Skip Navigation


JAC Advance Access originally published online on May 26, 2004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
54/1/60    most recent
dkh281v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Tempone, A. G.
Right arrow Articles by de Andrade, H. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tempone, A. G.
Right arrow Articles by de Andrade, H. F., Jr
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of Antimicrobial Chemotherapy 2004 54(1):60-68; doi:10.1093/jac/dkh281
JAC vol.54 no.1 © The British Society for Antimicrobial Chemotherapy 2004; all rights reserved.

Targeting Leishmania (L.) chagasi amastigotes through macrophage scavenger receptors: the use of drugs entrapped in liposomes containing phosphatidylserine

André Gustavo Tempone1, Daniel Perez2, Susanne Rath3, André Luis Vilarinho3, Renato A. Mortara4 and Heitor Franco de Andrade, Jr2,*

1 Instituto de Ciências Biomédicas, Dept. Parasitologia - Universidade de São Paulo; 2 Instituto de Medicina Tropical – Lab. Protozoologia, Universidade de São Paulo, Av. Dr Enéas de Carvalho Aguiar, 470 Cerqueira César, 05403–000 São Paulo; 3 Dept. Química Analítica, Instituto de Química -Unicamp; 4 Dept. Microbiologia, Imunologia e Parasitologia – Escola Paulista de Medicina UNIFESP, Brazil

Received 10 June 2003; returned 8 December 2003; revised 17 December 2003; accepted 13 April 2003


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Objectives: We devised liposome-entrapped antimony with the negatively charged lipid phosphatidylserine—liposome-entrapped antimony (Sb-LP)—in order to improve their targeting to infected macrophages through the interaction with scavenger receptors (SRs).

Methods: SR production was indirectly evaluated by its mRNA synthesis in infected and uninfected peritoneal macrophages using RT–PCR. The interaction and cytotoxicity of Sb-LP with SRs and their metabolism were determined by incubation with macrophages in the presence of cytochalasin B, chloroquine or different competitive ligands, with determination of the 50% inhibitory concentration (IC50) in vitro in infected macrophages. The intracellular trafficking of Sb-LP was evaluated by confocal microscopy using trapped fluorescent dyes.

Results: Our results showed an up-regulation of macrophage SR mRNA during the initial steps of Leishmania (L.) chagasi infection. By competitive ligand assays, we demonstrated the preferential uptake of Sb-LP by macrophage SRs. Sb-LP was 16-fold more effective (IC50=14.11 µM) than the free drug (IC50=225.9 µM) against L. (L.) chagasi-infected macrophages. The binding and uptake of Sb-LP in macrophages were shown to be energy-dependent and were reduced in the presence of cytochalasin B, showing the dependency of the cell microfilament system. Confocal analysis using trapped fluorescent dyes showed fluorescence of parasites or in their close proximity, compatible with the localized delivery of the liposomes.

Conclusions: The uptake of Sb-LP was reduced in infected macrophages, despite their effectiveness and targeting ability, suggesting a low metabolic rate in infected macrophages that could be overcome by the higher efficiency of the liposomal formulation. These in vitro results suggest that liposomes could improve the therapeutic index of old drugs, such as pentavalent antimony, via targeted delivery to Leishmania-infected cells.

Keywords: leishmaniasis , antimony , parasitophorous vacuoles , therapy


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Protozoan tropical diseases cause great suffering throughout developing countries and a typical example is visceral leishmaniasis (VL), which affects 12 million people in subtropical and tropical regions.1 The clinical course of established VL leads to death if untreated, and is exacerbated with HIV co-infection,2 remaining a priority for the World Health Organization.3 Leishmania spp. are intracellular parasites adapted to thrive in a hostile ecological niche of macrophages, the parasitophorous vacuole (PV), which is an acid and lytic compartment.4 Thus, multiple vacuole trafficking pathways can intersect with the Leishmania PV, supplying potential nutrient sources to the amastigotes.5 Several immune evasion mechanisms are utilized by amastigotes: the down-regulation of parasite antigen presentation via the MHC class II antigen pathway and the inhibition of the oxidative burst that impacts directly on the survival of the parasite inside the cell.6 Recently, up-regulation of the negatively charged lipid phosphatidylserine (PS), on the outer leaflet of Leishmania spp. amastigotes, was demonstrated. This seems to be highly relevant for their attachment to macrophages,7 once negatively charged phospholipids expressed in the outer leaflet of cells are recognized by macrophages (via scavenger receptors) as apoptotic cells.8

