Skip Navigation


JAC Advance Access originally published online on January 19, 2005
Journal of Antimicrobial Chemotherapy 2005 55(3):293-300; doi:10.1093/jac/dkh525
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
55/3/293    most recent
dkh525v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Werber, S.
Right arrow Articles by Blau, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Werber, S.
Right arrow Articles by Blau, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

JAC vol.55 no.3 © The British Society for Antimicrobial Chemotherapy 2005; all rights reserved

Moxifloxacin inhibits cytokine-induced MAP kinase and NF-{kappa}B activation as well as nitric oxide synthesis in a human respiratory epithelial cell line

Sara Werber1, Itamar Shalit2, Ina Fabian1, Guy Steuer3, Taly Weiss1 and Hannah Blau2,*

1 Department of Cell Biology and Histology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv; 2 Schneider Children's Medical Centre of Israel and Sackler School of Medicine, Tel-Aviv University, Tel-Aviv; 3 Paediatric Department, Assaf Harofeh Medical Centre and Sackler School of Medicine, Tel-Aviv University, Tel-Aviv, Israel


* Correspondence address. Pulmonary Unit and Graub Cystic Fibrosis Centre, Schneider Children's Medical Centre of Israel, 14 Kaplan Street, Petah Tikva, 49202, Israel. Tel: +972-3-9253654; Fax: +972-3-9253147; Email: hblau{at}post.tau.ac.il

Received 9 June 2004; returned 26 July 2004; revised 11 September 2004; accepted 7 November 2004


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Background: We previously demonstrated that the quinolone moxifloxacin prevents Candida albicans pneumonitis and epithelial nuclear factor {kappa}B (NF-{kappa}B) nuclear translocation in immunosuppressed mice.

Objectives: To explore the anti-inflammatory effects of moxifloxacin directly on a lung epithelial cell line.

Methods: We studied the effect of clinically relevant concentrations of moxifloxacin (2.5–10 mg/L) on cytokine-induced activation of nitric oxide (NO) secretion, inducible NO synthase (iNOS) expression and the activation of signal transduction pathways of inflammation, NF-{kappa}B and the mitogen-activated protein kinases [extracellular signal-regulated kinases (ERK1/2) and C-Jun N-terminal kinase (JNK)], in the A549 lung epithelial cell line.

Results: Stimulation with the cytokines interleukin-1ß(IL-1ß)/interferon-{gamma} (IFN-{gamma}) increased NO up to 3.3-fold and moxifloxacin inhibited this up to 68% (P < 0.05). Similarly, the increase in iNOS levels was inhibited in cells pre-treated with moxifloxacin by up to 62%. IL-1ß stimulated a rapid increase in the activities of early intracellular signalling molecules, ERK1/2 and JNK. Moxifloxacin inhibited ERK1/2 by up to 100% and p-JNK activation by 100%. NF-{kappa}B, as measured by electrophoretic mobility shift assay, was inhibited up to 72% by moxifloxacin. Western-blot analysis revealed that IL-1ß enhanced NF-{kappa}B p65 and p50 proteins by 1.7- and 3.6-fold, respectively, whereas moxifloxacin inhibited the proteins by up to 60%.

Conclusions: Moxifloxacin inhibits intracellular signalling, iNOS expression and NO secretion in a lung epithelial cell line. Future studies may uncover a primary site of quinolone immunomodulation, either upstream or at the cell membrane. Eventually, this quinolone might become an important therapy for inflammatory lung diseases.

Keywords: quinolone , immunomodulation , intracellular signalling pathways , lung inflammation , A549 cells


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Inhibitors of inflammation would be clinically useful for treating acute lung injury and many chronic lung diseases. Certain fluoroquinolones, in addition to their broad-spectrum of antimicrobial activity, have been shown to have protective immunomodulatory properties, both in human disease and in animal models.1 The fluoroquinolone moxifloxacin, which is in common clinical use, has recently demonstrated immunomodulatory effects in both animal models and in vitro studies.2 Some of the studies have described significant anti-inflammatory effects of moxifloxacin in vitro, demonstrating inhibition of pro-inflammatory cytokine production by human neutrophils3 and monocytes stimulated in vitro with lipopolysaccharide.4

In a recent study, we showed that cyclophosphamide-injected mice inoculated intratracheally with Candida albicans, when pre-treated with moxifloxacin, were protected from the severe bronchopneumonia and massive neutrophilic infiltration that developed in control animals. In addition, moxifloxacin prevented pro-inflammatory cytokine secretion in lung tissue, despite no direct antifungal effect.5 Immunohistochemical staining of lungs from control mice showed nuclear factor {kappa}B (NF-{kappa}B) translocation in inflammatory cells and in 50% of lung epithelial cells, which was completely prevented in animals pre-treated with moxifloxacin.6 The lack of antifungal effects of moxifloxacin suggest that its efficacy is most likely due to protective anti-inflammatory activity in this model.

