Skip Navigation


JAC Advance Access originally published online on May 4, 2005
Journal of Antimicrobial Chemotherapy 2005 55(6):832-839; doi:10.1093/jac/dki118
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
55/6/832    most recent
dki118v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Granger, D.
Right arrow Articles by Roger, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Granger, D.
Right arrow Articles by Roger, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions{at}oupjournals.org

Genetic analysis of pbp2x in clinical Streptococcus pneumoniae isolates in Quebec, Canada

Dominic Granger1,2, Geneviève Boily-Larouche1, Pierre Turgeon2,3, Karl Weiss2,4 and Michel Roger1,2,*

1 Laboratoire d'immunogénétique, Centre de Recherche du Centre Hospitalier de l'Université de Montréal (CHUM), Montréal, Canada; 2 Département de microbiologie-immunologie, Hôpital Notre-Dame du CHUM, 1560 Sherbrooke Est, Montréal, Québec, Canada H2L 4M1; 3 Département de microbiologie, Hôpital Saint-Luc du CHUM, Montréal, Canada; 4 Département de microbiologie, Hôpital Maisonneuve-Rosemont, Montréal, Canada


* Corresponding author. Tel: +1-514-890-8000, ext. 25802; Fax: +1-514-412-7512; Email: michel.roger{at}ssss.gouv.qc.ca

Received 16 November 2004; returned 22 January 2005; revised 10 March 2005; accepted 11 March 2005


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Objectives: To investigate the nature of the amino acid motifs found in penicillin-binding protein (PBP) 2x of penicillin-resistant Streptococcus pneumoniae isolates across the province of Quebec (Canada), and to obtain preliminary information regarding the prevalence of these alterations.

Methods: The pbp2x genomic region encompassing codons 178–703, which includes the entire region of the transpeptidase domain, was sequenced and compared for 52 clinical isolates comprising 20 penicillin-susceptible (PSSP), 20 penicillin-intermediate (PISP) and 12 penicillin-resistant (PRSP) pneumococci.

Results: The degree of diversity within PBP2x correlated with increased resistance to ß-lactam antibiotics. There were an average of 5.0 ± 1.8 mutations in PSSP, 37.9 ± 4.4 in PISP, and 63.0 ± 2.0 in PRSP isolates when compared with the control penicillin-susceptible strain R6. At least six distinct amino acid profiles were identified among PISP strains isolated in Quebec. In contrast, all PRSP isolates shared a similar pattern of altered amino acids compared with the sequence from susceptible strains.

Conclusions: These data will be useful in future studies to monitor the genetic changes associated with the emergence and spread of ß-lactam resistance in Quebec.

Keywords: penicillin-binding proteins , ß-lactams , pneumococci , serotype , penicillin resistance , cefotaxime resistance


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Streptococcus pneumoniae remains the major cause of bacterial pneumonia and an important cause of otitis media, meningitis and septicaemia. The extensive use of ß-lactam antibiotics over the last 40 years has led to a strong selective pressure, resulting in the emergence of pneumococcal strains with greatly increased resistance to penicillin and cephalosporins.

ß-Lactam antibiotics exert their biological effects by interacting with a unique class of proteins, the penicillin-binding proteins (PBPs). PBPs are membrane enzymes that catalyse the polymerization and transpeptidation of glycan strands, during the assembly of the bacterial cell wall.1 ß-Lactam resistance in clinical pneumococci is mediated by altered PBPs, specifically PBP1a, PBP2x and PBP2b.24

PBP2x of S. pneumoniae, the first target to be modified under antibiotic pressure, is the most thoroughly studied PBP.57 The crystal structure of PBP2x revealed that it comprised three-domains: a central 350-residue domain (amino acid positions 266 to 616), which corresponds to the transpeptidase domain, and two flanking domains of unknown function.8 The active site of transpeptidase activity is formed by three conserved amino acid motifs, STMK (including the active-site serine), SSN and KSG. Mutations, within or in positions flanking these motifs, have been observed in resistant laboratory mutants and clinical isolates.5,914 PBP2x of penicillin non-susceptible pneumococci (NSSP) may harbour several dozen amino acid mutations outside these motifs compared with homologous sequences from penicillin-susceptible S. pneumoniae (PSSP).9,15 Some of these amino acid substitutions have been shown to be common to penicillin-resistant pneumococci (PRSP) isolated from different countries.1618 Only a few of those changes are likely to be linked to the resistance phenotype.1720