Macrophages, the target cells for VL therapy, play an important role due to their particularly phagocytic nature. They express a range of cell surface glycoproteins, namely scavenger receptors (SRs),9 that are able to bind modified lipoproteins, senescent and apoptotic cells, proteins, polysaccharides and a range of polyanionic molecules.10 The broad specificity of ligands involved and global structural similarities enable SRs to be differentiated into distinct classes:11 Class A—SR-AI, SR-AII, SR-AIII and MARCO (macrophage receptor with a collagenous structure); Class B—CD36, SR-BI/CLA-I and others, such as SR-CI, macrosialin, CD68, LOX-I, SREC.12 Scavenger receptors play a role in innate immunity and homeostasis, and it is possible that pathogens ‘hijack’ SRs to gain entry into macrophages.13

Pentavalent antimonials have been the mainstay of treatment for leishmaniasis for over 60 years, the oldest non-substituted first-line drug against different types of leishmaniasis in the world.14 Despite their clinical use for over half a century, the mechanism of action and basis for selective toxicity of these anti-leishmanial agents remains poorly understood.15 It has been suggested that, in vitro, macrophages accumulate pentavalent antimony and convert it to the more toxic trivalent form.16 Laboratory investigations into metal drug-complexes have shown promising results against VL.17 Second-line drugs, such as cationic diamidines (pentamidine) and antifungals (amphotericin B) remain as secondary compounds, owing to the difficulty of their administration and their undesirable side effects. This, coupled with an increase in primary antimonial resistance, demonstrates the importance of identifying new antileishmanials—either novel compounds18 or new approaches to the delivery of old drugs.12

Alternative therapies for VL have resulted in the development of liposome-entrapped drugs, with enhanced efficacy and therapeutic indices.1921 Liposomes are micro-particulate carriers, composed of biodegradable and biocompatible material that can encapsulate a wide range of drugs with varied lipophilicities.22 The interaction between liposomes and target-cells is one of the key issues in designing suitable liposome-carrier systems. Recent developments in liposome technology have resulted in the availability of more effective strategies for controlling the stability and reactivity of liposomes after their systemic administration.22 Targeting macrophages with sugar-grafted liposomes has been studied against leishmaniasis,19 but the use of PS-coated liposomes against Leishmania (L.) chagasi-infected macrophages seems to be a novel and promising tool, once Class B SRs (SR-BI and CD36) and a Class A receptor, MARCO, were shown to be involved in the binding and rapid clearance of these liposomes from the blood compartment.2326 The importance of SRs in the immune response against bacterial and viral pathogens has been examined in other models,10 but there are no reports to our knowledge on their use as the target for drug delivery, using PS-liposomes to tackle Leishmania-infected cells. Most functional studies involving SRs have concentrated on their role in atherosclerosis,22,27 but other aspects of macrophage function could be exploited with regard to intracellular pathogens and their influence on SR activity during intracellular hosting.

Using RT-PCR, we examined the in vitro regulation of SR-AI, SR-AII, MARCO, CD36 and SR-BI (mRNA) before and after macrophage infection by L. (L.) chagasi amastigotes. By using SR competitive ligands, we studied the in vitro targeting ability of the liposome-entrapped antimony (Sb-LP) to SRs in peritoneal macrophages and their kinetics at different temperatures and concentrations, comparing the in vitro 50% inhibitory concentration (IC50) between the free and the liposomal antimony against Leishmania-infected macrophages. We also examined, by confocal microscopy, the delivery of liposomes to the parasitophorous vacuole of Leishmania-infected macrophages.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Materials

Lipids—hydrogenated phosphatidylcholine and phosphatidylserine—were kindly given by Lipoid GmbH, Ludwigshafen, Germany. [3H]DPPC 1 mCi/mmol was purchased from Amersham Incorp. Glycerol, dodecyl sodium sulphate, methanol and chloroform were purchased from Merck. DMSO, cholesterol, dextran sulphate, cytochalasin B, lipopolysaccharide (LPS), (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide; Thiazol blue)—MTT and RPMI-PR-1640 medium (without phenol red) were purchased from Sigma. Polycarbonate membranes were purchased from Avanti Lipids. Glucantime was obtained from Aventis, TriZol Reagent from Invitrogen, M-MuLV Reverse Transcriptase from USB–Promega (Madison, USA) and DIL (C18) (1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate) from Molecular Probes, OR, USA.

Animals

Animals were supplied by the Animal Breeding Facility at the Faculty of Medicine of São Paulo and maintained in sterilized cages with an absorbent environment, receiving water and diet ad libitum. Golden hamsters (Mesocricetus auratus) were infected every 2 months by intraperitoneal injection with L. (L.) chagasi in order to obtain amastigotes. BALB/c female (20–22 g) mice were used to provide peritoneal macrophages. Animal procedures were performed after Research Ethics Commission approval, according to the Guide for the Care and Use of Laboratory Animals from the National Academy of Sciences (http://www.nap.edu).

Parasites

L. (L.) chagasi (M 6445 strain) was maintained in golden hamsters. Amastigotes were obtained from the spleen by differential centrifugation and the parasite burden determined with the method of Stauber et. al,28 60–70 days post-infection.