The pulmonary epithelium, once considered a passive physiological barrier, is now known to play a central role in the innate immune response of the lung,7 orchestrating the excessive immune response that characterizes acute lung injury and inflammatory lung diseases.8,9 Epithelial cells are activated directly by infectious insults10 and soluble mediators11 to secrete pro-inflammatory cytokines in response to intracellular signalling molecules, including mitogen-activated protein kinases (MAPKs) and the transcription factor NF-{kappa}B.12

Nitric oxide (NO), a short-lived biological molecule, is considered a major marker of inflammatory lung diseases, including asthma, adult respiratory distress syndrome and lung fibrosis.13,14 Respiratory epithelium appears to be its major source,15,16 following activation of inducible NO synthase (iNOS).17,18 iNOS-deficient mice are protected from ozone-induced lung injury19 and recently oligonucleotide microarray analysis of global inflammatory lung gene expression induced by lipopolysaccharide in wild-type and NOS2–/– mice revealed the responsiveness of the latter to be markedly low.20

Human iNOS production, as well as numerous inflammatory cytokines in the lung, are dependent upon MAPK and NF-{kappa}B pathways.21,22 NF-{kappa}B comprises specific heterodimeric complexes present in an inactive form in the cytoplasm of resting cells, where each is bound to one of the inhibitor (I)-{kappa}B proteins. Stimulus-induced activation of the NF-{kappa}B-inducing kinase leads to phosphorylation of the I-{kappa}B kinase complexes (reviewed in ref. 23) followed by ubiquitination and proteasome-mediated degradation of I-{kappa}B, which frees NF-{kappa}B to translocate to the nucleus. In development of acute lung injury, NF-{kappa}B in the nucleus interacts with its target motifs and regulates secretion of various chemokines, including iNOS.24 Recently, the iNOS gene was further identified as a new target regulated by C-Jun N-terminal kinase (JNK) in microglial cells.25 Other studies have shown that extracellular signal-regulated kinases ERK1/2 are needed for interleukin-1ß (IL-1ß) to induce persistent activation of NF-{kappa}B, required for the subsequent expression of iNOS.26 Similarly, in human alveolar epithelial cells, ERK-dependent pathways activate the human iNOS promoter.27

In the present study, we sought to investigate further the anti-inflammatory effects of moxifloxacin on pulmonary epithelial cells. Using the human alveolar epithelial cell line, A549, stimulated with pro-inflammatory mediators IL-1ß and interferon-{gamma} (IFN-{gamma}), we studied the effect of moxifloxacin on human iNOS expression, NO secretion, as well as on activation of the two major signal transduction pathways: NF-{kappa}B, and the MAPKs ERK and JNK, known to be involved in the regulation of this pro-inflammatory molecule.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cell culture studies

An immortal Type II alveolar cell line of human origin (A549) was obtained from the American Type Culture Collection (ATCC) and maintained as described previously.11 Briefly, the cells were seeded at 4 x 104 cells/cm2 and grown in F-12 medium (Biol. Industries, Beit Haemek, Israel) supplemented with 10% heat inactivated fetal calf serum (FCS) (Hyclone Laboratories, Logan UT, USA), 2 mM L-glutamine, 100 units/mL penicillin and 100 µg/mL streptomycin, at 37°C in a humidified incubator with 5% CO2 until they reached confluence.

Exposure to serum-free medium, cytokines and moxifloxacin

A549 cells (1 x 106 cells/mL) suspended in F-12 medium supplemented with 10% FCS were placed in 24-well culture plates and incubated for 24 h for adherence. Cells were then transferred to serum-free medium. In vivo research indicates that moxifloxacin exerts pronounced protective anti-inflammatory effects when administered as pre-treatment to immunosuppressed animals.2,5 We therefore pre-incubated the A549 cells with various concentrations (2.5–10 mg/L) of moxifloxacin (Bayer AG, Wuppertal, Germany) in serum-free medium, for 24 h prior to addition of cytokines.11 Moxifloxacin (2.5–10 mg/L) did not affect the viability of A549 cells (Trypan Blue test) (data not shown). As a synergic action of both IL-1ß and IFN-{gamma} is required to activate iNOS and increase NO production within lung epithelial cells,11,22 we used both stimuli in these experiments. A549 cells (1 x 106 cells/mL) pre-incubated with moxifloxacin were exposed to IL-1ß/IFN-{gamma} at a concentration of 100 ng/mL each and incubated for 12–24 h for iNOS determination. In experiments on NF-{kappa}B and MAPK activation, IL-1ß is the direct stimulus, and IFN-{gamma} has no further direct role. Thus, all further studies used IL-1ß alone (1 ng/mL) for 5–60 min, as described in the literature.26

NO assay

A549 cells pre-incubated with moxifloxacin (5–10 mg/L) were exposed to IL-1ß/IFN-{gamma} at a concentration of 100 ng/mL (each cytokine) and incubated for 24 h. Serum was returned to the culture medium and cells were incubated for an additional 24–72 h.11 In control cultures, serum was added to the cells grown without cytokines or quinolone and incubated as above. In preliminary experiments, cells were pre-incubated with moxifloxacin, ciprofloxacin (Bayer AG, Wuppertal, Germany) or ofloxacin (Hoechst AG, Germany), all at doses of 5 and 10 mg/L and compared with control cells. The quinolones did not affect cell viability (Trypan Blue test). We found that inhibition of NO production was maximal with moxifloxacin, was less than half with ciprofloxacin and that there was no inhibition at all with ofloxacin. We therefore chose to proceed with moxifloxacin alone in order to examine further the findings in our previous in vivo studies.5,6

NO, quantified by the accumulation of nitrate in the culture medium, was measured using the Greiss reaction, as previously described by us.28 Sodium nitrite was used as the standard. Briefly, 50 µL of culture medium was mixed with 50 µL of Greiss reagents and incubated at room temperature (RT) for 10 min. The absorbance at 550 nm was measured in a microplate reader. Data are presented as µM nitrite.

