Skip Navigation


JAC Advance Access originally published online on November 5, 2004
Journal of Antimicrobial Chemotherapy 2004 54(6):1127-1129; doi:10.1093/jac/dkh476
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
54/6/1127    most recent
dkh476v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by O'Neill, A. J.
Right arrow Articles by Chopra, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O'Neill, A. J.
Right arrow Articles by Chopra, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

JAC vol.54 no.6 © The British Society for Antimicrobial Chemotherapy 2004; all rights reserved

Comparison of assays for detection of agents causing membrane damage in Staphylococcus aureus

Alexander John O'Neill1, Keith Miller1, Brunello Oliva2 and Ian Chopra1,*

1 Antimicrobial Research Centre and School of Biochemistry and Microbiology, University of Leeds, Leeds LS2 9JT, UK; 2 Department of Experimental Medicine, University of L'Aquila, Coppito—67100, L'Aquila, Italy

Received 10 August 2004; returned 16 September 2004; revised 21 September 2004; accepted 22 September 2004


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Objectives: To develop a novel ß-galactosidase leakage assay for Staphylococcus aureus and to evaluate this alongside other simple methods for detection of agents that cause membrane damage in staphylococci.

Methods: Using a PCR-based approach, a derivative of S. aureus RN4220 was constructed carrying the Escherichia coli lacZ gene under the control of the strong staphylococcal promoter, cap1A. Leakage of ß-galactosidase (BG) from this strain was examined after exposure for 10 min to various membrane-damaging agents at 4xMIC, using a fluorescence assay and the substrate 4-methylumbelliferyl-ß-D-galactoside. Other assays for membrane damage involving protoplast lysis (PL), leakage of material absorbing at 260 nm (OD) and ATP release as well as the BacLight (BL) assay were carried out using established methods.

Results: All the assays, with the exception of the PL assay, detected membrane damage induced by cetyltrimethylammonium bromide, nisin, clofazimine and protegrin IB-367. However, the ability to detect membrane damage induced by these agents differed between the assay systems. The assays also varied considerably in their signal-to-noise ratio, with the ATP assay providing values for nisin approaching 100-fold that of the control.

Conclusions: The PL assay is unsuitable for detection of membrane-damaging agents in S. aureus. The other assays, including the BG assay, detect membrane damage. The OD assay should be sufficient for most purposes since it is effective, rapid and cheap to perform. Studies requiring maximum sensitivity and discrimination should employ the ATP assay.

Keywords: membrane perturbation , protoplasts , fluorescent dyes , ATP , ß-galactosidase , components absorbing at 260 nm


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Infections caused by antibiotic-resistant strains of Staphylococcus aureus are increasing in both hospital and community settings.1 Consequently, there has been considerable interest in discovering and developing new antistaphylococcal agents for potential therapeutic application.1 However, during the search for novel antistaphylococcal agents, a number of synthetic and natural products have been identified that damage the staphylococcal cytoplasmic membrane.26 A consensus has now emerged that such agents should be eliminated from further study because their non-specific bactericidal activity usually corresponds to lack of prokaryotic specificity and therefore the likelihood of toxicity in mammals.7,8

A number of simple assays have been developed to detect membrane damage in S. aureus. These range from tests for alterations in membrane permeability such as the BacLight assay which measures changes in the uptake of fluorescent dyes,2,3,5 to those that detect gross destruction of the cytoplasmic membrane through lysis of protoplasts.2 However, a direct comparison of the various methods for detection of staphylococcal membrane-damaging agents has not been published. In this paper we evaluate several techniques including the BacLight assay, methods to detect release of low molecular components from the cell and the protoplast lysis assay.

Release of the intracellular enzyme ß-galactosidase is a traditional method for studying membrane-damaging agents in Escherichia coli.7 However, this methodology has not been available for staphylococci. In this paper, we report the development of a novel staphylococcal ß-galactosidase leakage assay, which we have also evaluated alongside the other rapid methods for detection of membrane-damaging agents in S. aureus.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Bacterial strains, reagents and antibacterial agents

S. aureus 8325-4 was used as the standard test strain, although the restriction-deficient 8325-4 derivative, RN4220, was used for construction of a ß-galactosidase-expressor (see below). All reagents, unless otherwise indicated, were purchased from Sigma–Aldrich (Poole, UK). Ciprofloxacin and protegrin IB-367 were gifts, respectively, from Bayer AG (Leverkusen, Germany) and IntraBiotics Pharmaceuticals (Mountain View, CA, USA).

