Skip Navigation


JAC Advance Access originally published online on July 22, 2005
Journal of Antimicrobial Chemotherapy 2005 56(3):544-551; doi:10.1093/jac/dki255
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
56/3/544    most recent
dki255v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Enne, V. I.
Right arrow Articles by Bennett, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Enne, V. I.
Right arrow Articles by Bennett, P. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oupjournals.org

Assessment of the fitness impacts on Escherichia coli of acquisition of antibiotic resistance genes encoded by different types of genetic element

V. I. Enne1,*, A. A. Delsol2, G. R. Davis1, S. L. Hayward1, J. M. Roe2 and P. M. Bennett1

1 Bristol Centre for Antimicrobial Research, Department of Pathology and Microbiology, University of Bristol, Medical Sciences Building, University Walk, Bristol BS8 1TD, UK; 2 Division of Animal Health and Husbandry, Department of Clinical Veterinary Science, University of Bristol, Langford BS40 5DU, UK


* Corresponding author. Tel: +44-117-9287522; Fax: +44-117-9287896; E-mail: v.i.enne{at}bristol.ac.uk

Received 4 March 2005; returned 27 April 2005; revised 3 June 2005; accepted 23 June 2005


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Objectives: Little is known of the fitness cost that antibiotic resistance exerts on wild-type bacteria, especially in their natural environments. We therefore examined the fitness costs that several antibiotic resistance elements imposed on a wild-type Escherichia coli isolate, both in the laboratory and in a pig gut colonization model.

Methods: Plasmid R46, Tn1 and Tn7 and a K42R RpsL substitution were separately introduced into E. coli 345-2 RifC, a rifampicin-resistant derivative of a recent porcine isolate. The insertion site of Tn1 was determined by DNA sequencing. The fitness cost of each resistance element was assessed in vitro by pairwise growth competition and in vivo by regularly monitoring the recovery of strains from faeces for 21 days following oral inoculation of organic piglets. Each derivative of 345-2 RifC carrying a resistance element was grown in antibiotic-free broth for 200 generations and the experiments to assess fitness were repeated.

Results: RpsL K42R was found to impose a small fitness cost on E. coli 345-2 RifC in vitro but did not compromise survival in vivo. R46 imposed a cost both before and after laboratory passage in vitro, but only the pre-passage strain was at a disadvantage in vivo. The post-passage isolate had an advantage in pigs. Acquisition of Tn7 had no impact on the fitness of E. coli 345-2 RifC. Two derivatives containing Tn1 were isolated and, in both cases, the transposon inserted into the same cryptic chromosomal sequence. Acquisition of Tn1 improved fitness of E. coli 345-2 RifC in vitro and in vivo in the case of the first derivative, but in the case of a second, independent derivative, Tn1 had a neutral effect on fitness.

Conclusions: The fitness impact imposed on E. coli 345-2 RifC by carriage of antibiotic resistance elements was generally low or non-existent, suggesting that once established, resistance may be difficult to eliminate through reduction in prescribing alone.

Keywords: plasmids , transposons , fitness , antibiotic resistance


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
It is often assumed that in the absence of drug selection, acquisition and expression of antibiotic resistance will exert a fitness cost upon the bacterial host. Such a cost is believed to arise because resistance may compromise the cell's normal metabolic functions due to mutations in essential genes that encode antibiotic targets such as rpsL or rpoB and/or from the requirement for extra resources. Hence, it has been suggested that if selection pressure is removed, the incidence of resistance may decline as less-fit resistant bacteria are displaced by more competitive, antibiotic-susceptible bacteria.13 Most studies on the fitness cost of antibiotic resistance have concentrated on resistance achieved by mutation of chromosomal genes, such as streptomycin resistance achieved through rpsL mutation,46 rifampicin resistance achieved through mutation in rpoB79 and nalidixic acid resistance achieved through mutation in gyrA.4,10 In general, resistance acquired by chromosomal mutation has been shown to impose fitness costs both in vitro6,8,9 and in vivo,4,5,10 although in some cases, no-cost mutations have been identified.7,8 However, after a period of co-evolution, second-site compensatory mutations often arise that reduce or eliminate the initial fitness cost imposed by the resistance mutation.46,8,10

Fewer studies have examined fitness costs associated with acquired antibiotic resistance genes. Furthermore, most work addressing this question has been carried out in vitro, although one study measured the fitness cost of a vanA-coding plasmid upon Enterococcus faecium in gnotobiotic mice.11 In general, resistance plasmids have been shown to impose an initial fitness cost on their hosts.1115 However, work with pBR322,15 pACYC184,14 R112 and RP412 has shown that after a period of co-evolution, compensatory mutations can arise, with the plasmid-carrying host becoming fitter than its plasmid-free derivative. In the cases of pBR322 and pACYC184, such compensatory mutations were located on the host chromosome,14,15 whereas with R1 and RP4, adaptive genetic changes occurred both on the plasmids and the host chromosome.12

Relatively few studies have examined the fitness costs associated with acquisition of transposons encoding antibiotic resistance genes. The kanamycin-resistance transposon Tn5 has been shown to confer a selective advantage upon Escherichia coli.16 This advantage is due to presence of the bleomycin resistance gene ble,17 the product of which is able to prevent DNA breakage.18 In contrast, Tn10 acquisition was found to be associated with a fitness cost. This cost was approximately equal regardless of whether the transposon encoded tetracycline, chloramphenicol or kanamycin resistance and was thought to be due to insertion mutations.19 The fitness costs associated with transposon carriage have not been examined in vivo.