Preparation of cytosolic extracts and western-blot analysis of iNOS, ERK and JNK

Following incubation, cytosolic extracts were prepared as previously described.11 In brief: the cells were collected on ice, washed twice with ice-cold phosphate buffered saline (PBS) and suspended in 100 µL of the lysis buffer. The lysis buffer for iNOS was: 10 mM HEPES-KOH pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 1 mM dithiothreitol (DTT), 1 mM phenylmethanesulphonyl fluoride (PMSF) and 1:100 protease inhibitors.11 After being kept on ice for 15 min the lysates were vigorously mixed, Nonidet P40 (NP40) was added to a final concentration of 0.6% (v/v), and nuclei were pelleted by centrifugation (5000g) at 4°C for 5 min. To prepare cytosolic extracts for ERK and JNK the lysis buffer used was: 50 mM Tris pH 7.6, 150 mM NaCl, 5 mM EDTA pH 8, 0.5% NP40, 2 mM p-nitrophenyl phosphate (PNPP), 1 mM Na3VO4, 20 mM ß-glycerophosphate, 1 mM PMSF and 1:100 protease inhibitors.29 After being kept on ice for 15 min, the lysates were subjected to centrifugation (5000g) at 4°C for 15 min. The protein concentration was measured (using the Bradford reaction) before storage at –70°C. An aliquot of the cytosolic fraction containing 30 µg of protein for iNOS and 50 µg of protein for ERK and JNK was resolved by 10% SDS-polyacrylamide gel. After electrophoresis and electrophoretic transfer of proteins to nitrocellulose membrane (Bio-Rad, Munich, Germany), the membranes were blocked with 3% non-fat milk in Tris-buffered saline (pH 7.4) containing 0.1% Tween (TBST) for 1 h. Membranes were then rinsed three times in TBST and incubated at RT with rabbit polyclonal antibody (Ab) against iNOS (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) or mouse monoclonal anti-MAPK, activated (di-phosphorylated ERK-1/2) Ab (Sigma Chemical Co. St Louis, MO, USA) and anti-phospho-JNK Ab (from New England Biolabs, Beverly, MA, USA) (1:3000 dilution), and with anti-ERK-1/2 Ab and anti-JNK Ab (1:1000 dilution) for 1 h. Actin levels were also assessed as a loading control using an Ab (Santa Cruz Biotechnology) that reacts with a broad range of actin isoforms. The blots were then incubated with a secondary antibody, horseradish peroxidase-linked anti-rabbit IgG (Santa Cruz Biotechnology) or anti-mouse IgG, respectively, as previously described.29 After 1 h at RT and three washes in TBST, blots were incubated in enhanced chemiluminescence reagent (ECL, Amersham Pharmacia Biotech). Relative density values of iNOS, ERK1/2 and JNK were determined by densitometric analysis followed by photographing the specific bands (Kodak XLS-1 film).

Electrophoretic mobility shift assay (EMSA) of NF-{kappa}B

A549 cells (6 x 105 cells/mL) pre-incubated with 2.5 or 5 mg/L moxifloxacin were exposed to IL-1ß (1 ng/mL) for 30 or 60 min. Following incubation, the cells were collected on ice before isolation of nuclear extracts according to the protocol reported by Aikawa et al.30 Briefly, the cells (15 x 106 cells/sample) were washed with ice-cold PBS, suspended in 400 µL of lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.75 mM spermidine, 0.15 mM spermine, 20 mM PNPP, 20 mM ß-glycerophosphate, 1 mM Na3VO4, 1 mM PMSF, 1:100 protease inhibitor) and allowed to swell on ice for 15 min, after which 25.5 µL of 10% NP40 was added. The tubes were kept on ice for 5 min prior to centrifugation (20 000g) at 4°C for 8 min. The obtained nuclear pellets were re-suspended in 80 µL of ice-cold nuclear extraction buffer (20 mM HEPES pH 7.9, 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 0.75 mM spermidine, 0.15 mM spermine, 20 mM PNPP, 20 mM ß-glycerophosphate, 1 mM Na3VO4, 1 mM PMSF and 1:100 protease inhibitor). The samples were subjected to three cycles of freezing and thawing and the suspended nuclei were centrifuged (12 000g) for 15 min at 4°C. The supernatants were stored at –70°C after measurement of their protein content using the Bio-Rad protein assay kit, as described above. An NF-{kappa}B consensus is GGGAGGGGACTTTCCGAGAG (Santa Cruz Biotechnology). This oligonucleotide was radiolabelled using T4 polynucleotide kinase (Epicentre Technologies, Madison, WI, USA) and [{gamma}-32P]ATP (Sigma Chemical Co.) before being annealed to oligonucleotides of complementary sequence. A binding reaction buffer was used to optimize NF-{kappa}B binding (10 mM Tris/HCl pH 7.5, 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 19% glycerol, 1 mM PMSF and 1 µg/mL each of leopeptin, aprotonin, antipain and pepstatin A).30 Binding reactions (20 µL) were prepared containing 8 µg of nuclear extract, 0.5 ng of 32P-labelled double-stranded oligonucleotide and 1 µg of poly(dI-dC). The tubes were incubated at RT before electrophoresis through 5%, 1 x TGE (5xTGE:250 mM Tris, 20 mM glycine, 10 mM EDTA) polyacrylamide gels. For competition assays, pre-incubation at RT for 30 min with a 100-fold molar excess of competitor was carried out before the addition of the labelled oligonucleotides. Gels were dried under vacuum and exposed at –70°C with intensifying screens. Relative density values of NF-{kappa}B were determined by densitometric analysis followed by photographing the specific bands (Kodak XLS-1 film). When supershift assays were performed, polyclonal antibodies specific for p65 or p50 (Santa Cruz Biotechnology) were added to the nuclear extracts 30 min before the binding reaction, and the DNA–nuclear protein complexes were separated on a 5% polyacrylamide gel.