Cells

Macrophages were collected from the peritoneal cavity of female BALB/c mice by washing with RPMI-PR-1640, supplemented with 10% fetal bovine serum. They were then seeded into 24-well plates for a period of 2 h for attachment, at 37°C in a humidified 5% CO2 95% air incubator. Non-adherent cells were removed by one-step washing with medium and the subsequent incubation was performed for 48 h at the same temperature.

Liposome preparation

Liposomes were prepared by extrusion through polycarbonate membranes.29 Liposomes were composed of saturated egg phosphatidylcholine, phosphatidylserine and cholesterol (5:1:4 molar ratio). The lipids were mixed in chloroform–methanol (1:1) solution and dried at 55°C by rotary evaporation. For the preparation of radiolabelled liposomes, 30 µCi of [3H]DPPC was added to the lipid mixtures before drying. For Sb-LP, dried lipids were resuspended in 1 mL of pentavalent antimony at 55°C for 1 h. After vesicle rehydration, the solution was sonicated for 5 min in a sonicating bath, under a stream of nitrogen at 55°C and extruded through 0.2 µm pore size polycarbonate membranes using a mini-extruder device (Avanti Polar Lipids, Inc., Alabaster, USA). The separation of the non-encapsulated materials was carried out by 24 h dialysis against an isotonic glycerol solution; the sterilization of the liposomal formulation was conducted using 0.22 µm membranes prior to use. The final phospholipid concentration was determined by the Stewart Assay.30 The average diameter of liposomes was determined by transmission electron microscopy, using 1% phosphotungstic solution for staining. The concentration of encapsulated antimony was determined in an Atomic Absorption Spectrophotometer–Hydrate Generation (Intralab GeminiAA12/1475) at {lambda}=217.6 nm, after liposome lysis with 0.2% SDS. Liposomal preparations presented <15% variation in antimony concentration between batches (±10.9%), but each lot concentration was determined in an atomic absorption spectrophotometer before using. Empty liposomal preparations with identical phospholipid composition were used as controls.

Uptake of [3H]liposome-entrapped antimony by macrophages

Macrophages were harvested and seeded (8 x 105/well) in 24-well plates and incubated at 37°C. The following SR ligands were dissolved in PBS, sterilized in 0.22 µm membranes and incubated for 2 h before adding Sb-LP: phosphatidylserine (400 µg/mL);24 dextran sulphate (2 µg/mL);31 polyinosinic acid (60 µg/mL);11 LPS (5 µg/mL).32 Phosphatidylserine liposomes were prepared as described, using phosphatidylcholine, phosphatidylserine, cholesterol (4:4:2 molar ratio). To estimate the surface-bound fraction of liposomal antimony (150 nmol phospholipid/well), macrophages were incubated at 4°C for 8 h. The metabolism of [3H]Sb-LP was also studied, by blocking the lysosomal degradation with chloroquine (50 µM),33 which had been previously incubated with cells for 2 h. The involvement of the microfilament system was studied, by blocking the phagocytosis with cytochalasin B (3 µg/mL)23 that had been previously incubated for 2 h. The [3H]Sb-LP (150 nmol of phospholipid/well) were then incubated with cells for 8 h at 37°C. The binding kinetics of the [3H]liposomal antimony to peritoneal macrophages was performed at 37°C with liposome concentrations in the range 500–31.25 nmol. At the final step of the experiment, cells were washed three times with cold PBS, permeabilized with 0.1% SDS–liquid scintillation Aquasol (Packard, Meriden, USA), and the radioactivity determined by a liquid scintillation counter (RackBeta 1209-Wallac; Perkin Elmer, Boston, USA). In order to determine the uptake of [3H]Sb-LP by infected macrophages, peritoneal macrophages were seeded at 5 x 105 cells/well and infected with L. (L.) chagasi amastigotes at a ratio of 1:10 (macrophage/amastigotes). After 18 h of infection, macrophages were washed once with medium and the liposomal formulation was added at 150 nmol of phospholipid/well and incubated for a further 8 h at 37 °C. Naive (uninfected) macrophages were used as controls. Uptake was determined by a liquid scintillation counter, as described above. The data were analysed using Graph Pad Prism 3.0 software, from the mean of three experiments in duplicate.