In Canada, data from the 1997–2002 national surveillance study demonstrated that the prevalence of S. pneumoniae with reduced susceptibility to penicillin did not significantly change over the 5 year period and ranged from 21.2% in 1997 to 24% in 2002.2123 However, the proportion of isolates with high-level penicillin resistance (MIC > 2 mg/L) increased dramatically from 2.4% in 1999 to 13.8% in 2002, and the proportion of multidrug-resistant S. pneumoniae isolates increased from 2.7% to 8.8% over the 5 year period.23 The prevalence of PRSP varied considerably by geographical location in Canada, and was higher in Ontario and Quebec (central Canadian provinces) than the eastern provinces.22,23

Although several studies have described the genetic profile of the pbp2x gene in pneumococci from different countries, only one study was done on very few clinical isolates from Canada.13 Given that the proportion of PRSP with high-level resistance has considerably increased in Canada since 1999, and Quebec is part of this emerging trend, we investigated the nature of the PBP2x amino acid motifs in 52 clinical pneumococci isolated across the Quebec province.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bacterial strains, growth conditions and DNA isolation

Fifty-two clinical isolates of pneumococci [20 penicillin-susceptible, 20 penicillin-intermediate (PISP) and 12 penicillin-resistant strains, for which the penicillin MICs were ≤0.06 mg/L, > 0.06 and < 2 mg/L, and ≥2 mg/L, respectively] were chosen randomly to represent a range of MICs and a cross-Quebec geographical distribution, for molecular characterization. Pneumococci were obtained from the bacteria bank of the Reseau EQUERE (Etude QUEbecoise des pathogenes REspiratoires) at Maisonneuve-Rosemont Hospital (Montreal, Canada) and from St-Luc Hospital (Montreal, Canada). The R6 strain of S. pneumoniae (MIC of penicillin ≤0.016 mg/L) and the laboratory strain ATCC 49619 (MIC of penicillin between 0.125 and 1 mg/L) were used as the penicillin-susceptible and -intermediate reference strains, respectively. The clinical and demographic parameters of the S. pneumoniae isolates analysed in this study are listed in Table 1. Bacteria were cultured at 37°C on agar supplemented with 5% sheep blood (Quelab, Montreal, Canada) in a 5% CO2 atmosphere. Capsular typing was based on the Quellung technique. Bacterial DNA was extracted from overnight growth cultures by boiling pneumococcal cells in chelex (Sigma–Aldrich, Oakville, Canada) for 15 min. The supernatant was then recovered by spinning the specimen for 10 min at 15 000 rpm. The supernatant was kept at 4°C until used for PCR.


View this table:
[in this window]
[in a new window]
 
Table 1.. Characteristics and PBP2x genetic profiles of the 52 pneumococcal isolates in Quebec, Canada

 
Susceptibility testing

For each clinical strain, penicillin and cefuroxime susceptibility testing was performed by broth microdilution according to NCCLS guidelines.24 Interpretative criteria used were those published in the NCCLS M100-S12 document.25 For all NSSP isolates, penicillin and cefotaxime MICs were also determined in triplicate using Etest strips (AB Biodisk, Solna, Sweden), as recommended by the manufacturer. MICs were measured independently by two observers and the mean was calculated for each bacterial strain tested in triplicate. MIC values for both methods appear in Table 1.