Studies that examine the fitness impact of naturally occurring resistance elements on wild-type bacteria are rare in the literature, as are studies that use in vivo models.1,3 Here, we examine changes in fitness resulting from acquisition of antibiotic resistance by a recent porcine E. coli isolate, both in vitro and in a pig gut model. The impact of streptomycin resistance conferred by mutation in rpsL; ampicillin, tetracycline, sulphonamide and streptomycin resistance conferred by the plasmid R46; ampicillin resistance conferred by the transposon Tn1 and trimethoprim resistance conferred by the transposon Tn7 on host fitness is examined. We also investigate whether evolution in the laboratory can reduce any fitness costs sustained.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Development of E. coli 345-2RifC study strain

The purpose of this work was to isolate a rifampicin-resistant derivative of a wild-type E. coli strain with good growth characteristics in both laboratory culture and in pigs, into which antibiotic resistance encoding elements could be introduced. A sample of pig faeces collected in October 2001 was homogenized and serial dilutions spread onto Chromogenic UTI agar (Oxoid). Colonies provisionally identified as E. coli were chosen at random for speciation using API-20E strips (bioMérieux). Twenty-five E. coli isolates were kept for further study. Disc susceptibility testing was then carried out for ampicillin, chloramphenicol, kanamycin, nalidixic acid, rifampicin, streptomycin, sulfamethoxazole, tetracycline and trimethoprim.20 E. coli isolates that were susceptible to all antibiotics tested were chosen for further study. The generation time of the isolates was determined by regularly measuring the OD600 of a nutrient broth culture, grown with shaking at 200 rpm at 37°C. Plasmid contents were determined by performing a plasmid extraction with the Qiaprep Spin miniprep kit (Qiagen) according to the manufacturer's instructions. Plasmids were visualized by UV illumination after gel electrophoresis on 1% agarose gels in Tris boric acid/EDTA buffer (pH 7.0) incorporating ethidium bromide. Based on these tests, three isolates, each of which were fully antibiotic-susceptible, carried no more than two plasmids and had a generation time in nutrient broth of no more than 27 min, were chosen for further study. Each isolate was grown overnight in nutrient broth and the resulting cultures spread onto nutrient agar containing 50 mg/L rifampicin.

Five rifampicin-resistant mutants were then randomly chosen per isolate. Each was then sub-cultured onto nutrient agar and stored at –80°C. Subsequently, each experiment was started with a fresh sub-culture from the frozen stock, in order to avoid excessive passage in the laboratory that may have generated further mutations in the isolates. The generation times of the mutants were determined in nutrient broth and minimal salts medium supplemented with 0.4% glucose (w/v). The three fastest growing mutants per strain were then chosen for further study. The fitness of each of the nine mutants was assessed by conducting a growth competition assay14 and an approximate measure of their transcription efficiency was determined by performing ß-galactosidase assays21 (Table 1). In order to identify the mutation in rpoB responsible for rifampicin resistance in individual mutants (Table 1), the first 2226 nucleotides of the rpoB gene were amplified by PCR using the primers RPOB1F 5'GACAGATGGGTCGACTTGTCAGCG3', RPOB1R 5'AGGTGGTCGATATCATCGACTT3',RPOB2F 5'TCGAAGGTTCCGGTATCCTGAGC3' and RPOB2R 5'GGATACATCTCGTCTTCGTTAAC3' in a standard PCR mixture using Extensor Hi-fidelity PCR master mix (Abgene). Template DNA was prepared by suspending one colony in 100 µL molecular biology grade water (Eppendorf) and boiling for 5 min. PCR amplification was carried out at 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, annealing for 1 min (60°C for RPOB1 primers and 57°C for RPOB2 primers) and 72°C for 1 min, followed by a final extension of 5 min at 72°C. PCR amplification products were visualized by agarose gel electrophoresis and purified using a Qiaquick PCR purification kit (Qiagen) according to manufacturer's instructions. They were sent for sequencing at the Advanced Biotechnology Centre, Imperial College, London, where sequencing was carried out on an ABI 3100 automated DNA sequencer using a BigDye terminator kit (Applied Biosystems). Sequence analysis was carried out using the Lasergene DNASTAR software package.


View this table:
[in this window]
[in a new window]
 
Table 1.. Characteristics of porcine E. coli strains 345-2, 345-8 and 343-9 and rifampicin-resistant mutants derived from them

 
Three mutants (345-2RifA, 345-2 RifC and 345-8RifC) were chosen, on the premises that they carried different rpoB mutations and their fitness did not appear to be markedly compromised by these mutations, based on the tests performed (Table 1). The three mutants were cultured overnight in nutrient broth, the OD600 of the cultures was determined and the three mutants then mixed in equal portions. They were then inoculated by oral gavage into three 7-week-old organic piglets using an inoculum of 1010 cfu per animal. (For further details of how animals were housed and sampled, please see following section.) After 2 weeks, samples of faeces from the piglets were plated onto MacConkey agar containing 50 mg/L rifampicin. Fifty colonies were selected and identified by API-20E testing and sequencing of the rpoB genes, as the three mutants had different biochemical profiles and/or rpoB mutations. The biochemical difference between E. coli 345-2 and E. coli 345-8 was that 345-2 was ornithine decarboxylase negative, while 345-8 was positive. The most commonly recovered mutant, E. coli 345-2 RifC, was chosen as the study strain.