Western-blot analysis of NF-{kappa}B

Nuclear extracts used in the western-blot analyses were prepared as described above. An aliquot of the nuclear fraction containing 50 µg of protein for NF-{kappa}B was resolved by 10% SDS-polyacrylamide gel, as described above. NF-{kappa}B was detected by incubating blots with anti-NF-{kappa}B p65 and anti-NF-{kappa}B p50 rabbit polyclonal Abs (Santa Cruz Biotechnology, diluted 1:500). The blots were then incubated with a secondary Ab, horseradish peroxidase-linked anti-rabbit IgG (Santa Cruz Biotechnology). After 1 h at RT and three washes in TBST, blots were incubated in enhanced chemiluminescence reagent (ECL, Amersham Pharmacia Biotech).

Statistical significance was determined by using a paired t-test.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Moxifloxacin inhibits cytokine-induced NO production

A549 cells were stimulated with IL-1ß/IFN-{gamma}, to produce NO (Figure 1). The addition of IL-1ß/IFN-{gamma} induced a marked and significant increase in NO production that was time-dependent. Maximal increase was observed following 96 h of incubation (3.3-fold increase compared with cells incubated in medium only for the same time). There was a significant concentration-dependent inhibition of NO secretion of up to 68% when cells were pre-treated with moxifloxacin (P < 0.05). A milder inhibition (21% at 96 h) was observed when moxifloxacin was added to the cells concomitantly with the cytokines (data not shown).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1.. Effect of moxifloxacin (MXF) on NO production by A549 cells grown in serum-free medium in the presence or absence of IL-1ß/IFN-{gamma} (100 ng/mL each cytokine). A549 cells (1 x 106 cells/ml) were pre-incubated in serum-free medium for 24 h in the absence or presence of MXF (5–10 mg/L), then exposed to IL-1ß/IFN-{gamma} and further incubated as indicated. Results are expressed as means ± S.E.M. of three experiments performed in triplicate. *P < 0.05, MXF-treated cells compared with controls. **P < 0.05, MXF 10 mg/L compared with 5 mg/L as well as compared with controls.

 
Moxifloxacin inhibits IL-1ß/IFN-{gamma}-induced iNOS expression

Our data demonstrate that IL-1ß/IFN-{gamma} increased iNOS levels within 12 h following exposure to cytokines while after 24 h there was a decline in iNOS levels (Figure 2a). Moxifloxacin at concentrations of 5 mg/L and 10 mg/L inhibited the increase in iNOS levels (measured after 12 h of incubation with the cytokines) by 62 ± 20% and 34 ± 3%, respectively) as determined by densitometric analysis (Figure 2b and c) (P < 0.05). These results suggest that the inhibition of NO production observed is due to a decrease in iNOS levels following exposure to moxifloxacin.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2.. Effect of moxifloxacin (MXF) on the kinetics of iNOS expression in IL-1ß/IFN-{gamma}-stimulated A549 cells. (a). Time-dependent studies. A549 cells (1 x 106 cells/mL) were pre-incubated for 24 h in serum-free medium then exposed to 100 ng/mL IL-1ß/IFN-{gamma} and further incubated as indicated. The cytoplasmic extracts were prepared and assayed for iNOS by western-blot analysis (upper blot) and actin (lower blot). (b) A549 cells were pre-incubated in serum-free medium for 24 h in the absence or presence of 5–10 mg/L MXF and then treated with 100 ng/mL IL-1ß/IFN-{gamma} for 12 h. Control cells were incubated for 12 h in the absence of cytokines. The cytoplasmic extracts were prepared and assayed for iNOS by western-blot analysis (upper blot) and actin (lower blot). (c) The densitometric analysis of westernblots from three experiments are shown. *P < 0.05.

 
Effect of moxifloxacin on MAPK activation in IL-1ß-stimulated A549 cells

MAP kinases are important mediators involved in the intracellular network of proteins that transduce extra cellular cues to intracellular responses. To determine whether ERK and JNK MAPK pathways are involved in IL-1ß-stimulated A549 cell responses, we examined the activation of these MAP kinases by detecting their phosphorylated forms, using immunoblot analyses with specific antibodies.

IL-1ß strongly stimulated rapid and transient increases in ERK1/2 and JNK activities, which peaked at 15 min and then declined to basal levels (Figure 3a). Pre-incubation with moxifloxacin at concentrations of 2.5, 5 and 10 mg/L inhibited p-ERK1/2 activation stimulated by IL-1ß by 100%, 100% and 64%, respectively (Figure 3b and c). Moxifloxacin, at a concentration of 10 mg/L, inhibited p-JNK activation due to IL-1ß by 100%, whereas lower concentrations of moxifloxacin did not inhibit p-JNK activation (Figure 3b and d).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3.. Effect of moxifloxacin (MXF) on the activation of ERK and JNK. (a) Time-dependent studies. A549 cells were pre-incubated for 24 h in serum-free medium followed by the addition of IL-1ß (1 ng/mL) for the indicated times. Cytoplasmic extracts were prepared and subjected to western immunoblotting using an antibody specific for phosphorylated forms of ERK1/2 and JNK (p-ERK1/2 and p-JNK) and for ERK1/2 and JNK, respectively. (b) Effect of MXF on IL-1ß-induced ERK1/2 and JNK activation. A549 cells were pre-incubated for 24 h in serum-free medium in the absence (lanes 1 and 2) or presence (lanes 3–5) of the indicated concentrations of MXF. IL-1ß (1 ng/mL) was added (lanes 2–5) and the cells were incubated for 15 min. Cytoplasmic extracts were prepared and subjected to western immunoblotting using antibodies as described in (a). (c) Densitometric analysis of p-ERK1/2. Mean results of three experiments are shown. (d) Densitometric analysis of p-JNK. Mean results of two experiments are shown.

