Skip Navigation


JAC Advance Access originally published online on April 22, 2005
Journal of Antimicrobial Chemotherapy 2005 55(6):1053-1055; doi:10.1093/jac/dki138
This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
55/6/1053    most recent
dki138v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by del Campo, R.
Right arrow Articles by Baquero, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by del Campo, R.
Right arrow Articles by Baquero, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions{at}oupjournals.org

Correspondence

New aac(6')-I genes in Enterococcus hirae and Enterococcus durans: effect on ß-lactam/aminoglycoside synergy

Rosa del Campo1,*, Juan Carlos Galán1, Carmen Tenorio2, Patricia Ruiz-Garbajosa1, Myriam Zarazaga2, Carmen Torres2 and Fernando Baquero1

1 Servicio de Microbiología, Hospital Universitario Ramón y Cajal, Madrid, Spain; 2 Área de Bioquímica y Biología Molecular, Universidad de La Rioja, Logroño, Spain


* Corresponding author. Tel: +34-91-3368542; Fax: +34-91-3368809; Email: rosacampo{at}yahoo.com

Keywords: E. hirae , E. durans , aminoglycoside acetyltransferase enzymes , acetyltransferases , AAC(6')-I , aminoglycoside/penicillin synergy

Sir,

Enterococcus faecium species harbour an intrinsic aac(6')-Ii gene,1 which encodes aminoglycoside acetyltransferase AAC(6') that confers resistance to the synergy of the association of penicillin with tobramycin. Nevertheless, similar genes have not been previously detected in other enterococcal species. Enterococcus hirae and Enterococcus durans are frequently found in the intestine of animals and less frequently in humans,2 and are occasionally involved in severe human infections.3

The characterization of two novel aac(6')-Ii-like genes, species-specific for E. hirae and E. durans, is reported in this study. In agreement with the nomenclature suggestion of Vanhoof et al.4 for the E. faecium acetyltransferase gene [aac(6')-Ii], we have named the new genes as aac(6')-Iih for E. hirae, and aac(6')-Iid for E. durans.

Eight E. hirae strains with seven different PFGE-SmaI patterns and three unrelated E. durans strains were identified by biochemical and genetic criteria.5 MICs of penicillin, streptomycin, gentamicin, tobramycin and kanamycin were determined by the recommended agar dilution method, and none of the isolates had either high-level resistance to the aminoglycosides tested or penicillin resistance. Time–kill studies were carried out as previously described.6 Synergy was observed with the association of penicillin plus streptomycin or gentamicin in the eight E. hirae and the three E. durans strains. Absence of synergy occurred when penicillin was associated with either tobramycin or kanamycin.

Aminoglycoside acetyltransferase enzymes (AAC) were analysed in sonic extracts obtained by ultrasonic disruption, using the phosphocellulose paper-binding assay. A typical AAC(6') activity was observed by the radioenzymic assay in all five of eight E. hirae and three of three E. durans strains tested. Enzymic modification of gentamicin C1a, tobramycin and netilmicin but not of gentamicin C1 and 6'-N-ethylnetilmicin was observed in all these strains. Phosphotransferase or nucleotidyltransferase activities were not observed in any strain.

For PCR assays, degenerate primers aacD-F (5'->3') TGGGARYTICAYCCIHTIGT and aacD-R (5'->3') YWWICCRTTIGCRTTIGGIAD were designed comparing the sequences of the different aac(6')-I genes. Total DNAs from three E. hirae strains and one E. durans strain were used as templates obtaining a 270 bp amplicon in all cases. The nucleotide sequences were identical in the three E. hirae, but different in the E. durans strain, even though both PCR products showed high homology with aac(6')-Ii from E. faecium. A new set of primers, hira-3 (5'->3') CTTTGCAAAGTTACAAGAA and hira-4 (3'->5') CTGTCCCTAGATAGATGA, were applied in an inverse PCR strategy using the total DNA generated from E. hirae AR48 strain digested with RsaI and subsequent re-ligation, yielding a 0.8 kb amplicon. The primers aac1 (5'->3') GGATAGCGGATGATTATCA and aac2 (3'->5') TAAGAGTTTAATGAATAATTA were designed to amplify a fragment of ~840 bp containing the entire aac(6') gene that has a size of 549 bp. The nucleotide sequence of the aac(6')-Iih gene (G + C=43.2%) from E. hirae strain presented a 72% identity with aac(6')-Ii from E. faecium (G + C=38.9%). The aac(6')-Iid gene from E. durans (G + C=42.8%) was obtained using the same strategy as for E. hirae, and showed 80% identity with aac(6')-Ii from E. faecium and 73% identity with aac(6')-Iih from E. hirae. The nucleotide sequences of the aac(6')-Iih and aac(6')-Iid genes have been deposited in the EMBL Nucleotide Sequence Database under the accession numbers AJ584700 [GenBank] and AJ584701 [GenBank] , respectively.