Generation of an S. aureus strain strongly expressing ß-galactosidase

In order to achieve high-level constitutive expression of ß-galactosidase in S. aureus, the E. coli lacZ gene was placed under the control of the strong staphylococcal promoter, cap1A, using a PCR-based approach.9 Oligonucleotide primers (MWG Biotech, Milton Keynes, UK) for PCR were as follows: forward, 5'-AAATGTCGACiAGAGTTTGCAAiiAATATACAGGGGATTATATATAATiiiGGAAAACAAGAAAGGAAAATAGGAGGivTTTATATGvACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTG; and reverse, 5'-CCCCACTAGTGTTATTATTATTTTTGACACCA. The forward primer comprises (underlined): ia SalI-restriction site; ii–35 and iii–10 regions of the cap1A promoter; iva ribosome-binding site; and vstart codon and N-terminal portion of the lacZ gene. The reverse primer contains an engineered SpeI-restriction site (underlined).

These primers were used to PCR amplify the lacZ gene from plasmid pMC1871 (CBS, Utrecht, The Netherlands), using Platinum Pfx (Invitrogen, Paisley, UK), and a touchdown cycling approach [initial denaturation cycle at 94°C for 2 min, followed by five cycles of denaturation at 94°C for 15 s, annealing at 60°C (dropping 1°C per cycle) for 30 s and extension at 68°C for 3 min, and then by 25 cycles of denaturation at 94°C for 15 s, annealing at 55°C for 30 s and extension at 68°C for 3 min]. The resulting amplicon was ligated into pJIM224610 following restriction digestion with SalI/SpeI, and electroporated into S. aureus RN4220. Transformants expressing ß-galactosidase were identified on agar containing X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside), and a single strain (AJ22) subjected to confirmatory DNA sequencing of the promoter/lacZ junction.

ß-Galactosidase leakage assay

Strain AJ22 was grown at 37°C with aeration in Mueller–Hinton broth (MHB) containing chloramphenicol (25 mg/L) to an OD600 of 0.6. Cells were resuspended in fresh MHB, and 225 µL of cell suspension was added to 25 µL of drug to achieve a final concentration of 4x MIC. These mixtures were incubated at 25°C for 10 min, before centrifuging at 16 000 g for 3 min to pellet cells. Aliquots (180 µL) of the supernatant were added to 20 µL of 4-methylumbelliferyl-ß-D-galactoside (10 mg/mL in DMSO). Reaction mixtures were incubated at 25°C for 100 min in black 96-well microtitre plates and fluorescence measured (excitation, 365 nm; emission, 460 nm). Relative fluorescence units were converted using a calibration curve generated from serial dilution of the fluorophore (4-methylumbelliferone).

Other assays for membrane damage

Previously-employed procedures were followed for assessing membrane damage by protoplast lysis,2 leakage of material absorbing at 260 nm,3 ATP release,3 and the BacLight assay.2,5 In each case, cells were exposed to antibacterial agents at 4x MIC for 10 min at 25°C. Where applicable, independent readings were also taken only in the presence of antibacterial agents to enable corrections for background contributions to be made.


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
ß-Galactosidase (BG) leakage was quantified in the presence of control compounds (ciprofloxacin and tetracycline), and compounds known to cause membrane damage [cetyltrimethylammonium bromide (CTAB), nisin, clofazimine and protegrin IB-367 (PRO)]. Membrane damage caused by these compounds was also examined by quantifying protoplast lysis (PL), leakage of material absorbing at 260 nm (OD), ATP release, and by the BacLight (BL) assay.

No substantial membrane damage was detected in bacteria exposed to tetracycline and ciprofloxacin (Table 1), as expected for agents with intracellular targets. All the assays, with the exception of the PL assay, detected membrane damage for CTAB, nisin and PRO, but the ability to detect membrane damage induced by these compounds differed between the assay systems (Table 1). For example, the ATP and BG assays most readily detected damage induced by nisin, whilst the OD and PL assays appeared to be superior for PRO and clofazimine, respectively. In contrast, clofazimine appears to exert only a weak membrane-disrupting effect as measured by the BL and BG assays (Table 1). In the case of the latter assay, the amount of membrane damage is presumably insufficient to allow release of the relatively large BG protein (molecular weight, 464 kDa) from the cytoplasm. This suggests that the BG assay will not identify compounds that only exert subtle membrane perturbations.