 
Effect of moxifloxacin on IL-1ß-induced NF-{kappa}B activation (EMSA and western blot)

The effect of moxifloxacin on IL-1ß-induced activation of NF-{kappa}B was evaluated by EMSA using the nuclear extracts from A549 cells. Cells alone showed no NF-{kappa}B activity (Figure 4, lane 1) whereas exposure to IL-1ß significantly induced NF-{kappa}B nuclear translocation in a time-dependent manner, occurring within 30 min and slightly declining by 60 min (Figure 4, lanes 2 and 3, respectively).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 4.. Kinetics of IL-1ß-induced NF-{kappa}B-specific DNA–protein complex formation, and NF-{kappa}B translocation. Time-dependent studies (lanes 1–3). A549 cells (6 x 105 cells/mL) were pre-incubated in serum-free medium for 24 h then treated with IL-1ß (1 ng/mL) for the indicated times. Nuclear extracts were prepared and assayed for NF-{kappa}B by EMSA on a 5% polyacrylamide gel using double-stranded oligonucleotide-containing an NF-{kappa}B consensus sequence. In lanes 4–8, cells were pre-incubated as above then treated with IL-1ß (1 ng/mL) for 30 min. Supershift assays were performed using 2 µg of the indicated antibodies as described in the Materials and methods section (lanes 4–6). Binding competition assays were performed with a non-specific inhibitor and a 100-fold excess of unlabelled NF-{kappa}B oligonucleotide as competitor (cold NF-{kappa}B) (lanes 7 and 8). The representative blots of two experiments are shown.

 
To identify the specific subunits involved in the formation of the banding pattern of the NF-{kappa}B dimer after stimulation, supershift assays were performed in the presence of antibodies specific for the p65 and p50 subunits. Figure 4, lanes 5 and 6, indicate that incubation with anti-p65 or anti-p50 antibodies induced a supershift (arrow a). These supershifts were specific for NF-{kappa}B consensus oligonucleotide, since excess cold competitor was able to compete out the signal, whereas a non-specific competitor could not (Figure 4, lanes 8 and 7, respectively). Next, the effect of moxifloxacin on IL-1ß-induced NF-{kappa}B activation was examined. Figure 5 indicates that pre-incubation with 2.5 or 5 mg/L moxifloxacin inhibited IL-1ß-induced NF-{kappa}B activation by 72% and 45%, respectively (Figure 5a, lanes 3 and 4, respectively). In order to detect whether moxifloxacin, while suppressing NF-{kappa}B DNA-binding activity induced by IL-1ß, also affects the expression of the p65 and p50 NF-{kappa}B proteins, western-blot analysis was performed (Figure 5b). Nuclear extracts isolated from cells pre-treated with moxifloxacin or medium and exposed to IL-1ß were analysed for p65 and p50 NF-{kappa}B proteins. Figure 5(b) shows that IL-1ß enhances the expression of p65 and p50 NF-{kappa}B proteins (1.7- and 3.6-fold increases, respectively) whereas pre-treatment with 2.5 and 5 mg/L moxifloxacin decreased the enhanced p65 protein expression by 50% and 60%, respectively, and that of p50 by 17% and 20%, respectively.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 5.. Effect of moxifloxacin (MXF) on IL-1ß-induced activation of NF-{kappa}B. (a) A549 cells (6 x 105 cells/mL) were pre-incubated in serum-free medium in the absence or presence of MXF for 24 h, then treated with IL-1ß for 30 min. Nuclear extracts were prepared and assayed for NF-{kappa}B (described in Figure 4). (b) Expression of p65 and p50 NF-{kappa}B proteins in IL-1ß-stimulated cells. Western blots illustrate the expression of p65 and p50 NF-{kappa}B proteins in nuclear extracts isolated from cells exposed to IL-1ß and pre-incubated in the absence or presence of MXF. The representative blots and densitometric analysis of western blots of two experiments are shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In our previous study of Candida pneumonitis in cyclophosphamide-treated mice, we found that pre-treatment with moxifloxacin had a protective anti-inflammatory effect on the infected mice and inhibited nuclear translocation of NF-{kappa}B within lung epithelial cells.6 To further explore this immunomodulatory effect of moxifloxacin, we investigated its effect on activation of NF-{kappa}B and pro-inflammatory intracellular signals in vitro. Signalling pathways have been studied in depth using the A549 lung epithelial cell line and we chose a similar dose of stimuli and time course as described by others.31,32

This study demonstrates that pre-treatment with the fluoroquinolone antibiotic moxifloxacin significantly inhibits NO secretion by the human alveolar epithelial cell line A549, stimulated with the pro-inflammatory cytokines IL-1ß and IFN-{gamma} (Figure 1). It also inhibits the increased synthesis of iNOS by activated A549 cells (Figure 2). The different incubation times for peak iNOS expression (12 h) compared with NO production (96 h) have been well described by others.11,15 The inactive iNOS monomer protein must undergo conformational change to produce the active dimer, which then converts L-arginine into L-citrulline and finally releases NO.33 In addition, NO may itself provide a self-amplifying signal, resulting in continued increase in production up to 96 h.34

Importantly, moxifloxacin inhibits activation of early intracellular signalling events associated with the inflammatory response, in this pulmonary epithelial cell line. To our knowledge, this is the first study to describe inhibition by quinolones of ERK, JNK and NF-{kappa}B activation, as well as of NO secretion in epithelial cells.