Amplification of the pbp2x gene and nucleotide sequencing

The coding region of the transpeptidase domain of pbp2x genes of all strains of S. pneumoniae, listed in Table 1, was amplified from bacterial DNA by PCR. Primer pairs used for amplification of the pbp2x gene were designed from the DNA sequence of the R6 strain (GenBank accession no. X16367): pbp2x-F, 5'-721GGGATTACCTATGCCAATATGAT743-3'; and pbp2x-R, 5'-2463AGCTGTGTTAGC(G/A/C)CGAACATCTTG-2440-3'. Amplification reactions contained 200 mg of bacterial DNA, 0.25 mM of each dNTP (Pharmacia, Piscataway, NJ, USA), 1 x PCR buffer (Applied Biosystems, Foster City, CA, USA), 2.5 units of Taq DNA polymerase (Applied Biosystems) and 15 pmol of primers (Invitrogen Canada Inc., Burlington, Canada) in a total volume of 50 µL. PCR cycling conditions included a 5 min initial denaturation step at 95°C, followed by 35 cycles of 1 min at 95°C, 75 s at 62°C and 75 s at 72°C, and a final extension step at 72°C for 4 min. Amplified fragments of 1742 nucleotides were purified into Multiscreen96 PCR plates, using vacuum filtration with the cleaning kit (Millipore, Bedford, MA, USA).

The nucleotide sequences of purified PCR products were determined by direct sequencing using BigDye terminator cycle sequencing reactions (Applied Biosystems). The reaction products were run in an automated DNA sequencing ABI PRISM 3100 capillary sequencer (Applied Biosystems). All PCR products were sequenced in both directions.

Sequence analysis

Nucleotide and derived amino acid sequence data were compared with those of the pbp2x R6 reference strain (X16367). The analysis was done by Lasergene software (Version 5, DNAstar Inc., Madison, WI, USA), using the ClustalW alignment. Comparison of our sequences with all other sequences was performed using the Genetics Computer Group (GCG) package. Numbers of amino acid mutations are presented as means ± SEM.

Nucleotide sequence accession numbers

The nucleotides sequences determined in this study were submitted to the GenBank nucleotide sequence database under accession numbers AY950507 [GenBank] to AY950558 [GenBank] .


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The characteristics and PBP2x genetic profiles of the clinical pneumococci are illustrated in Table 1. Two isolates, 14759 and 14765, can be classified as either PSSP or NSSP, depending on the method used for MIC determination. We classified these two pneumococci as PISP, by preferentially using the MICs ( > 0.06 mg/L) obtained by Etest (Table 1). The majority of NSSP isolates belonged to serogroup 23 (21.9%) followed by serogroups/types 6 (18.8%), 14 (15.6%), 19 (12.5%), 9 (6.3%) and 15 (3%).

The diversity of amino acids in PBP2x (codons 178–703) was determined for each clinical isolate. In total, we observed 110 amino acid changes compared with the R6 PBP2x control sequence (Figure 1). Of those, 105 amino acid substitutions were found in NSSP and occurred mostly (67%) within the transpeptidase domain (residues 266–616). Mutations at positions in or close to each of three conserved motifs (STMK, SSN and KSG) are indicated in bold (Figure 1).



View larger version (65K):
[in this window]
[in a new window]
 
Figure 1.. Deduced amino acid sequences (residues 178 to 703) of pbp2x genes of clinical Streptococcus pneumoniae strains isolated in the province of Quebec, Canada. Sequences are shown top to bottom for penicillin-susceptible, penicillin-intermediate and penicillin-resistant categories. Penicillin-intermediate pneumococci are classified in six groups by considering their amino acid motifs. Penicillin-susceptible strain 14900 is the only exception and is classified as belonging to group II of PISP. ATCC, ATCC 49619 penicillin-intermediate laboratory strain. Only amino acids that differ from the reference sequence of the R6 strain (GenBank accession no. X16367) are shown. The transpeptidase domain corresponds to the amino acids between positions 266 and 616. Dashes indicate residues identical with those of the R6 strain. Amino acids are numbered according to their positions in the gene. Mutations at positions in or close to each of three conserved motifs, STMK, SSN and KSG, are indicated in bold. Sequences of three penicillin-susceptible isolates that were identical with the R6 sequence are not shown (isolates 2010, 14636 and 14762).