View this table:
[in this window]
[in a new window]
 
Table 1.. Effects of antimicrobial agents at 4x MIC on membrane integrity in S. aureus measured by various assays

 
The assays varied considerably in their signal-to-noise ratio. The BG and OD assays displayed 5–10-fold greater activity in the presence of some membrane-disrupting agents relative to the control (no drug; Table 1), whilst the BL assay achieved slightly higher discrimination (10–20-fold; data not shown). The ATP assay enabled by far the greatest discrimination, with values for nisin approaching 100-fold that of the control. The low discriminatory power of the PL assay (Table 1), and the inability of this assay to detect several membrane-damaging agents, suggests that it is unsatisfactory for quantifying membrane damage in S. aureus.

When considering the application of these assays in the industrial setting for potential high-throughput screening of large numbers of compounds, several factors need to be considered. These include the ability of the assays to detect agents with a range of membrane perturbing activities, their ease of use, their cost to perform, and their amenability to miniaturization for use in microtitre plate formats. In our opinion, the best assay was the OD assay, since it was effective, rapid and cheap to perform. The ATP, BL and BG assays all performed well and may be suited to particular types of experimental work. Studies requiring maximum sensitivity and discrimination should employ the ATP assay.

Several other established assay systems are available for the study or detection of membrane perturbation, such as phosphate or potassium leakage.11 However, we obtained unreliable results for phosphate leakage (data not shown), and did not include measurement of potassium leakage since it is relatively complex and not readily amenable to high-throughput applications.

Finally, it should be noted that agents specifically inhibiting staphylococcal peptidoglycan synthesis promote cell lysis that will result in release of cellular components such as those detected in the OD, ATP and BG assays described here. However, at the screening stage, such agents can be readily distinguished from membrane-damaging agents by a number of simple assays including their failure to lyse organisms in which the stringent response is induced,2,7 their specificity for peptidoglycan synthesis as judged by radiolabel incorporation,12 their lack of activity against staphylococcal L forms,12 and by their ability to induce the formation of osmotically fragile spheroplasts.12


    Footnotes
 
* Corresponding author. Tel: +44-113-233-5604; Fax: +44-113-233-5638; Email: i.chopra{at}leeds.ac.uk


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
1 . Chopra, I. (2003). Antibiotic resistance in Staphylococcus aureus: concerns, causes and cures. Expert Review of Anti-infective Therapy 1, 45–55.

2 . Oliva, B., Miller, K., Caggiano, N. et al. (2003). Biological properties of novel antistaphylococcal quinoline-indole agents. Antimicrobial Agents and Chemotherapy 47, 458–66.[Abstract/Free Full Text]

3 . Oliva, B., O'Neill, A. J., Miller, K. et al. (2004). Antistaphylococcal activity and mode of action of clofazimine. Journal of Antimicrobial Chemotherapy 53, 435–40.[Abstract/Free Full Text]

4 . Woldemichael, G. M., Wachter, G., Singh, M. P. et al. (2003). Antibacterial diterpenes from Calceolaria pinifolia. Journal of Natural Products 66, 242–6.[Medline]

5 . Hilliard, J. J., Goldschmidt, R. M., Licata, L. et al. (1999). Multiple mechanisms of action for inhibitors of histidine protein kinases from bacterial two-component systems. Antimicrobial Agents and Chemotherapy 43, 1693–9.[Abstract/Free Full Text]

6 . Oh, S. U., Yun, B. S., Lee, S. J. et al. (2002). Atroviridins A-C. and neoatroviridins A-D, novel peptaibol antibiotics produced by Trichoderma atroviride F80317. I. Taxonomy, fermentation, isolation and biological activities. Journal of Antibiotics 55, 557–64.[Medline]

7 . O'Neill, A. J. & Chopra, I. (2004). Preclinical evaluation of novel antibacterial agents by microbiological and molecular techniques. Expert Opinion on Investigational Drugs 13, 1045–63.[CrossRef][Web of Science][Medline]

8 . Ling, L. L., Liang, X., Puyang, X. et al. (2003). Rapid elimination of compounds acting through non-specific membrane perturbation mechanisms. In Abstracts of the Forty-third Interscience Conference on Antimicrobial Agents and Chemotherapy, Chicago, IL, 2003. Abstract F-1469 p. 255. American Society for Microbiology, Washington, DC, USA.