These findings are consistent with an increasing body of evidence describing immunomodulatory functions of fluoroquinolones.1 Attenuation of pro-inflammatory cytokine synthesis has been described, generally in monocytes and other leucocytes, both in vitro and in vivo.3,4 To date, only one study has shown direct immunomodulation of airway epithelial cytokine secretion by a quinolone.35 We demonstrated that immunomodulatory effects of moxifloxacin are not restricted to leucocytes. It appears that common intracellular pro-inflammatory pathways are affected by moxifloxacin in lung epithelium and other cell types.

In the present study, moxifloxacin inhibited IL-1ß-induced NF-{kappa}B nuclear translocation and DNA-binding activity (Figure 5a) at the concentration range required for the inhibition of iNOS expression and NO production. A recent study showed that NF-{kappa}B was essential but not sufficient for IL-1ß induction of iNOS gene expression in vascular smooth muscle cells.26 The MAPK ERK was an important temporal regulator resulting in prolonged NF-{kappa}B activation, required for iNOS expression. The addition of the selective ERK inhibitors PD98059 or U0126 inhibited IL-1ß-induced ERK activation and iNOS expression. We have demonstrated that both p-ERK 42 kDa and p-ERK 44 kDa expressions were similarly increased by IL-1ß in A549 cells and that this was inhibited significantly by moxifloxacin. Our studies are consistent with Han et al.36 who have shown that phorbol myristate acetate (PMA) and IFN-{gamma} synergically stimulate iNOS expression, mediated through NF-{kappa}B and ERK in microglial cells. ERK appears to be an early biochemical event, which can act synergically with NF-{kappa}B upon the iNOS gene promoter. This study is the first to describe moxifloxacin inhibition of ERK phosphorylation in A549 cells. The inhibition of ERK activation could explain, at least in part, the inhibitory effects of moxifloxacin on iNOS synthesis and NO secretion by IL-1ß and IFN-{gamma}-stimulated A549 cells.

Other MAP kinases, including JNK, are known to participate in the intricate pathways of iNOS, in concert with NF-{kappa}B and ERK.25 A recent study showed a reduction in iNOS mRNA levels, 8 h after the addition of a JNK inhibitor (SP600125) to lipopolysaccharide-stimulated macrophages.37 In the present study, IL-1ß induced the activation of p-JNK 46 kDa activities and pre-incubation with moxifloxacin inhibited this activation.

Within lung epithelial cells, synergic action of both IL-1ß and IFN-{gamma} are required to activate iNOS and increase NO production. Neither pro-inflammatory stimulus alone is sufficient.11 An interesting study recently demonstrated that synergic stimuli of iNOS in microglial cells require the cooperative interaction of multiple signalling pathways involving ERK, NF-{kappa}B and interferon regulatory factor-1 (IRF-1).36 Analysis of the iNOS gene promoter indicates the requirement for upstream and downstream NF-{kappa}B, as well as IRF-1 binding sites. The particular MAPK signalling pathways involved in iNOS gene regulation appear to depend on the cell type and stimulus and have not yet been fully delineated in lung epithelial cells.

The role of moxifloxacin in the inhibition of inflammatory responses seems to occur at the earliest stages of ‘priming’. Previous studies, both in vivo and in vitro, show that cells or animals must be pre-treated with moxifloxacin (reviewed in ref. 1). Similarly, in our present studies, moxifloxacin was applied before the pro-inflammatory stimulus.

Our previous in vivo studies6 and present in vitro data expand current understanding of the immunomodulatory role of moxifloxacin, by directly demonstrating the two major intracellular signalling pathways in inflammatory gene transduction, which are suppressed by moxifloxacin. In addition, for the first time, a direct effect has been demonstrated by moxifloxacin on the synthesis of the central pro-inflammatory molecule, NO.

Future studies may elucidate a common target, upstream to the signalling pathways demonstrated here, within the cell or at the cell membrane, which will prove to be the primary site of quinolone anti-inflammatory activity. Eventually, clinical studies might combine the antibiotic and anti-inflammatory roles of moxifloxacin for both prophylaxis against acute infections in immunosuppressed hosts and in the treatment of chronic inflammatory lung disease.


    Acknowledgements
 
We are thankful to Nir Weizman for his help in the EMSA assay technique.

This work was supported by a grant from Bayer AG, Wuppertal, Germany


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1 . Dalhoff, A. & Shalit, I. (2003). Immunomodulatory effects of quinolones. Lancet Infectious Disease 3, 359–71.

2 . Shalit, I., Kletter, Y., Halperin, D. et al. (2000). Immunologic effects of moxifloxacin in comparison to ciprofloxacin and G-CSF in a murine model of cyclophosphamide induced leukopenia. European Journal of Haematology 66, 287–96.