SR mRNA activity in infected macrophages

Macrophages were collected and seeded (3 x 106/well) in six-well plates (duplicate). Infection was performed at a ratio 1:10 (macrophage/amastigotes) at 37°C for 18 h and the parasite burden confirmed by Giemsa staining. The macrophages were washed twice with 4°C RPMI 1640 medium and incubated for a further 24 h. At the final step, the medium was removed and replaced with TriZol Reagent. Cell lysates were pooled and stored at –80°C until extraction. Extracted macrophage mRNA was reverse transcribed by M-MuLV Reverse Transcriptase (Promega) and the resulting cDNA stored at –20°C until use. PCR reactions amplifying cDNA encoding SR were performed in 34 cycles, using specific primers (SR-AI–sense: AACAACATCACCAACGACCTCAGAC, antisense: GGGCTCCACTACCACCAACCA (Ta=75.7°C, product size: 343 bp); SR-AII–sense: TTAAAGGTGATCGGGGACAAAT, antisense: CCCAGGGTTAGAAGAAGTTACAAGA (Ta=62.2°C, product size: 347 bp); SR-BI–sense: AATTTGGCCTGTTTGTTGGGATGA, antisense: AAGCCTTCGTTGGGTGGGTAGAC (Ta=57°C, product size: 349 bp); CD-36–sense: GTGCTCTCCCTTGATTCT, antisense: TCGGGGTCCTGAGTTAT (Ta=51°C, product size: 355 bp); MARCO–sense: CAGGGAGGTAAAGGTGATGC, antisense: CCGACTCGTCCAGGTTCTC (Ta=58.2°C, product size: 356 bp). All primer sequences were confirmed using BLAST software (www.ncbi.nlm.nih.gov/blast/). Semi-quantitative analysis of amplified products was performed after PAGE (6%, silver-stained), and gel images were obtained by scanning. Optical density of bands was estimated by ImageJ 1.27 software (rsb.info.nih.gov/ij), and quantification of products given by relative units of optical density between the SR band and ß-actin band (sense: TGGAATCCTGTCGCATCCATGAAAC, antisense: TAAAACGCAGCACAGTAACAGTCCG (Ta=54°C, product size: 349 bp). The data analysis considered the pooled fractions of two experiments in duplicate.

Cytotoxicity assay

In order to verify the cytotoxicity of SR ligands, peritoneal macrophages were seeded at 4 x 105/well (triplicate) in 96-well microplates and submitted to an incubation period of 48 h in the presence of cytochalasin B, chloroquine, dextran sulphate, LPS (5 µg/mL), polyinosinic acid and phosphatidylserine, at the same concentrations used in the previous experiments, with a final well volume of 150 µL. Sb-LP were also incubated (150 nmol phospholipid/well) with macrophages for a period of 48 h to evaluate any cytotoxicity. Macrophages were incubated without drugs and retained as viability control, by using a colorimetric method with MTT.34 Briefly, MTT (5 mg/mL) was dissolved in PBS, sterilized through 0.22 µm membranes and added, 20 µL/well, for 4 h at 37°C. Formazan extraction was carried out with 10% SDS (w/v) for 18 h (100 µL/well) at 24°C and the optical density was determined in a Multiskan MS (Uniscience, Sao Paulo, Brazil) at 570 nm. The data analysis was conducted with Graph Pad Prism 3.0 software, using the mean of two experiments in triplicate. 100% viability was expressed based on the optical density of control macrophages, after normalization.

Determination of the 50% inhibitory concentration (IC50)

Peritoneal macrophages were seeded at 4 x 105/well in 24-well plates containing glass coverslips, infected with L. (L.) chagasi amastigotes at a ratio 1:10 (macrophage/amastigotes) and treated with free and liposome-entrapped antimony for 120 h. The concentration of free antimony was in the range 821.35–10.14 µM and the liposomal formulation was in the range 342.17–0.47 µM. Macrophages were incubated for the same period without drugs for control (100% infected). At the end of the assay, macrophages were fixed with methanol and stained with Giemsa. Parasite burden was verified by the number of infected macrophages out of 200 cells (triplicate). The data were analysed by a sigmoid dose–response curve in Graph Pad Prism 3.0 software, using the mean of three experiments in duplicate. The amount of pentavalent antimony inside the liposomes was determined by atomic absorption spectrophotometry in the presence of 0.2% SDS. Liposomes without drug but with the same phospholipid composition were used as control.

Confocal microscopy studies

Peritoneal macrophages were applied (4 x 105/well) to 24-well plates containing glass coverslips and infected with L. (L.) chagasi amastigotes at a ratio 1:5 (macrophage/amastigotes) for 18 h, as previously described. Liposome-entrapped antimony was prepared in the presence of the fluorescent markers ethidium bromide or DIL (C18) and incubated (100 nmole) with infected macrophages for 0.5 h at 37°C. Cells were washed with cold PBS, fixed with 2% formaldehyde and processed for confocal microscopy. A Giemsa-stained glass coverslip was prepared to confirm the parasite burden. Images were acquired in a Bio-Rad 1024UV confocal system attached to a Zeiss Axiovert 100 microscope (Oberkochen, Germany) equipped with a 63xoil immersion N.A. 1.4 plan-apochromatic objective with differential interference contrast. LaserSharp 1024 version 3.2T from BioRad (Hercules, USA) was used for image acquisition and Adobe Photoshop 4.0 for image processing.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Differential SR activity in infected macrophages