Introduction of antibiotic resistance into E. coli 345-2 RifC

A variety of antibiotic resistance elements were separately introduced into E. coli 345-2 RifC. The plasmid R4622 was introduced by conjugation.23 Successful introduction of R46 into E. coli 345-2 RifC was confirmed by susceptibility testing using Etests according to manufacturer's instructions (AB Biodisk). A chromosomal mutation in rpsL conferring high-level streptomycin resistance was introduced as follows. E. coli 345-2 RifC was cultured overnight in nutrient broth and the cells in 10 mL of culture were pelleted by centrifugation. The pellet was suspended in 200 µL of nutrient broth and spread onto nutrient agar containing 1 g/L streptomycin. Following overnight incubation at 37°C, a single mutant was chosen at random. This mutant was then characterized by sequencing the rpsL gene after PCR amplification. The primers used were RPSLF 5'-CTCGCAAAGTTGCGAAAAGC-3' and RPSLR 5'-TTCACGCCATACTTGGAACG-3'. PCR amplification was carried out as described for the rpoB gene using an annealing temperature of 58°C. Purification of PCR products and sequencing was carried out as described.

To introduce Tn1 into 345-2 RifC, the plasmid pMR5, a temperature-sensitive variant of RP1,24 was transferred into 345-2 RifC by conjugation at 30°C.23 Four randomly chosen transconjugants were then incubated on Dorset egg agar slopes for 7 days to allow transposition to take place. Each culture was then inoculated into nutrient broth and incubated overnight at 42°C. The resulting cultures were then subcultured onto nutrient agar to obtain single colonies. Representative colonies were subjected to disc susceptibility testing20 in order to identify clones that retained ampicillin resistance but that had lost kanamycin and tetracycline resistance, an indication of Tn1 transposition and loss of the temperature-sensitive pMR5 plasmid carrying the aphA and tetA markers. Retention of Tn1 was confirmed by PCR for the blaTEM-2 gene using the primers TEMF 5'-ATGAGTATTCAACATTTCCG-3' and TEMR 5'-CCAATGCTTAATCAGTGACG-3' in a standard PCR using ReadyMix Taq PCR mixture (Sigma). DNA amplification was carried out as described for rpoB at an annealing temperature of 50°C. The insertion site of Tn1 was identified using a two-step random PCR technique,25,26 in which primers targeted to the 3' end of the known sequence are used in conjunction with random primers in order to obtain the adjacent unknown sequence. To obtain the Tn1 insertion site, the primers were initially targeted to the 3' extremity of Tn1 and the resulting PCR amplification products were sequenced. Successive cycles of primer design, random PCR and sequencing were undertaken, until a sequence of 4894 bp in length had been obtained. Similarity to known sequences and proteins was searched for using BLASTN and BLASTP. As the sequence obtained was novel, it was deposited in GenBank under the accession number AY925200 [GenBank] .

To introduce Tn727 into 345-2 RifC, a derivative of pMR524 carrying Tn7 was introduced into the strain by conjugation.23 The resulting transconjugant was then sub-cultured onto nutrient agar and grown overnight at 37°C. Individual colonies were inoculated into nutrient broth and allowed to grow overnight at 42°C. These cultures were then screened to identify isolates that had lost pMR5, but retained Tn7 by insertion into the chromosome, by disc susceptibility testing for kanamycin, tetracycline and trimethoprim.20 Tn7 is known to insert site-specifically into the E. coli chromosome, downstream from the glmS gene.28 The insertion site was verified by PCR using the primers GLMSF 5'-GCAAAATCGGTTACGGTTGA-3' anchored in the glmS gene and TN7R 5'-CGATATAGCTACCATTGAGTG-3' anchored in Tn7. DNA amplification by PCR was carried out as described above at an annealing temperature of 51°C and PCR products were then purified and sequenced.

Finally, susceptibility of all the constructed strains to antibiotics appropriate to their construction was determined by Etest (AB Biodisk).

Evolution of study strains

The various 345-2 RifC derivatives were passaged in the laboratory for 200 generations to allow host and resistance determinant to adapt to the other, if necessary. One colony of each constructed strain was inoculated into 100 mL of nutrient broth and grown at 37°C shaking at 170 rpm until stationary phase was reached. One millilitre of culture was then transferred into 100 mL of nutrient broth and grown as previously. The process of transfers was maintained until 200 generations had been reached. The retention of the introduced antibiotic resistance(s) in the culture was confirmed regularly by Etest.