 
Most of the PSSP isolates had amino sequences highly similar to the R6 sequence. However, two PSSP strains, 14770 and 14771, had 28 (5.3%) and 25 (4.8%) substitutions in the PBP2x sequence, respectively (Table 1). Although these two particular isolates shared strong identity in the last portion of PBP2x's sequence (residues 552–703) with those of group I among PISP they did not have the characteristic amino acid motif: H–R–A–N between the positions 514 and 538, unique to this group. The PBP2x amino acid sequences of PISP isolates differed from 14 (2.7%) to 66 (12.6%) residues compared with the control R6 strain (Table 1). Based on the deduced amino acid sequence, we distinguished six distinct motif profiles among the PISP. The amino acid sequence of the isolates in group I was very similar to that of the laboratory strain ATCC 49619, and all contained the motif H514–R523–A535–N538 (Figure 1). Group II did not have any mutation in the central part of the transpeptidase domain (positions 385–566). Group III had the amino acid motif: H514–K531–N567–N576. Group IV is distinguished by the amino acid motif: L483–S490V491. Finally, isolates in groups V and VI showed a greater number of amino acid changes (~40) within the transpeptidase domain than the previous groups. Those for which penicillin MICs were ≤0.5 mg/L were classified in group V and other pneumococci with penicillin MICs between 0.5 and 1 mg/L were assembled in group VI. The PBP2x amino acid sequences of group VI isolates were highly homogeneous with those of PRSP. Substitution N417->K was observed only in isolates from group VI and can be used as a criterion to distinguish this particular group. PRSP isolates were found to have high numbers of amino acid sequence variations. The pattern of amino acid sequence variations was highly homogenous among PRSP strains (Figure 1).

Finally, we compared the pbp2x gene sequence of the 52 clinical isolates analysed in this study with other published sequences in the Genetics Computer Group (GCG) database and identified five novel amino acid sequence variants in our samples. The amino acid substitutions Asn185->Thr, Ser252->Ala and Lys505->Glu were observed in the PISP isolates 14736, 14622/14625 and 2259, respectively. Leu429->Cys was found in the PSSP isolate 14756 and Asp643->Ala was identified in PRSP strain 14893. These new mutations are not frequent and are probably the result of point mutations.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Our investigation of the PBP2x amino acid sequence of 52 clinical pneumococci isolated in Quebec (Canada) demonstrates that the degree of diversity within PBP2x correlates with increasing resistance to ß-lactam antibiotics. In fact, we found an average of 5.0 ± 1.8 mutations in PSSP, 37.9 ± 4.4 in PISP and 63.0 ± 2.0 in PRSP isolates when compared with the control penicillin-susceptible R6 strain. However, two PSSP strains, 14770 and 14771, contained high numbers of substitutions and shared strong identity in the last portion of PBP2x's sequence (residues 552–703) with those of group I among PISP. This situation has also been reported by Baek et al.26 and could suggest that mutations in other pbp or other non-pbp genes are necessary for acquiring penicillin resistance.

We identified the presence of at least six distinct amino acid profiles among PISP strains isolated in Quebec. The acquisition and spread of ß-lactam resistance in pneumococci is a complex process, involving clonal diffusion, horizontal DNA transfer, and point mutations. The diversity of the pattern of amino acid motifs in the PISP pbp2x gene suggests that PISP isolates have emerged independently in Quebec, on more than one occasion. In contrast, all PRSP strains shared a similar pattern of amino acid motifs and are probably associated with a limited number of resistant clones.