The activity of scavenger receptors SR-AI, SR-AII, MARCO, CD36 and SR-BI in Leishmania-infected macrophages was determined in a semi-quantitative analysis. After 24 h of infection, the amount of SR mRNA was markedly affected in infected macrophages (Figure 1b) when compared with the non-infected control group (Figure 1a). CD36 and MARCO presented an enhancement of specific mRNA expression of ~44% and 19%, respectively, and a less intense up-regulation was observed in SR-BI mRNA (~8%). The mRNA expression of SR-AI and SR-AII was unaltered when compared with control macrophages. The parasite burden in this assay was, on average, 15 amastigotes/macrophage as determined by light microscopy.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 1.. Analysis of the SRs activity (mRNA) by RT–PCR in naive and Leishmania-infected macrophages. 3 x 106 macrophages were infected with 1:10 ratio (macrophage/amastigotes) and incubated for 18 h at 37°C. The macrophages were washed twice with 4°C RPMI 1640 medium and incubated for more 24 h under the conditions described before. The washed cell layer was diluted in TriZol Reagent and the extracted mRNA was reverse transcribed by M-MuLV Reverse Transcriptase. PCR reactions amplifying cDNA encoding SR were performed. The data analysis considered the pooled fractions of two experiments in duplicate. Lane A shows expression pattern of SRs in uninfected group and lane B, the Leishmania-infected group.

 
Liposomes and cellular interactions

Liposomal antimony was measured by transmission electron microscopy, resulting in an average diameter of 210 nm (data not shown). Cellular interaction was determined in naive macrophages by studying the effect of temperature on the total association of the formulation. At 37°C, the binding and internalization of [3H]liposomes showed a time-dependent curve and did not show saturation even after 8 h (Figure 2a) probably due to interference of random liposome fusion. The extent of liposome binding to cell surface receptors was estimated by incubating the cells with liposomes at a lower temperature (4°C), to inhibit endocytosis. The amount of associated liposomes in macrophages was reduced by 54% in a time-dependent manner (Figure 2a), resulting in ~297.2 pmol (±18.1) surface-bound after 8 h incubation. The uptake of increasing concentrations showed that liposomes were taken up at a constant rate (Figure 2b), and no saturation was observed even at high phospholipid concentrations (500 nmol/well).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2.. Uptake and internalization of [3H]liposome-entrapped antimony by peritoneal macrophages. Macrophages were seeded at 8 x 105/well and incubated for 48 h before adding [3H]liposome-entrapped antimony, which were incubated at different time points and concentrations. (a). Effect of temperature in different time points (150 nmole/well): filled triangle, 37°C and filled circles, 4°C. (b) Effect of the phospholipid concentration (8 h incubation). The uptake was determined by the intracellular radioactivity measured in a liquid scintillation counter and correlated to the phospholipid concentration from liposomes associated to 8 x 106 macrophages. The data were analysed by Graph Pad Prism 3.0 software, using the mean of three experiments in duplicate.

 
Competitive assays: SR interaction and the metabolism of Sb-LP

The characterization of the receptors responsible for the uptake of [3H]Sb-LP was carried out via a competitive assay using different SR ligands (Figure 3). Polyinosinic acid (Poly I) and phosphatidylserine (PS) inhibited the binding of liposomes to scavenger receptors, reducing the total amount by 45% and 42%, respectively. Neither dextran sulphate nor lipopolysaccharide (LPS) affected the binding of [3H]Sb-LP. When all the above-cited ligands were mixed and incubated with macrophages, the total amount of associated liposomes was reduced by 40%. The metabolism of the [3H]Sb-LP in peritoneal macrophages was also studied, by blocking the lysosomal degradation with chloroquine, which showed an increase of 41% in the association of liposomes. Another approach used was the inhibition of the microfilament system, by blocking phagocytosis with cytochalasin B, which resulted in a 57% reduction of uptake of Sb-LP.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3.. Scavenger receptors involvement in the uptake and internalization of [3H]liposome-entrapped antimony by peritoneal macrophages. Macrophages were seeded at 8 x 105/well and incubated for 48 h before adding 150 nmole of [3H]liposome-entrapped antimony. All incubations were done for 8 h in the presence of competitive ligands and reagents. The graph shows the effect on the internalization in a competitive assay with different SR ligands, and in the presence of lysosomal degradation and phagocytosis inhibitors. The uptake was determined by the intracellular radioactivity measured in a liquid scintillation counter and correlated to the phospholipid concentration from liposomes associated to 8 x 106 macrophages. The data were analysed by Graph Pad Prism 3.0 software, using the mean of three experiments in duplicate.