Competition experiments to assay in vitro fitness

To assess the fitness impact of the antibiotic resistance elements upon E. coli 345-2 RifC, pair-wise growth competition in Davis minimal medium with 25 mg/mL glucose (DM25) was carried out using a modification of the method described previously.29 Briefly, E. coli 345-2 RifC and either pre- or post-passage 345-2 RifC containing a resistance element were cultured overnight in nutrient broth and then inoculated at a ratio of 1:104 into DM25. They were cultured separately for 72 h, during which time they were diluted at a 1:100 ratio into fresh DM25 every 24 h. The cultures were then mixed at a volumetric ratio of 1:1 and inoculated at a 1:100 dilution into DM25. After 24 h of growth, cultures were transferred at a ratio of 1:100 into fresh DM25. The experiment was continued for a total of six transfers. After the first 72 h period of growth and each subsequent 24 h period of growth, a sample of the culture was diluted appropriately and spread in triplicate onto Iso-Sensitest agar (Oxoid) and onto Iso-Sensitest agar containing the appropriate antibiotic. For the R46 plasmid, the agar contained ampicillin at 25 mg/L, for the rpsL mutation it contained streptomycin at 500 mg/L, for Tn1 it contained ampicillin at 25 mg/L and for Tn7 it contained trimethoprim at 25 mg/L. Six replicates of each competition experiment were performed. For each competition experiment, the percentage per generation fitness impact of each resistance element was determined as described previously.8,14

To estimate the degree of potential transfer of plasmid or transposon occurring during the competition experiment, a parallel experiment using a nalidixic acid-resistant derivative of E. coli 345-2 RifC instead of E. coli 345-2RifC was performed. The nalidixic acid-resistant derivative was obtained by spreading an overnight nutrient broth culture onto nutrient agar containing 200 mg/L nalidixic acid, and then choosing one of the resulting mutants at random. Donor and recipient strains were mixed and incubated as for a competition experiment. Samples of the undiluted culture were then taken periodically and spread onto Iso-Sensitest agar containing the appropriate antibiotic for the resistance element in question and 200 mg/L nalidixic acid. Any growth on these plates was assumed to be potential incidence of transfer of the plasmid or transposon from the nalidixic acid-susceptible, antibiotic resistance element-carrying competitor to the nalidixic acid-resistant, element-free 345-2 RifC. This experiment was not performed for the rpsL mutant, as resistance acquired by mutation is not transferable. The experimental design does not rule out the possibility that any colonies obtained may also represent spontaneous mutation nalidixic acid resistance by the resistance element-carrying competitor.

Animal experiments to screen for retention and fitness impact of resistance in vivo

For each experiment, six organic piglets from two litters of Saddleback-Duroc cross, weaned at 5 weeks of age, were housed as a single group for 2 weeks, to allow the animals to acclimatize to their surroundings. They were then randomly separated into two groups of three into pens with individual HEPA filtration and fed a standard organic feed (Organic Feed Company, grower/finisher pellets, UK) ad libitum. Prior to the start of the experiment, all animals were screened for the presence of rifampicin-resistant E. coli, by homogenizing 1 g of faeces in 9 mL of saline and plating 1 mL of each onto six MacConkey agar plates containing 50 mg/L rifampicin (detection limit, 2 cfu/g faeces). All procedures complied with the Animals (Scientific Procedures) Act 1986 and were performed under Home Office Licence.

All study strains (E. coli 345-2 RifC, and pre- and post-passage derivatives containing antibiotic resistance elements) were grown separately overnight in nutrient broth at 37°C with shaking at 170 rpm. The cells were collected by centrifugation and suspended in antacid solution composed of (g/L): MgCO3, 50 g; Mg2Si3O8, 50 g; NaHCO3, 50 g, then each strain was inoculated separately into the piglets as a single dose of 1010 cfu per animal by oral gavage. Faecal samples were collected from each animal by digital manipulation on days 3, 5, 7, 10, 12, 14, 17, 19 and 21 post-inoculation and analysed within 24 h. One gram of faeces was suspended in 9 mL of saline and plated at appropriate dilutions onto six MacConkey agar plates containing 50 mg/L rifampicin (detection limit 2 cfu/g). They were incubated overnight at 37°C and the colonies obtained replica plated onto MacConkey agar containing 50 mg/L rifampicin and the appropriate antibiotic for the antibiotic-resistant element under study (for R46, this was one plate containing 25 mg/L tetracycline and 25 mg/L ampicillin and one plate containing 500 mg/L sulfamethoxazole and 25 mg/L streptomycin; for rpsL mutation, this was 500 mg/L streptomycin, for Tn1 this was 25 mg/L ampicillin and for Tn7 this was 25 mg/L trimethoprim) followed by replica plating onto MacConkey agar with rifampicin only. Faeces were also plated onto MacConkey agar lacking antibiotics to monitor levels of rifampicin-susceptible coliforms.

When colonies that did not grow on the plates containing additional antibiotics were identified they were first re-streaked onto antibiotic-containing plates from the plates containing rifampicin only to ensure that replica plating errors had not occurred. Then the identity of the clone as E. coli 345-2 RifC was confirmed by biotyping using API20-E strips (bioMérieux). The susceptibility pattern of each isolate was then investigated by Etest.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Four different antibiotic resistance elements, the plasmid R46, an rpsL mutation and the transposons Tn1 and Tn7 were separately introduced into a rifampicin-resistant derivative of the wild-type study strain E. coli 345-2. Sequencing of the rpsL gene of the mutant revealed that the rpsL gene had sustained a single point mutation, resulting in the substitution of lysine at codon 42 with an arginine residue. The sequence 3' of the insertion site of Tn1 in the chromosome of the first derivative, E. coli 345-2RifC/Tn1A, was obtained but was found to be cryptic. It encodes a single open reading frame, at least 1420 amino acids in length, which appears interrupted by the insertion of the transposon as there was no obvious start codon. The putative protein encoded exhibits 42% similarity to a segment of the large repetitive protein of Salmonella enterica subsp. enterica serovar Typhi.30 The cryptic sequence led into a sequence that was 94% identical with a hypothetical open reading frame, located between the ybbD and ybbB genes on the chromosome of E. coli K12.31 A second independent derivative of 345-2 RifC, E. coli 345-2RifC/Tn1B, containing Tn1 was isolated and the transposon again inserted into the same segment of cryptic DNA. This time, the transposon was found to have inserted 2173 bp away from the first insertion site and in the opposite orientation.