Our analysis of PBP2x penicillin-binding motifs showed the presence of substitutions at the amino acid Thr338 in most NSSP strains (Table 1). However, one PSSP isolate (14900) contained this mutation while it was absent in three PISP (2076, 14896 and 14763). The Thr338->Ala/Ser/Pro mutation, adjacent to the active-site serine Ser337 in the first conserved motif (STMK), was identified as an important determinant of penicillin resistance.27,28 Although the Thr338 residue is not directly in contact with the antibiotic,8,29 the Thr338->Ala substitution results in the absence of a hydroxyl group at this position, which drastically lowers the acylation efficiency of PBP2x for ß-lactams.29 The Thr338 substitution is frequently found in clinical isolates with ß-lactam resistance4,9,13,18,28 but it is sometimes observed in PSSP isolates.9,13,18 However, it is not clear how some PSSP isolates can harbour this substitution without becoming resistant. It is possible that other compensatory structural alterations help to stabilize the primary active-site mutation of PBP2x. The His394->Leu mutation just before the second conserved motif (SSN) was found only in one PISP isolate (14763) not bearing the Thr338->Ala substitution in the STMK motif (Table 1). In fact, the His394->Leu substitution has never been observed in association with the Thr338->Ala mutation in NSSP isolates.12,13,18,28

On the other hand, the Met339->Phe substitution, also in the first conserved motif, was found in only one PRSP isolate (14760). Site-directed mutagenesis demonstrated that this substitution decreases the acylation efficiency 3- to 10-fold, depending on the sequence context and the ß-lactam antibiotic.10 In clinical S. pneumoniae, the PBP2x Met339->Phe substitution has been found in strains with penicillin MICs ≥4 mg/L12,20,30 and cefotaxime MICs ≥2 mg/L2,9,18,20,31 isolated in France, USA and Japan. In our case, penicillin and cefotaxime MICs for the 14760 isolates were 2 mg/L for penicillin and 1.5 mg/L for cefotaxime. This substitution was not observed in the previous study of Canadian pneumococci strains.13 This strain was isolated in January 2002 and may represent the recently increasing incidence of highly resistant pneumococci in Quebec.22,23 This observation is interesting and will be useful to monitor the emergence and spread of isolates with high-level penicillin resistance in Quebec and other parts of Canada.

The amino acid substitution Leu546->Val preceding the third conserved motif (KSG), was observed in 18 clinical isolates; and penicillin MICs for these strains were generally the highest (≥1 mg/L), except for two strains (2259 and 14681) whose MICs were 0.25 and 0.5 mg/L, respectively (Table 1). The Leu546->Val substitution is associated with high-level ß-lactam resistance in clinical pneumococci.9,12,13,20,28 In our study, all strains presenting cefuroxime MICs ≥2 mg/L and cefotaxime MICs > 0.5 mg/L (Table 1) harboured the Leu546->Val substitution. However, some strains susceptible to these cephalosporins contained this mutation. Although the Leu546->Val substitution is not sufficient by itself to cause high-level ß-lactam resistance, it seems to play an important role in the development of resistance.

The Thr550->Ala mutation just after the KSG motif was observed in only one of our clinical isolates. Interestingly, this mutation was found in an isolate (14758) with a penicillin MIC of ≤0.06 mg/L and a cefuroxime MIC of 0.5 mg/L. It has been clearly shown by site-directed mutagenesis that this mutation in PBP2x is involved in low-level resistance to cephalosporins.5,7 However, several studies of clinical S. pneumoniae found no or very few resistant strains with a Thr550->Ala substitution.12,13,18 Our results are in agreement with the observed difference between clinical and laboratory PBP2x mutants. In fact, resistance in laboratory mutants does not always correlate with the definition of resistance for clinical isolates in terms of their MICs. Furthermore, one amino acid change may contribute to a decreased susceptibility selectable in the laboratory without conferring high resistance levels.