 
Uptake of Sb-LP by infected macrophages

In order to study the uptake capability of macrophages after infection with amastigotes, infected cells were incubated with [3H] liposome-entrapped antimony for 8 h and compared with uninfected cells. A 45% decrease in the uptake of liposomes was observed compared with the control (Figure 4). The parasite burden at mRNA collection was 14 amastigotes/macrophage, as determined in a Giemsa-stained control preparation.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 4.. Uptake and internalization of [3H]liposome-entrapped antimony by naive and Leishmania-infected macrophages. Amastigotes were seeded at 1:10 ratio (macrophage/amastigotes) and incubated for 24 h before adding 150 nmole of [3H]liposome-entrapped antimony for 8 h. The uptake ratio expressed in percentage was determined by the intracellular radioactivity found in the control group (uninfected) measured in a liquid scintillation counter. The data were analysed by Graph Pad Prism 3.0 software, using the mean of two experiments in triplicate.

 
Cytotoxicity

After 48 h incubation of macrophages in the presence of SR ligands, no toxicity was observed, as determined by the mitochondrial activity detected with the tetrazolium assay—MTT (Figure 5). Sb-LP also showed no toxicity for macrophages at the tested concentrations. All observed wells (light microscopy) corroborated the MTT assay.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 5.. Cytotoxicity of SR ligands and liposomes. Peritoneal macrophages were seeded at 4 x 105/well in 96-well microplates and submitted to an incubation period of 48 h in the presence of Sb-LP (150 nmol of phospholipid/well), cytochalasin B, chloroquine, dextran sulphate, LPS, polyinosinic acid and phosphatidylserine, at the concentrations used in the previous experiments. The viability was determined with MTT and the optical density was determined at 570 nm. The data analysis was conducted in Graph Pad Prism 3.0 software, using the mean of two experiments in triplicate.

 
50% Inhibitory concentration (IC50)

The antileishmanial activity of free and liposome-entrapped antimony was compared after 120 h incubation. The percentage of treated cells was determined by the number of amastigote-free macrophages in 100 cells (triplicate) in comparison with uninfected cells. Free pentavalent antimony resulted in an IC50 of 225.9 µM (CI 95%=203.3–251.0 µM), whereas the IC50 for liposomal antimony was 14.11 µM (CI 95%=7.93–25.09 µM) (Figure 6). Both formulations achieved complete elimination of the parasite burden in macrophages. Neither the free nor the liposome-entrapped antimony presented toxicity for peritoneal macrophages at the tested concentrations, confirmed by the normal morphology observed under light microscopy. The IC50 values were compared, showing an extremely significant difference (P<0.0001, t=15.69) in Graph Pad Prism 3.0 software.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 6.. Determination of the 50% inhibitory concentration. Free (filled triangle) and liposome-entrapped antimony (filled square) were incubated with Leishmania-infected macrophages at 37°C for a treatment period of 120 h. The number of infected macrophages was determined in Giemsa-stained glass coverslips determining the parasite burden by light microscopy. The data were analysed in Graph Pad Prism 3.0 software and resulted in an extremely significant difference between the curves (P<0.0001, t=15.69).

 
Confocal studies

In order to verify the delivery of antimony-entrapped liposomes to the parasitophorous vacuole of Leishmania-infected macrophages, we labelled the liposomal formulation with either a lipophilic fluorescent marker [DIL (C18)] or a water-soluble dye (ethidium bromide) and analysed the infected macrophages in a confocal microscope. Thirty minutes after liposome incubation, fluorescence signal associated with amastigotes inside the macrophages could be seen with both labels, indicating that labelled liposomes could reach the parasitophorous vacuole (Figure 7, arrowheads). Moreover, the water-soluble dye was more dispersed than the lipophilic marker, suggesting that fusion between the liposomes and the parasitophorous vacuoles with subsequent processing might have occurred (Figure 7). Light microscopy examination of Giemsa-stained macrophages demonstrated a parasite ratio of 1:8 (macrophage/amastigotes) after 24 h infection.



View larger version (91K):
[in this window]
[in a new window]
 
Figure 7.. Delivery of liposome-entrapped fluorescent dyes to L. (L.) chagasi in infected macrophages. Liposomes loaded with DIL (C18) (a, b, c) were incubated for 30 min with infected macrophages, fixed and imaged under confocal microscopy. A similar process was performed in another infected-macrophage group using liposomes loaded with ethidium bromide (d, e, f). Single focal plane images were acquired. (a, d) differential interference contrast images; (b, e) intracellular dye fluorescence; (c, f) merged images. Arrowheads indicate isolated labelled parasites; ‘n’ indicates the nucleus of the host cell and ‘*’ indicates an area with a high concentration of amastigotes. Bars = 5 µm.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Our data have highlighted new insights for liposome-based therapy, making use of the encapsulation of a standard drug (pentavalent antimony) into PS-containing liposomes, and by competitive ligand assays, verifying their affinity for SRs in Leishmania-infected macrophages. The temperature-dependent internalization of Sb-LP was demonstrated, supporting the characteristic receptor-mediated endocytosis as the main process, where the binding of ligands to cell surface receptors could occur even at lower temperatures, but the internalization of the complexes requires temperatures >23°C.35

