MIC parameters and resistance compared with TEM-1 isolates.2,3 MIC parameters were also increased for cefprozil but not for cefpodoxime, cefuroxime, cefdinir or cefditoren. Interestingly, TEM-1 isolates appeared more resistant to chloramphenicol and tetracycline while, conversely, ROB-1 isolates appeared more resistant to co-trimoxazole. Further studies are planned to investigate if this observation is due to clonal expansion.
As seen by the range of MICs in Table 2, many ROB-1 and TEM-1 isolates had high levels of resistance to cefaclor and cefprozil (up to >128 mg/L). It is unclear why such variation in MIC levels exists but a recent study showed that mutations in the controlling region of the TEM-1 ß-lactamase were associated with increased resistance to cefaclor.9 We plan to sequence the fts1 gene (which is the transpeptidase region of penicillin binding protein 3A and/or 3B) to determine whether the same or similar mutations are responsible here.
A total of 27 ß-lactamase-positive H. influenzae isolates were negative for both ROB-1 and TEM-1 genes suggesting either a mutation has occurred in either or both ROB-1 and TEM-1 gene(s) to prevent detection by our methodology, or a previously undescribed enzyme (or enzymes) is (are) responsible. Further research is needed to investigate this. Although the prevalence of BLNAR isolates was low overall, the high rate of BLNAR and particularly BLNAI found in Japan supports the previously reported high rate of BLNAR in this country.4 The observed trend of increasing BLNAI/BLNAR prevalence over the 4 years of the study warrants close monitoring as these isolates have high levels of non-susceptibility to the cephalosporins tested and amoxicillin/clavulanate. Of the non-ß-lactam antibiotics, telithromycin, azithromycin, and the fluoroquinolones tested (levofloxacin and ciprofloxacin), all demonstrated high in vitro activity against H. influenzae regardless of H. influenzae ß-lactamase status.
This is the first study to assess and provide baseline data on the global prevalence and distribution of ß-lactamases in H. influenzae. We have shown that the distribution of these enzymes is variable and have confirmed previous reports that in vitro susceptibility to cefaclor is decreased and demonstrated that susceptibility to cefprozil is also decreased. This study is being continued in current PROTEKT studies and is planned to continue in future years.
|
Acknowledgements |
|---|
We are grateful to our colleagues throughout the world for the supply of bacterial isolates as part of the PROTEKT study, the GR Micro PROTEKT team, and to sanofi-aventis for their financial support of the PROTEKT study.
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
1. Felmingham D, Gruneberg RN. The Alexander Project 1996–1997: latest susceptibility data from this international study of bacterial pathogens from community-acquired lower respiratory tract infections. J Antimicrob Chemother 2000; 45: 191–203.
2.
Scriver S, Walmsley S, Kau C et al. Determination of antimicrobial susceptibilities of Canadian isolates of Haemophilus influenzae and characterization of their ß-lactamases. Canadian Haemophilus Study Group. Antimicrob Agents Chemother 1994; 38: 1678–80.
3.
Karlowsky JA, Verma G, Zhanel GG et al. Presence of ROB-1 ß-lactamase correlates with cefaclor resistance among recent isolates of Haemophilus influenzae. J Antimicrob Chemother 2000; 45: 871–5.
4. Hasegawa K, Yamamoto K, Chiba N et al. Diversity of ampicillin-resistance genes in Haemophilus influenzae in Japan and the United States. Microb Drug Resist 2003; 9: 39–46.[Web of Science][Medline]
5.
Cerquetti M, Cardines R, Giufre M et al. Antimicrobial susceptibility of Haemophilus influenzae strains isolated from invasive disease in Italy. J Antimicrob Chemother 2004; 54: 1139–43.
6. Felmingham D. The need for antimicrobial resistance surveillance. J Antimicrob Chemother 2002; 50: 1–7.[Abstract]
7. National Committee for Clinical Laboratory Standards. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically—Sixth Edition: Approved Standard M7-A6. NCCLS, Wayne, PA, USA, 2003.
8. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing—Fifteenth Informational Supplement: CLSI Document M100-S15. CLSI, Wayne, PA, USA, 2005.
9. Molina JM, Cordoba J, Monsoliu A et al. Haemophilus influenzae and ß-lactam resistance: description of blaTEM gene deletion. Rev Esp Quimioter 2003; 16: 195–203.[Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  S. G. Tristram and J. G. Burdach Effect of cloned inhibitor-resistant TEM {beta}-lactamases on the susceptibility of Haemophilus influenzae to amoxicillin/clavulanate J. Antimicrob. Chemother., November 1, 2007; 60(5): 1151 - 1154. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. San Millan, J. A. Escudero, A. Catalan, S. Nieto, F. Farelo, M. Gibert, M. A. Moreno, L. Dominguez, and B. Gonzalez-Zorn {beta}-Lactam Resistance in Haemophilus parasuis Is Mediated by Plasmid pB1000 Bearing blaROB-1 Antimicrob. Agents Chemother., June 1, 2007; 51(6): 2260 - 2264. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Tristram, M. R. Jacobs, and P. C. Appelbaum Antimicrobial Resistance in Haemophilus influenzae Clin. Microbiol. Rev., April 1, 2007; 20(2): 368 - 389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Tristram and S. Nichols A multiplex PCR for {beta}-lactamase genes of Haemophilus influenzae and description of a new blaTEM promoter variant J. Antimicrob. Chemother., July 1, 2006; 58(1): 183 - 185. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||