Substitutions outside penicillin-binding motifs that may alter the conformational change of active-site structure, might also contribute to resistance. Amino acid substitution Gln552->Glu was previously associated with cephalosporin resistance in laboratory mutants.2,6,11,19,32 Although this substitution was observed in four clinical pneumococci isolated in Quebec (14770, 14771, 2076 and 14896), none was resistant to either cefuroxime or cefotaxime (Table 1). These results confirm previous studies reporting that this particular mutation is associated with ß-lactam resistance of laboratory mutant strains rather than clinical S. pneumoniae isolates.17,18,30

Analysis of amino acid sequences of PBP2x revealed other prominent substitutions that occurred among most NSSP isolates. In fact, 97% (31/32) of NSSP isolates contained both Arg254->Gln and Met256->Val substitutions. Our search in different databases and among PBP2x published sequences revealed that this double substitution in the C-terminal domain is present in most NSSP clinical isolates19,20,28,30 and ß-lactam-resistant Streptococcus mitis B6.15 However, like other mutations previously described to be linked to resistance, this double substitution was also found in two PSSP isolates. The prevalence of these double substitutions (97%) is higher than the Thr338 substitution (94%) usually used to predict resistance. The amino acid motif Q254–V256 (Figure 1) could represent a new target for the development of PCR-based predictive diagnosis of ß-lactam resistance in S. pneumoniae. Further studies of mutagenesis in this area are still necessary to confirm if these preponderant amino acid alterations are directly associated with penicillin resistance development.

This study constitutes the first investigation of pbp2x gene alterations in clinical S. pneumoniae isolates throughout the province of Quebec. Based on the deduced amino acid sequence, we distinguished six distinct motif profiles among the PISP that will play an important role in tracking the genetic changes to chart the emergence, spread and evolution of ß-lactam and notably penicillin resistance in this part of Canada.


    Acknowledgements
 
We thank Marthe Bernier from the Centre de recherche en Infectiologie (CRI) (Sainte-Foy, PQ, Canada), Christiane Restieri from banque du reseau EQUERE, Hôpital Maisonneuve-Rosemont (Montreal, PQ, Canada), and the Department of Microbiology of the Hôpital Saint-Luc (Montreal) for providing pneumococcal isolates. We express our gratitude to Dr Ann Huletsky for providing the primer sequences. We thank France Dion and Julie Lacaille for their technical help, Carmen Fleury and C. Restieri for MIC determinations, Louise Jetté and François Robillard from Laboratoire de la Santé Publique du Québec (Sainte-Anne-de-Bellevue, PQ, Canada) for their help in capsular typing, and Jean-Nicholas Roy for correcting the manuscript. We are very grateful to Dr Paul H. Roy for his expertise with the GCG package. This work was partly supported by a grant from Valorisation Research Québec. M. R. is supported by a career award from Fonds de la Recherche en Santé du Québec (FRSQ).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1 . Ghuysen JM. Serine ß-lactamases and penicillin-binding proteins. Annu Rev Microbiol 1991; 45: 37–67.[CrossRef][ISI][Medline]

2 . Coffey TJ, Daniels M, McDougal LK et al. Genetic analysis of clinical isolates of Streptococcus pneumoniae with high-level resistance to expanded-spectrum cephalosporins. Antimicrob Agents Chemother 1995; 39: 1306–13.[Abstract]

3 . Hakenbeck R, Ellerbrok H, Briese T et al. Penicillin-binding proteins of penicillin-susceptible and -resistant pneumococci: immunological relatedness of altered proteins and changes in peptides carrying the ß-lactam binding site. Antimicrob Agents Chemother 1986; 30: 553–8.[Abstract/Free Full Text]

4 . Laible G, Hakenbeck R. Five independent combinations of mutations can result in low-affinity penicillin-binding protein 2x of Streptococcus pneumoniae. J Bacteriol 1991; 173: 6986–90.[Abstract/Free Full Text]

5 . Grebe T, Hakenbeck R. Penicillin-binding proteins 2b and 2x of Streptococcus pneumoniae are primary resistance determinants for different classes of ß-lactam antibiotics. Antimicrob Agents Chemother 1996; 40: 829–34.[Abstract]

6 . Krauss J, van der Linden M, Grebe T et al. Penicillin-binding proteins 2x and 2b as primary PBP targets in Streptococcus pneumoniae. Microb Drug Resist 1996; 2: 183–6.[ISI][Medline]