Acquisition of the streptomycin resistance mutation RpsL K42R by E. coli 345-2 RifC imposed a small fitness cost in laboratory culture of –2.2 ± 0.9% per generation. This cost was not reduced following 200 generations of laboratory passage and was determined to be –3.6 ± 0.9% per generation for the post-passage isolate. However, no detectable cost was observed in vivo. The pre- and post-passage streptomycin-resistant strains, inoculated into animals as monocultures, were recovered at rates similar to that of the streptomycin-susceptible parent strain, with most animals still shedding the strain 3 weeks after inoculation (Figure 1). ANOVA analysis indicated there were no significant differences in the rate of recovery of the three strains (F = 0.54, P = 0.583). Differences in rates or recovery of up to 1000-fold between individual animals were noted, a fact that was true for all derivatives of E. coli 345-2RifC. Of a total of 23 025 colonies screened for retention of streptomycin resistance, only two, both of the pre-passage isolate, lost resistance to streptomycin. DNA sequencing of rpsL revealed that these were revertants at codon 42.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 1.. Recovery of E. coli 345-2RifC (triangles), pre-passage E. coli 345-2RifC/RpsL K42R (diamonds) and post-passage E. coli 345-2RifC/RpsL K42R (squares) from pig faeces following oral inoculation. As a result of variation between individual animals, standard deviations are large and for clarity, error bars have not been included but would be overlapping at all time points.

 
Experiments to monitor potential transfer of mobile elements in the in vitro competition assays indicated that no transfer of R46, Tn1 or Tn7 occurred during the assay.

Introduction of plasmid R46 into E. coli 345-2RifC imposed a small in vitro fitness cost of –3.3 ± 1.7% per generation. This cost was not reduced by laboratory passage in antibiotic-free medium, being calculated as –3.8 ± 1.6% per generation for the post-passage isolate. In the pig gut model, the pre-passage R46 strain was recovered at lower rates than the plasmid-free parent, while the post-passage strain was recovered at higher rates (Figure 2). ANOVA analysis, followed by the Tukey HSD test indicated that these results were statistically significant (F = 4.465, P = 0.013, Tukey P < 0.01). Of a total of 23 667 colonies screened, all retained the plasmid and expression of antibiotic resistance conferred by it, indicating that carriage of the plasmid is stable.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 2.. Recovery of E. coli 345-2RifC (triangles), pre-passage E. coli 345-2RifC/R46 (diamonds) and post-passage E. coli 345-2RifC/R46 (squares) from pig faeces following oral inoculation. As a result of variation between individual animals, standard deviations are large and for clarity, error bars have not been included.

 
Introduction of Tn1, to generate E. coli 345-2 RifC/Tn1A, had a positive effect on E. coli 345-2RifC with an in vitro fitness advantage of +6.0 ± 2.6% per generation recorded for the pre-passage strain and a +5.2 ± 4.6% advantage determined for the post-passage isolate. To test whether this advantage was a function of the insertion site or of the transposon itself, a second independent derivative containing Tn1, E. coli 345-2RifC/Tn1B was isolated. In this case, the Tn1 insertion had a neutral effect on fitness in vitro, measured as +0.2 ± 0.8% per generation. The second Tn1derivative was not passaged in the laboratory. In animals, the results obtained were similar to those obtained in vitro, with pre- and post-passage 345-2RifC/Tn1A being consistently recovered at higher rates than the parent, and 345-2RifC/Tn1B recovered at equivalent rates to the transposon-free parent (Figure 3). However, these differences were found not to be statistically significant (F = 1.38, P = 0.2499). All 33 848 colonies of the two Tn1 derivatives screened retained the transposon and expression of ampicillin resistance, indicating that carriage of the transposon is stable.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3.. Recovery of E. coli 345-2RifC (triangles), pre-passage E. coli 345-2RifC/Tn1A (diamonds) and post-passage E. coli 345-2RifC/Tn1A (squares) and 345-2RifC/Tn1B (circles) from pig faeces following oral inoculation. As a result of variation between individual animals, standard deviations are large and for clarity, error bars have not been included.

 
Carriage of the transposon Tn7 had no measurable effect on competitive fitness of E. coli 345-2 RifC in vitro. The fitness impact of Tn7 carriage on the strain was determined as +1.2 ± 1.2% per generation before laboratory passage and +0.8 ± 4.4% post-passage. In the porcine model, the results were similar, with no differences detected in the recovery rates of the three strains (Figure 4) (F = 2.25, P = 0.1087). Of 19 913 colonies screened, all retained Tn7 and the antibiotic resistances coded by it.



View larger version (9K):
[in this window]
[in a new window]
 
Figure 4.. Recovery of E. coli 345-2RifC (triangles), pre-passage E. coli 345-2RifC/Tn7 (diamonds) and post-passage E. coli 345-2RifC/Tn7 (squares) from pig faeces following oral inoculation. As a result of variation between individual animals, standard deviations are large and for clarity, error bars have not been included.