3 . Williams, A. C., Galley, H. F. & Webster, N. R. (2001). The effect of moxifloxacin on release of interleukin-8 from human neutrophils. British Journal of Anaesthesia 87, 671–2.

4 . Araujo, F. G., Slifer, T. L. & Remington, J. S. (2002). Effect of moxifloxacin on secretion of cytokines by human monocytes stimulated with lipopolysaccharide. Clinical Microbiology and Infection 8, 26–30.[CrossRef][ISI][Medline]

5 . Shalit, I., Horev, L., Fabian, I. et al. (2002). Immunomodulatory and protective effects of moxifloxacin against Candida albicans induced bronchopneumonia in cyclophosphamide injected mice. Antimicrobial Agents and Chemotherapy 46, 2442–9.[Abstract/Free Full Text]

6 . Blau, H., Fabian, I., Kletter, Y. et al. (2002). Protective immunomodulation by moxifloxacin against Candida albicans lung infection in cyclophosphamide treated mice: suppression of TNF-{alpha}, interleukin 8 and NF{kappa}B activation. American Journal of Respiratory and Critical Care Medicine 165, A782.

7 . Diamond, G., Legarda, D. & Ryan, L. K. (2000). The innate immune response of the respiratory epithelium. Immunological Reviews 173, 27–38.[CrossRef][ISI][Medline]

8 . Bals, R. & Hiemstra, P. S. (2004). Innate immunity in the lung: how epithelial cells fight against respiratory pathogens. European Respiratory Journal 23, 327–33.[Abstract/Free Full Text]

9 . Polito, A. J. & Proud, D. (1998). Epithelial cells as regulators of airway inflammation. Journal of Allergy and Clinical Immunology 102, 714–8.[CrossRef][ISI][Medline]

10 . Rose, F., Dahlem, G., Guthmann, B. et al. (2002). Mediator generation and signaling events in alveolar epithelial cells attacked by S. aureus alpha-toxin. American Journal of Physiology: Lung Cellular and Molecular Physiology 282, L207–14.[Abstract/Free Full Text]

11 . Kwon, S., Newcomb, R. L. & George, S. C. (2001). Mechanisms of synergistic cytokine-induced nitric oxide production in human alveolar epithelial cells. Nitric Oxide 5, 534–46.[CrossRef][ISI][Medline]

12 . Tamanini, A., Rolfini, R., Nicolis, E. et al. (2003). MAP kinases and NF-{kappa}B collaborate to induce ICAM-1 gene expression in the early phase of adenovirus infection. Virology 307, 228–42.[CrossRef][ISI][Medline]

13 . Barnes, P. J. (1995). Nitric oxide and airway disease. Annals of Medicine 27, 389–93.[ISI][Medline]

14 . Beckman, J. S. & Koppenol, W. H. (1996). Nitric oxide, superoxide and peroxynitrite: the good, the bad and the ugly. American Journal of Physiology 271, C1424–37.

15 . Gutierrez, H. H., Pitt, B. R., Schwarz, M. et al. (1995). Pulmonary alveolar epithelial inducible NO synthase gene expression: regulation by inflammatory mediators. American Journal of Physiology 268, L501–8.

16 . Goodrum, K. J. & Poulson-Dunlap, J. (2002). Cytokine responses to group B streptococci induce nitric oxide production in respiratory epithelial cells. Infection and Immunity 70, 49–54.[Abstract/Free Full Text]

17 . Kristof, A. S., Goldberg, P., Laubach, V. et al. (1998). Role of inducible nitric oxide synthase in endotoxin-induced acute lung injury. American Journal of Respiratory and Critical Care Medicine 158, 1883–9.[Abstract/Free Full Text]

18 . Srivastava, K. D., Rom, W. N., Jagirdar, J. et al. (2002). Crucial role of interleukin-1ß and nitric oxide synthase in silica-induced inflammation and apoptosis in mice. American Journal of Respiratory and Critical Care Medicine 165, 527–33.[Abstract/Free Full Text]

19 . Fakhrzadeh, L., Laskin, J. D. & Laskin, D. L. (2002). Deficiency in inducible nitric oxide synthase protects mice from ozone-induced lung inflammation and tissue injury. American Journal of Respiratory Cell and Molecular Biology 26, 413–9.[Abstract/Free Full Text]

20 . Okamoto, T., Gohil, K., Finkelstein, E. I. et al. (2004). Multiple contributing roles for NOS2 in LPS-induced acute airway inflammation in mice. American Journal of Physiology: Lung Cellular and Molecular Physiology 286, L198–L209.[Abstract/Free Full Text]

21 . Adcock, I. M., Brown, C. R., Kwon, O. et al. (1994). Oxidative stress induces NF{kappa}B DNA binding and inducible NOS mRNA in human epithelial cells. Biochemical and Biophysical Research Communications 199, 1518–24.[CrossRef][ISI][Medline]

22 . Ganster, R. W., Taylor, B. S., Shao, L. et al. (2001). Complex regulation of human inducible nitric oxide synthase gene transcription by Stat 1 and NF-{kappa}B. Proceedings of the National Academy of Sciences, USA 98, 8638–43.[Abstract/Free Full Text]

23 . Karin, M. & Ben-Neriah, Y. (2000). Phosphorylation meets ubiquitination: the control of NF-{kappa}B activity. Annual Review of Immunology 18, 621–63.[CrossRef][ISI][Medline]