7 . Sifaoui F, Kitzis MD, Gutmann L. In vitro selection of one-step mutants of Streptococcus pneumoniae resistant to different oral ß-lactam antibiotics is associated with alterations of PBP2x. Antimicrob Agents Chemother 1996; 40: 152–6.[Abstract]

8 . Pares S, Mouz N, Petillot Y et al. X-ray structure of Streptococcus pneumoniae PBP2x, a primary penicillin target enzyme. Nat Struct Biol 1996; 3: 284–9.[CrossRef][ISI][Medline]

9 . Asahi Y, Takeuchi Y, Ubukata K. Diversity of substitutions within or adjacent to conserved amino acid motifs of penicillin-binding protein 2X in cephalosporin-resistant Streptococcus pneumoniae isolates. Antimicrob Agents Chemother 1999; 43: 1252–5.[Abstract/Free Full Text]

10 . Chesnel L, Pernot L, Lemaire D et al. The structural modifications induced by the M339F substitution in PBP2x from Streptococcus pneumoniae further decreases the susceptibility to ß-lactams of resistant strains. J Biol Chem 2003; 278: 44448–56.[Abstract/Free Full Text]

11 . Mouz N, Di Guilmi AM, Gordon E et al. Mutations in the active site of penicillin-binding protein PBP2x from Streptococcus pneumoniae. Role in the specificity for ß-lactam antibiotics. J Biol Chem 1999; 274: 19175–80.[Abstract/Free Full Text]

12 . Nagai K, Davies TA, Jacobs MR et al. Effects of amino acid alterations in penicillin-binding proteins (PBPs) 1a, 2b, and 2x on PBP affinities of penicillin, ampicillin, amoxicillin, cefditoren, cefuroxime, cefprozil, and cefaclor in 18 clinical isolates of penicillin-susceptible, -intermediate, and -resistant pneumococci. Antimicrob Agents Chemother 2002; 46: 1273–80.[Abstract/Free Full Text]

13 . Nichol KA, Zhanel GG, Hoban DJ. Penicillin-binding protein 1A, 2B, and 2X alterations in Canadian isolates of penicillin-resistant Streptococcus pneumoniae. Antimicrob Agents Chemother 2002; 46: 3261–4.[Abstract/Free Full Text]

14 . Smith AM, Klugman KP, Coffey TJ et al. Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa. Antimicrob Agents Chemother 1993; 37: 1938–44.[Abstract/Free Full Text]

15 . Hakenbeck R, Konig A, Kern I et al. Acquisition of five high-Mr penicillin-binding protein variants during transfer of high-level ß-lactam resistance from Streptococcus mitis to Streptococcus pneumoniae. J Bacteriol 1998; 180: 1831–40.[Abstract/Free Full Text]

16 . Munoz R, Coffey TJ, Daniels M et al. Intercontinental spread of a multiresistant clone of serotype 23F Streptococcus pneumoniae. J Infect Dis 1991; 164: 302–6.[ISI][Medline]

17 . Overweg K, Bogaert D, Sluijter M et al. Molecular characteristics of penicillin-binding protein genes of penicillin-nonsusceptible Streptococcus pneumoniae isolated in the Netherlands. Microb Drug Resist 2001; 7: 323–4.[CrossRef][ISI][Medline]

18 . Sanbongi Y, Ida T, Ishikawa M et al. Complete sequences of six penicillin-binding protein genes from 40 Streptococcus pneumoniae clinical isolates collected in Japan. Antimicrob Agents Chemother 2004; 48: 2244–50.[Abstract/Free Full Text]

19 . Pernot L, Chesnel L, Le Gouellec A et al. A PBP2x from a clinical isolate of Streptococcus pneumoniae exhibits an alternative mechanism for reduction of susceptibility to ß-lactam antibiotics. J Biol Chem 2004; 279: 16463–70.[Abstract/Free Full Text]

20 . duPlessis M, Bingen E, Klugman KP. Analysis of penicillin-binding protein genes of clinical isolates of Streptococcus pneumoniae with reduced susceptibility to amoxicillin. Antimicrob Agents Chemother 2002; 46: 2349–57.[Abstract/Free Full Text]