Several classes of scavenger receptors present broad ligand specificity for chemical groups, such as oxidized proteins and polyanions.12 The broad ligand specificity of Class B scavenger receptors (CD36 and SR-BI) and Class A (MARCO) makes them attractive candidates for mediating the binding and uptake of liposomes containing negatively charged phospholipids, like phosphatidylserine.10,24 The incubation of peritoneal macrophages with SR ligands such as polyinosinic acid11 and phosphatidylserine,24 demonstrated competitive binding of the Sb-LP, suggesting the involvement of scavenger receptors. No competition was observed when another class of SR ligands, dextran sulphate and LPS, was used, but a considerable reduction—by 40%—of the total amount of incorporated liposomes was seen when a pool of the four ligands was used, suggesting the involvement of scavenger receptors in the binding and internalization of the PS-liposome-entrapped antimony in macrophages. The accumulation of liposomes in macrophages, through the incubation with chloroquine, an inhibitor of the lysosomal degradation,33 suggests that the metabolism of the Sb-LP in peritoneal macrophages involves lysosomal hydrolysis. The inhibition of phagocytosis by cytochalasin B23 decreased the total association of liposomes, suggesting that the macrophage microfilament system is required for the internalization of liposomes. The interaction of different molecules with SRs is not completely understood, since SRs have many different features when compared with most other endocytic receptors. The classical endocytic motifs, like di-leucine or ITAM (FcgR), in cytoplasmic domains, which have been shown to be important for signalling, endocytic trafficking and functioning of receptors, are not found in the cytoplasmic tail of some SRs.11

The determination of the 50% inhibitory concentration of antimony, both free and liposome-entrapped, against L. (L.) chagasi-infected macrophages showed that the free antimony concentration necessary to achieve 50% (IC50) reduction on the parasite burden was 16-fold higher than for liposome-entrapped antimony. Lee and co-workers36 demonstrated that the uptake of PS-containing liposomes could be 187-fold higher than the pinocytosis-mediated uptake of solutes by J774 macrophages, which may partly explain the different IC50 values obtained in this study. Our IC50 data with free pentavalent antimony is consistent with findings described elsewhere.15,16

A differential activity of SRs in Leishmania-infected macrophages was observed, as shown by RT–PCR assay, since this technique allows the specific and fast determination of SRs in tissues37 or culture cells.38 We observed an up-regulation of CD36, SR-BI and MARCO after 24 h incubation, in the range 8%–44% when compared with non-infected cells. This effect could be related to transforming growth factor ß1 (TGF-ß1), a key cytokine widely secreted in macrophages during Leishmania spp. infection39 that has been shown to modulate SR activity in monocytic cell lines and human macrophages.40 Furthermore, the possible sequestration of SRs by some pathogens during the initial course of infection13 could up-regulate these molecules in the macrophages, corroborating our observed data.

The morphology of mature parasite-harbouring compartments, also known as parasitophorous vacuoles (PVs), varies depending on the infecting Leishmania species. Large communal PVs (Leishmania amazonensis, Leishmania mexicana) and tight individual PVs (Leishmania major, Leishmania donovani) have been identified, but the biogenesis of Leishmania-harbouring PVs is still poorly understood.41 Although in our experiments using confocal microscopy we could not clearly distinguish tight vacuoles formed by L. (L.) chagasi amastigotes, both lipophilic and aqueous dyes co-localized with the parasites. The delivery of DIL-labelled PS-liposomes to the L. (L.) chagasi PVs could be inferred since intracellular amastigotes appeared fluorescent after short-term incubation in the presence of these liposomes. The fusion of particles with the PVs of L. mexicana-infected macrophages has been described to occur as rapidly as in 15 min, corroborating our experimental results.42 Some reports describe the high selectivity of fusion of the PV with other particles containing vacuoles.42 It has been suggested that the nature of the receptor by which a particle gains entry into a cell can influence the extent of phagosome–lysosome fusion.43 It has also been proposed that annexins, hydrophilic proteins that reversibly bind negatively charged phospholipids,44 act as bridging molecules in the fusion of vesicles.45 Likewise, we could suggest that the negatively charged liposomes may possibly target the PVs of L. (L.) chagasi inside macrophages by a mechanism related to annexins. Thus, the differences in IC50 of free and liposome-entrapped antimony could be attributed to the preferential delivery characteristics of the liposomal formulation.