24 . Fan, J., Ye, R. D. & Malik, A. B. (2001). Transcriptional mechanisms of acute lung injury. American Journal of Physiology: Lung Cellular and Molecular Physiology 281, L1037–50.[Abstract/Free Full Text]

25 . Wang, M. J., Jeng, K. C., Kuo, J. S. et al. (2004). c-Jun N-terminal kinase and, to a lesser extent, p38 mitogen-activated protein kinase regulate inducible nitric oxide synthase expression in hyaluronan fragments-stimulated BV-2 microglia. Journal of Neuroimmunology 146, 50–62.[CrossRef][ISI][Medline]

26 . Jiang, B., Xu, S., Hou, X. et al. (2004). Temporal control of NF-{kappa}B activation by ERK differentially regulates interleukin-1-ß-induced gene expression. Journal of Biological Chemistry 279, 1323–9.[Abstract/Free Full Text]

27 . Kristof, A. S., Marks-Konczalik, J. & Moss, J. (2001). Mitogen-activated protein kinases mediate activator protein-1-dependent human inducible nitric oxide synthase promoter activation. Journal of Biological Chemistry 276, 8445–52.[Abstract/Free Full Text]

28 . Blau, H., Riklis, S., Van Iwaarden, J. F. et al. (1997). Nitric oxide production by rat alveolar macrophages can be modulated in vitro by surfactant protein A. American Journal of Physiology 272, L1198–204.

29 . Pearl-Yafe, M., Halperin, D., Halevy, A. et al. (2003). An oxidative mechanism of interferon induced priming of the Fas pathway in Fanconi anemia cells. Biochemical Pharmacology 65, 833–42.[CrossRef][ISI][Medline]

30 . Aikawa, Y., Yamamoto, M., Yamamoto, T. et al. (2002). An anti-rheumatic agent T-614 inhibits NF-{kappa}B activation in LPS- and TNF-{alpha}-stimulated THP-1 cells without interfering with I{kappa}B{alpha} degradation. Inflammation Research 51, 188–94.[CrossRef][ISI][Medline]

31 . Chen, C.-C., Chen, J.-J. & Chou, C.-Y. (2000). Protein kinase C{alpha} but not p44/42 mitogen-activated protein kinase, p38, or c-Jun NH2-terminal kinase is required for intercellular adhesion molecule-1 expression mediated by interleukin-1ß: involvement of sequential activation of tyrosine kinase, nuclear factor-{kappa}B-inducing kinase, and I{kappa}B kinase 2. Molecular Pharmacology 58, 1479–89.

32 . Newton, R., Hart, L. A., Stevens, D. A. et al. (1998). Effect of dexamethasone on interleukin-1ß-(IL-1ß)-induced nuclear factor-{kappa}B (NF-{kappa}B) and {kappa}B-dependent transcription in epithelial cells. European Journal of Biochemistry 254, 81–9.[ISI][Medline]

33 . Kwon, S. & George, S. C. (1999). Synergistic cytokine-induced nitric oxide production in human alveolar epithelial cells. Nitric Oxide 3, 348–57.[CrossRef][ISI][Medline]

34 . Janssen-Heininger, Y. M. W., Poynter, M. E. & Baeuerle, P. A. (2000). Recent advances towards understanding redox mechanisms in the activation of nuclear factor {kappa}B. Free Radical Biology and Medicine 28, 1317–27.[CrossRef][ISI][Medline]

35 . Hashimoto, S., Matsumoto, K., Gon, Y. et al. (2000). Grepafloxacin inhibits tumor necrosis factor-{alpha}-induced interleukin-8 expression in human airway epithelial cells. Life Sciences 66, 77–82.[CrossRef][ISI][Medline]

36 . Han, I.-O., Kim, H.-S., Kim, H.-C. et al. (2003). Synergistic expression of inducible nitric oxide synthase by phorbol ester and interferon-{gamma} is mediated through NF-{kappa}B and ERK in microglial cells. Journal of Neuroscience Research 73, 659–66.[CrossRef][ISI][Medline]

37 . Lahti, A., Jalonen, U., Kankaanranta, H. et al. (2003). c-Jun NH2-terminal kinase inhibitor anthra(1,9-cd)pyrazol-6(2H)-one reduces inducible nitric-oxide synthase expression by destablilizing mRNA in activated macrophages. Molecular Pharmacology 64, 308–15.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. Chmura, X. Bai, M. Nakamura, P. Kandasamy, M. McGibney, K. Kuronuma, H. Mitsuzawa, D. R. Voelker, and E. D. Chan
Induction of IL-8 by Mycoplasma pneumoniae membrane in BEAS-2B cells
Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L220 - L230.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
J.-Z. Zhang and K. W. Ward
Besifloxacin, a novel fluoroquinolone antimicrobial agent, exhibits potent inhibition of pro-inflammatory cytokines in human THP-1 monocytes
J. Antimicrob. Chemother., January 1, 2008; 61(1): 111 - 116.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H. Blau, K. Klein, I. Shalit, D. Halperin, and I. Fabian
Moxifloxacin but not ciprofloxacin or azithromycin selectively inhibits IL-8, IL-6, ERK1/2, JNK, and NF-{kappa}B activation in a cystic fibrosis epithelial cell line
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L343 - L352.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
55/3/293    most recent
dkh525v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Werber, S.
Right arrow Articles by Blau, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Werber, S.
Right arrow Articles by Blau, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?