9 . Murray, R. W., Melchior, E. P., Hagadorn, J. C. et al. (2001). Staphylococcus aureus cell extract transcription-translation assay: firefly luciferase reporter system for evaluating protein translation inhibitors. Antimicrobial Agents and Chemotherapy 45, 1900–4.[Abstract/Free Full Text]

10 . Renault, P., Corthier, G., Goupil, N. et al. (1996). Plasmid vectors for gram-positive bacteria switching from high to low copy number. Gene 183, 175–82.[CrossRef][Web of Science][Medline]

11 . Johnston, M. D., Hanlon, G. W., Denyer, S. P. et al. (2003). Membrane damage to bacteria caused by single and combined biocides. Journal of Applied Microbiology 94, 1015–23.[CrossRef][Medline]

12 . Singh, M. P., Petersen, P. J., Weiss, W. J. et al. (2003). Mannopeptimycins, new cyclic glycopeptide antibiotics produced by Streptomyces hygroscopicus LL-AC98: antibacterial and mechanistic activities. Antimicrobial Agents and Chemotherapy 47, 62–9.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Med MicrobiolHome page
Y. Qu, T. S. Istivan, A. J. Daley, D. A. Rouch, and M. A. Deighton
Comparison of various antimicrobial agents as catheter lock solutions: preference for ethanol in eradication of coagulase-negative staphylococcal biofilms
J. Med. Microbiol., April 1, 2009; 58(4): 442 - 450.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
J. K. Hobbs, K. Miller, A. J. O'Neill, and I. Chopra
Consequences of daptomycin-mediated membrane damage in Staphylococcus aureus
J. Antimicrob. Chemother., November 1, 2008; 62(5): 1003 - 1008.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
R. Steidl, S. Pearson, R. E. Stephenson, N. Ledala, S. Sitthisak, B. J. Wilkinson, and R. K. Jayaswal
Staphylococcus aureus Cell Wall Stress Stimulon Gene-lacZ Fusion Strains: Potential for Use in Screening for Cell Wall-Active Antimicrobials
Antimicrob. Agents Chemother., August 1, 2008; 52(8): 2923 - 2925.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
S. P. Falk, A. T. Ulijasz, and B. Weisblum
Differential Assay for High-Throughput Screening of Antibacterial Compounds
J Biomol Screen, December 1, 2007; 12(8): 1102 - 1108.
[Abstract] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. C. Rice, E. E. Mann, J. L. Endres, E. C. Weiss, J. E. Cassat, M. S. Smeltzer, and K. W. Bayles
The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus
PNAS, May 8, 2007; 104(19): 8113 - 8118.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
S. Gardete, S. W. Wu, S. Gill, and A. Tomasz
Role of VraSR in Antibiotic Resistance and Antibiotic-Induced Stress Response in Staphylococcus aureus.
Antimicrob. Agents Chemother., October 1, 2006; 50(10): 3424 - 3434.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
S. Gardete, H. de Lencastre, and A. Tomasz
A link in transcription between the native pbpB and the acquired mecA gene in a strain of Staphylococcus aureus.
Microbiology, September 1, 2006; 152(Pt 9): 2549 - 2558.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
M. C. Cholo, H. I. Boshoff, H. C. Steel, R. Cockeran, N. M. Matlola, K. J. Downing, V. Mizrahi, and R. Anderson
Effects of clofazimine on potassium uptake by a Trk-deletion mutant of Mycobacterium tuberculosis
J. Antimicrob. Chemother., January 1, 2006; 57(1): 79 - 84.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
54/6/1127    most recent
dkh476v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by O'Neill, A. J.
Right arrow Articles by Chopra, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O'Neill, A. J.
Right arrow Articles by Chopra, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?