21 . Low DE, de Azavedo J, Weiss K et al. Antimicrobial resistance among clinical isolates of Streptococcus pneumoniae in Canada during 2000. Antimicrob Agents Chemother 2002; 46: 1295–301.[Abstract/Free Full Text]

22 . Zhanel GG, Karlowsky JA, Palatnick L et al. Prevalence of antimicrobial resistance in respiratory tract isolates of Streptococcus pneumoniae: results of a Canadian national surveillance study. The Canadian Respiratory Infection Study Group. Antimicrob Agents Chemother 1999; 43: 2504–9.[Abstract/Free Full Text]

23 . Zhanel GG, Palatnick L, Nichol KA et al. Antimicrobial resistance in respiratory tract Streptococcus pneumoniae isolates: results of the Canadian Respiratory Organism Susceptibility Study, 1997 to 2002. Antimicrob Agents Chemother 2003; 47: 1867–74.[Abstract/Free Full Text]

24 . National Committee for Clinical Laboratory Standards. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically: Approved Standard M7-A6. NCCLS, Wayne, PA, USA, 2000.

25 . National Committee for Clinical Laboratory Standards. Performance Standards for Antimicrobial Susceptibility Testing: Twelfth Informational Supplement M100-S12. NCCLS, Wayne, PA, USA, 2002.

26 . Baek JY, Ko KS, Oh WS et al. Unique variations of pbp2b sequences in penicillin-nonsusceptible Streptococcus pneumoniae isolates from Korea. J Clin Microbiol 2004; 42: 1746–50.[Abstract/Free Full Text]

27 . Dowson CG, Hutchison A, Brannigan JA et al. Horizontal transfer of penicillin-binding protein genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Proc Natl Acad Sci USA 1989; 86: 8842–6.[Abstract/Free Full Text]

28 . Laible G, Spratt BG, Hakenbeck R. Interspecies recombinational events during the evolution of altered PBP 2x genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Mol Microbiol 1991; 5: 1993–2002.[ISI][Medline]

29 . Mouz N, Gordon E, Di Guilmi AM et al. Identification of a structural determinant for resistance to ß-lactam antibiotics in gram-positive bacteria. Proc Natl Acad Sci USA 1998; 95: 13403–6.[Abstract/Free Full Text]

30 . Ferroni A, Berche P. Alterations to penicillin-binding proteins 1A, 2B and 2X amongst penicillin-resistant clinical isolates of Streptococcus pneumoniae serotype 23F from the nasopharyngeal flora of children. J Med Microbiol 2001; 50: 828–32.[Abstract/Free Full Text]

31 . Smith AM, Botha RF, Koornhof HJ et al. Emergence of a pneumococcal clone with cephalosporin resistance and penicillin susceptibility. Antimicrob Agents Chemother 2001; 45: 2648–50.[Abstract/Free Full Text]

32 . Hakenbeck R, Kaminski K, Konig A et al. Penicillin-binding proteins in ß-lactam-resistant Streptococcus pneumoniae. Microb Drug Resist 1999; 5: 91–9.[ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
R. Izdebski, J. Rutschmann, J. Fiett, E. Sadowy, M. Gniadkowski, W. Hryniewicz, and R. Hakenbeck
Highly Variable Penicillin Resistance Determinants PBP 2x, PBP 2b, and PBP 1a in Isolates of Two Streptococcus pneumoniae Clonal Groups, Poland23F-16 and Poland6B-20
Antimicrob. Agents Chemother., March 1, 2008; 52(3): 1021 - 1027.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
D. Granger, G. Boily-Larouche, P. Turgeon, K. Weiss, and M. Roger
Molecular characteristics of pbp1a and pbp2b in clinical Streptococcus pneumoniae isolates in Quebec, Canada
J. Antimicrob. Chemother., January 1, 2006; 57(1): 61 - 70.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
55/6/832    most recent
dki118v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Granger, D.
Right arrow Articles by Roger, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Granger, D.
Right arrow Articles by Roger, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?