 
We also monitored the level of sensitive coliforms present in the pig's faeces. These were typically present at levels varying between 104 and 107 cfu/g of faeces. There appeared to be no correlation between the numbers of E. coli 345-2 RifC recovered and the quantity of other coliforms present.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In general, the fitness costs imposed on E. coli 345-2RifC by a variety of elements encoding antibiotic resistance were relatively low. All methods used to introduce resistance elements into the strain took advantage of naturally occurring phenomena such as conjugation and transposition. Use of artificial manipulation such as genetic engineering to introduce resistance into E. coli 345-2RifC was avoided, in order to maintain the system in as natural a state as possible. Most studies on the fitness costs of antibiotic resistance have reported higher costs.5,6,8,10,12,14 The fitness costs of rifampicin-resistance mutations in rpoB studied during preliminary experiments, were lower than those found by others. The mutation H526Y was found to have no negative impact on E. coli 345-2RifC (0% cost) and E. coli 345-8RifC (3% improvement) compared to the same mutation in E. coli K12 (8.7% cost).8 Although the fitness cost of the plasmid R46 has not been studied before, other conjugative multi-resistance plasmids such as R1 and RP4 have been found to impose much larger costs on E. coli K12 J53-1 (5.8% and 20.8%, respectively compared to 3.3% for R46).12 Thus, it appears as if the fitness costs imposed on E. coli 345-2 in general are lower than those observed in other systems.

It was interesting to find that passage of the E. coli 345-2 RifC derivatives for 200 generations in nutrient broth did not substantially alter the in vitro fitness costs of any of the four antibiotic resistance elements studied. It is possible that the time period was too short to allow fitter derivatives to evolve and emerge although other researchers have succeeded in isolating mutants with lowered fitness costs after just 200 generations. For example, the fitness of rifampicin-resistant mutants of E. coli improved by as much as 20% after just 200 generations of evolution.8 It is likely that because the fitness costs exerted on E. coli 345-2RifC by various resistance elements are low or non-existent, compensatory mutations, if needed, will emerge more slowly. Theoretically, compensation of a cost of only 3.3% as observed with R46 would take 390 generations, assuming the mutation frequency was 10–6. One would therefore expect that any compensatory mutations would have to not only eliminate the fitness cost of resistance but also improve fitness in relation to the parent strain in order to be observed within 200 generations. These low or non-existent fitness costs may in part also account for the fact that expression of antibiotic resistance was found to be extremely stable in the pig gut. Of more than 10 000 colonies screened per strain, only two were found that had lost expression of resistance. These were both revertants to wild-type of the RpsL K42R mutation.

It was noted during animal experiments that colonization levels of the same strain in individual piglets were variable. This suggests that, in addition to bacterial factors such as expression of antibiotic resistance, host factors and/or the competing microflora are also involved in determining how well a particular E. coli strain is able to colonize the pig gut.

Another intriguing observation was that results of the in vitro studies did not always exactly mirror those of the animal experiments. In the case of the strain with a mutation in rpsL, recovery rates were comparable to those obtained for the parent strain, suggesting that acquisition of the mutation did not compromise the cell in the pig gut. The pre-passage strain containing R46 was found to be at a disadvantage in the animal model compared to the plasmid-free parent, consistent with results of the in vitro experiments. However, although the post-passage R46 strain had a fitness cost in vitro, it was recovered at higher rates overall than the parent strain from the pig gut. This suggests that an adaptive change may have occurred during the laboratory passage process but that its effect was only apparent in animals and not in laboratory culture. E. coli 345-2RifC/Tn1A had a fitness advantage over its transposon-free progenitor and seemed to fare slightly better in animals than the transposon-free parent. The transposon insertion in the second derivative, Tn1B, had no detectable fitness cost in vitro or in vivo. Finally, neither derivative carrying Tn7 showed a detectable loss or gain of fitness in vitro or in the animals. The results of these experiments mirror those of other researchers who have found that experiments to assess fitness cost of antibiotic resistance fitness experiments often, although not always, produce similar results in vivo as in vitro.5,10,32 Large contrasts between in vitro and in vivo results in particular are rare, indicating that laboratory experiments are a good approximate indicator of in vivo fitness effects of antibiotic resistance.

Curiously, the region of E. coli 345-2 RifC chromosome into which Tn1 was found to be inserted in both instances was completely unknown, in the context that it does not resemble any published DNA sequences and in particular lacks homology with reported E. coli sequences, although some homology is detected at the protein level. It is unexpected that in today's age of genomic sequencing, a representative of a well-studied species such as E. coli can be found to have completely unknown chromosomal DNA sequences. We can only speculate as to the origin of this sequence; it may be a phage sequence, an integrated plasmid or perhaps part of a genomic island. The GC content of the large open reading frame, 39.5%, is considerably lower that that of E. coli, 50.0%,33 indicating that the DNA probably originates from another organism.

Transposon-borne antibiotic resistance, the fitness cost of which has not previously been extensively studied, was found not to exert any measurable fitness costs in vivo or in vitro and in the case of Tn1 can sometimes confer an advantage, in the absence of antibiotic selection. It is perhaps intuitive that transposon carriage does not have a large associated fitness cost as transposons are relatively small in size and if inserted into the chromosome, are usually only present in one copy and hence do not impose a significant metabolic burden on the cell. However, one must exercise caution when interpreting the fitness impacts of transposons such as Tn1 that insert into genomes at random, as any change in fitness may reflect disruption of the insertion site rather than acquisition of the transposon. The reason why Tn1 carriage may give a fitness advantage is unclear. The most likely explanation is that in derivative Tn1A, insertion of the transposon has disrupted a gene that imposes a fitness cost, although the possibility that the transposon itself can confer a fitness advantage cannot be completely ruled out. However, until further derivatives are constructed or the function of the cryptic sequence is known, this question cannot be answered.