The deduced amino acid sequences for AAC(6')-Iih and AAC(6')-Iid are compared with that of AAC(6')-Ii in Figure 1. Sequence homologies were 65% and 68% between E. faecium and E. hirae or E. durans, respectively, and 76% between E. durans and E. hirae. All three motifs involved in the antibiotic binding domain were highly conserved in the three enzymes: the hydrophobic region located in position 70 to 77 (GWELHPLV), the region between amino acids 86 and 98 that corresponded to the sequence QI/VGTRLVS/NYLEKE, and the region from amino acid 147 to 154 (E/TFYEKLGY).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1.. Amino acid sequences of AAC(6')-Ii from E. faecium, AAC(6')-Iid from E. durans and AAC(6')-Iih from E. hirae.

 
Dot-blot hybridization assays were performed to evaluate the species-specificity of aac(6')-Iih and aac(6')-Iid, using total DNA from E. faecalis (n=10), E. faecium (n=10), E. durans (n=3) and E. hirae (n=8) isolates. Internal fragments of 270 bp obtained from E. hirae AR25, E. durans AR23 and E. faecium RC714 strains were used as templates. Positive hybridization was observed in the E. faecium, E. durans or E. hirae strains when the correspondent probes obtained from each species were applied; however, no cross-hybridization between the different species was observed. Negative amplifications were consistently obtained when total DNA from E. faecalis JH2-2 and ATCC 29212 strains was tested. This suggests that the AAC(6')-Ii-like proteins might have originated very early in a common enterococcal ancestor, and then were later deleted in E. faecalis evolution.

In summary, new aac(6')-Ii-like genes have been characterized in E. hirae and E. durans. The presence of these genes precludes the synergy between tobramycin or kanamycin/amikacin, and ß-lactams, even though the strains can be categorized as non-high-level-resistant to aminoglycosides in conventional susceptibility testing studies. These results indicate that, except for the case of E. faecalis, association of ß-lactams with tobramycin and kanamycin/amikacin should not be recommended in the therapy of enterococcal infections.

Acknowledgements

Part of this work was presented at the 12th ESCMID meeting (Milan 2002) and at the 43rd ICAAC meeting (Chicago 2003). This work was supported in part by the Red Temática REIPI C03/14 from the Instituto Carlos III and by grant FIS 00/545 from the Ministerio de Sanidad from Spain.

References

1 . Costa Y, Galimand M, Leclercq R et al. Characterization of the chromosomal aac(6')-Ii gene specific for Enterococcus faecium. Antimicrob Agents Chemother 1993; 37: 1896–903.[Abstract/Free Full Text]

2 . Devriese LA, Hommez J, Wijfels R et al. Composition of the enterococcal and streptococcal intestinal flora of poultry. J Appl Bacteriol 1991; 71: 46–51.[Medline]

3 . Mangan MW, McNamara EB, Smyth EG et al. Molecular genetic analysis of high-level gentamicin resistance in Enterococcus hirae. J Antimicrob Chemother 1997; 40: 377–82.[Abstract/Free Full Text]

4 . Vanhoof R, Hannecart-Pokorni E, Content J. Nomenclature of genes encoding aminoglycoside-modifying enzymes. Antimicrob Agents Chemother 1998; 42: 483.[Free Full Text]

5 . Robredo, B., Singh, K.V., Torres, C. et al. Identification to the species level by PCR of Enterococcus hirae and Enterococcus durans. In: Program and Abstracts of the Thirty-ninth Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, CA, 1999. Abstract 1576, p. 228. American Society for Microbiology, Washington, DC, USA.

6 . Sahm DF, Torres C. High-content aminoglycoside disks for determining aminoglycoside-penicillin synergy against Enterococcus faecalis. J Clin Microbiol 1988; 26: 257–60.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
55/6/1053    most recent
dki138v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by del Campo, R.
Right arrow Articles by Baquero, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by del Campo, R.
Right arrow Articles by Baquero, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?