In conclusion, these results show that the fitness cost exerted by naturally occurring antibiotic resistance elements upon a wild-type E. coli strain is low both in vivo and in vitro and carriage of resistance can sometimes even be an advantage. These results indicate that elimination of existing antibiotic resistance, in particular that encoded on mobile resistance elements through modification of prescribing policies alone, is unlikely, and if possible at all, is likely to be a lengthy process.


    Acknowledgements
 
This work was supported by the Department for the Environment, Food and Rural Affairs (DEFRA), UK (Project code OD 2007).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1. Andersson DI. Persistence of antibiotic resistant bacteria. Curr Opin Microbiol 2003; 6: 452–6.[CrossRef][Web of Science][Medline]

2. Andersson DI, Levin BR. The biological cost of antibiotic resistance. Curr Opin Microbiol 1999; 2: 489–93.[CrossRef][Web of Science][Medline]

3. Bjorkman J, Andersson DI. The cost of antibiotic resistance from a bacterial perspective. Drug Resist Update 2000; 3: 237–45.[CrossRef][Web of Science][Medline]

4. Bjorkman J, Hughes D, Andersson DI. Virulence of antibiotic-resistant Salmonella typhimurium. Proc Natl Acad Sci USA 1998; 95: 3949–53.[Abstract/Free Full Text]

5. Bjorkman J, Samuelsson P, Andersson DI et al. Novel ribosomal mutations affecting translational accuracy, antibiotic resistance and virulence of Salmonella typhimurium. Mol Microbiol 1999; 31: 53–8.[CrossRef][Web of Science][Medline]

6. Schrag SJ, Perrot V, Levin BR. Adaptation to the fitness costs of antibiotic resistance in Escherichia coli. Proc R Soc Lond B Biol Sci 1997; 264: 1287–91.[Medline]

7. Enne VI, Delsol AA, Roe JM et al. Rifampicin resistance and its fitness cost in Enterococcus faecium. J Antimicrob Chemother 2004; 53: 203–7.[Abstract/Free Full Text]

8. Reynolds MG. Compensatory evolution in rifampin-resistant Escherichia coli. Genetics 2000; 156: 1471–81.[Abstract/Free Full Text]

9. Wichelhaus TA, Boddinghaus B, Besier S et al. Biological cost of rifampin resistance from the perspective of Staphylococcus aureus. Antimicrob Agents Chemother 2002; 46: 3381–5.

10. Giraud E, Cloeckaert A, Baucheron S et al. Fitness cost of fluoroquinolone resistance in Salmonella enterica serovar Typhimurium. J Med Microbiol 2003; 52: 697–703.[Abstract/Free Full Text]

11. Johnsen PJ, Simonsen GS, Olsvik O et al. Stability, persistence, and evolution of plasmid-encoded VanA glycopeptide resistance in enterococci in the absence of antibiotic selection in vitro and in gnotobiotic mice. Microb Drug Resist 2002; 8: 161–70.[CrossRef][Web of Science][Medline]

12. Dahlberg C, Chao L. Amelioration of the cost of conjugative plasmid carriage in Escherichia coli K12. Genetics 2003; 165: 1641–9.[Abstract/Free Full Text]

13. Helling RB, Kinney T, Adams J. The maintenance of plasmid-containing organisms in populations of Escherichia coli. J Gen Microbiol 1981; 123: 129–41.[Abstract/Free Full Text]

14. Lenski RE, Simpson SC, Nguyen TT. Genetic analysis of a plasmid-encoded, host genotype-specific enhancement of bacterial fitness. J Bacteriol 1994; 176: 3140–7.[Abstract/Free Full Text]

15. McDermott PJ, Gowland P, Gowland PC. Adaptation of Escherichia coli growth rates to the presence of pBR322. Lett Appl Microbiol 1993; 17: 139–43.[Web of Science][Medline]

16. Biel SW, Hartl DL. Evolution of transposons: natural selection for Tn5 in Escherichia coli K12. Genetics 1983; 103: 581–92.[Abstract/Free Full Text]

17. Blot M, Meyer J, Arber W. Bleomycin-resistance gene derived from the transposon Tn5 confers selective advantage to Escherichia coli K12. Proc Natl Acad Sci USA 1991; 88: 9112–6.[Abstract/Free Full Text]

18. Adam E, Volkert MR, Blot M. Cytochrome c biogenesis is involved in the transposon Tn5-mediated bleomycin resistance and the associated fitness effect in Escherichia coli. Mol Microbiol 1998; 28: 15–24.[CrossRef][Web of Science][Medline]

19. Elena SF, Ekunwe L, Hajela N et al. Distribution of fitness effects caused by random insertion mutations in Escherichia coli. Genetica 1998; 102/103: 349–58.[CrossRef]

20. BSAC Working Party on Susceptibility Testing. BSAC standardized disc susceptibility testing method. J Antimicrob Chemother 2001; 48 Suppl S1: 43–57.[Abstract/Free Full Text]

21. Pato ML, Bennett PM, von Meyenburg K. Messenger ribonucleic acid synthesis and degradation in Escherichia coli during inhibition of translation. J Bacteriol 1973; 116: 710–8.[Abstract/Free Full Text]

22. Brown AMC, Willetts NS. A physical and genetic map of the IncN plasmid R46. Plasmid 1981; 5: 188–201.[CrossRef][Web of Science][Medline]

23. Livermore DM, Williams JD. ß-Lactams: mode of action and mechanisms of bacterial resistance. In: Lorian V, ed. Antibiotics in Laboratory Medicine. Baltimore: Williams & Wilkins, 1996; 56.

24. Robinson MK, Bennett PM, Falkow S et al. Isolation of a temperature-sensitive derivative of RP1. Plasmid 1980; 3: 343–7.[Web of Science][Medline]

25. Sorensen AB, Duch M, Jorgensen P et al. Amplification and sequence analysis of DNA flanking integrated proviruses by a simple two-step polymerase chain reaction method. J Virol 1993; 67: 7118–24.[Abstract/Free Full Text]

26. Gould VC, Okazaki A, Howe RA et al. Analysis of sequence variation among smeDEF multi drug efflux pump genes and flanking DNA from defined 16S rRNA subgroups of clinical Stenotrophomonas maltophilia isolates. J Antimicrob Chemother 2004; 54: 348–53.[Abstract/Free Full Text]

27. Barth PT, Datta N, Hedges RW et al. Transposition of a deoxyribonucleic-acid sequence encoding trimethoprim and streptomycin resistances from R483 to other replicons. J Bacteriol 1976; 125: 800–10.[Abstract/Free Full Text]

28. Kubo KM, Craig NL. Bacterial transposon Tn7 utilizes two different classes of target sites. J Bacteriol 1990; 172: 2774–8.[Abstract/Free Full Text]

29. Enne VI, Bennett PM, Livermore DM et al. Enhancement of host fitness by the sul2-coding plasmid p9123 in the absence of selective pressure. J Antimicrob Chemother 2004; 53: 958–63.[Abstract/Free Full Text]

30. Parkhill J, Dougan G, James KD et al. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 2001; 413: 848–52.[CrossRef][Medline]

31. Blattner FR, Plunkett G III, Bloch CA et al. The complete genome sequence of Escherichia coli K-12. Science 1997; 277: 1453–74.[Abstract/Free Full Text]

32. Bjorkman J, Nagaev I, Berg OG et al. Effects of environment on compensatory mutations to ameliorate costs of antibiotic resistance. Science 2000; 287: 1479–82.[Abstract/Free Full Text]

33. National Centre for Biotechnology Information. Complete Microbial Genomes. http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi (1 March 2005, date last accessed).


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Antimicrob ChemotherHome page
M. Sundqvist, P. Geli, D. I. Andersson, M. Sjolund-Karlsson, A. Runehagen, H. Cars, K. Abelson-Storby, O. Cars, and G. Kahlmeter
Little evidence for reversibility of trimethoprim resistance after a drastic reduction in trimethoprim use
J. Antimicrob. Chemother., November 8, 2009; (2009) dkp387v1.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
P. M. Hawkey and A. M. Jones
The changing epidemiology of resistance
J. Antimicrob. Chemother., September 1, 2009; 64(suppl_1): i3 - i10.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
D. Bibbal, V. Dupouy, M. F. Prere, P. L. Toutain, and A. Bousquet-Melou
Relatedness of Escherichia coli Strains with Different Susceptibility Phenotypes Isolated from Swine Feces during Ampicillin Treatment
Appl. Envir. Microbiol., May 15, 2009; 75(10): 2999 - 3006.
[Abstract] [Full Text] [PDF]


Home page
J. Environ. Qual.Home page
J. C. Chee-Sanford, R. I. Mackie, S. Koike, I. G. Krapac, Y.-F. Lin, A. C. Yannarell, S. Maxwell, and R. I. Aminov
Fate and Transport of Antibiotic Residues and Antibiotic Resistance Genes following Land Application of Manure Waste
J. Environ. Qual., April 27, 2009; 38(3): 1086 - 1108.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
L. Pallecchi, C. Lucchetti, A. Bartoloni, F. Bartalesi, A. Mantella, H. Gamboa, A. Carattoli, F. Paradisi, and G. M. Rossolini
Population Structure and Resistance Genes in Antibiotic-Resistant Bacteria from a Remote Community with Minimal Antibiotic Exposure
Antimicrob. Agents Chemother., April 1, 2007; 51(4): 1179 - 1184.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
K. H. Dahl, D. D. G. Mater, M. J. Flores, P. J. Johnsen, T. Midtvedt, G. Corthier, and A. Sundsfjord
Transfer of plasmid and chromosomal glycopeptide resistance determinants occurs more readily in the digestive tract of mice than in vitro and exconjugants can persist stably in vivo in the absence of glycopeptide selection
J. Antimicrob. Chemother., March 1, 2007; 59(3): 478 - 486.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
V. I. Enne, A. A. Delsol, J. M. Roe, and P. M. Bennett
Evidence of Antibiotic Resistance Gene Silencing in Escherichia coli.
Antimicrob. Agents Chemother., September 1, 2006; 50(9): 3003 - 3010.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
56/3/544    most recent
dki255v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Enne, V. I.
Right arrow Articles by Bennett, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Enne, V. I.
Right arrow Articles by Bennett, P. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?