Despite the higher SR activity in Leishmania-infected macrophages, the targetability of PS-liposomes to SRs and their suggested fusion with the PVs, a reduced uptake of the [3H]liposome-entrapped antimony was seen in macrophages infected with amastigotes. The high parasite burden inside the macrophages (14 amastigotes/cell) could have altered their metabolic activity and their ability to ingest particulate material, altering the intracellular trafficking of vesicles inside the infected macrophages. However, this result did not interfere with the in vitro activity of Sb-LP, which showed ~16-fold more efficacy than free antimony (IC50) and also suggests that Sb-LP could have higher effectiveness than the non-liposomal drug against Leishmania-infected macrophages.

With regard to the differential SR activity (mRNA) in Leishmania-infected macrophages, we concluded that it is important to analyse the infected rather than the uninfected target cell. Differences in expression of a variety of molecules could be exploited for drug delivery and PS-liposomes appear to be an efficient vehicle for targeting drugs to Leishmania-infected macrophages since even in the infected cell with a hindered uptake of particulate matter, liposomal antimony was 16-fold more active than free drug. Furthermore, the up-regulation of Class B SRs (CD36 and SR-BI) in infected macrophages at the initial time of intracellular hosting, could have contributed to the higher effectiveness of PS-liposomes when compared with free pentavalent antimony, given that those receptors were described to be responsible for the uptake and internalization of phosphatidylserine rich-liposomes.24 Drug targeting is an important way to avoid the toxicity of many currently used drugs. Using SRs as target molecules in Leishmania-infected cells could be an efficient strategy in the development of new therapeutic approaches against leishmaniasis.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
We wish to thank Dr Vanessa Yardley from the London School of Hygiene and Tropical Medicine for criticism and manuscript review. We also thank Andrés J. Galisteo Jr. for laboratory assistance. This work was supported by grants from Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP 99/08491–4) and LIM49 HCFMUSP.


    Footnotes
 
* Corresponding author. Tel: +55-11-3066-7010; Fax: +55-11-3088-5237; Email: hfandrad{at}usp.br


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
1 . Desjeux, P. (1992). Human leishmaniasis: epidemiology and public health aspects. World Health Statistics Quarterly 45, 267–75.[Medline]

2 . Silva, E. S., Pacheco, R. S., Gontijo, C. M. et al. (2002). Visceral leishmaniasis caused by Leishmania (Viannia) braziliensis in a patient infected with human immunodeficiency virus. Revista do Instituto de Medicina Tropical de São Paulo 44, 145–9.[Medline]

3 . Guerin, P. J., Olliaro, P., Sundar, S. et al. (2002). Visceral leishmaniasis: current status of control, diagnosis, and treatment, and a proposed research and development agenda. Lancet Infectious Diseases 2, 494–501.[CrossRef][Web of Science][Medline]

4 . Courret, N., Frehel, C., Gouhier, N. et al. (2002). Biogenesis of Leishmania-harbouring parasitophorous vacuoles following phagocytosis of the metacyclic promastigote or amastigote stages of the parasites. Journal of Cell Science 115, 2303–16.[Abstract/Free Full Text]

5 . Peters, C., Aebischer, T., Stierhof, Y. D. et al. (1995). The role of macrophage receptors in adhesion and uptake of Leishmania mexicana amastigotes. Journal of Cell Science 108, 3715–24.[Abstract]

6 . McMahon-Pratt, D., Kima, P. E. & Soong, L. (1998). Leishmania amastigote target antigens: the challenge of a stealth intracellular parasite. Parasitolology Today 14, 31–4.

7 . de Freitas Balanco, J. M., Moreira, M. E. C., Bonomo, A. et al. (2001). Apoptotic mimicry by an obligate intracellular parasite downregulates macrophage microbicidal activity. Current Biology 11, 1870–3.[CrossRef][Web of Science][Medline]

8 . Fadok, V. A., Cathelineau, A., de Dalekes, D. L. et al. (2001). Loss of phospholipid asymmetry and surface exposure of phosphatidylserine is required for phagocytosis of apoptotic cells by macrophages and fibroblasts. Journal of Biological Chemistry 276, 1071–7.[Abstract/Free Full Text]

9 . Krieger, M. (2001). Scavenger receptor class B type I is a multiligand HDL receptor that influences diverse physiologic systems. Journal of Clinical Investigation 108, 793–7.[CrossRef][Web of Science][Medline]

10 . Platt, N., Silva, R. P. & Gordon, S. (1999). Class A scavenger receptors and the phagocytosis of apoptotic cells. Immunology Letters 65, 15–9.[CrossRef][Web of Science][Medline]

11 . Shirai, H., Murakami, T., Yamada, Y. et al. (1999). Structure and function of type I and II macrophage scavenger receptors. Mechanisms of Ageing and Development 111, 107–21.[CrossRef][Web of Science][Medline]

12 . Dhaliwal, B. & Steinbrecher, U. P. (1999). Scavenger receptors and oxidized low density lipoproteins. Clinica Chimica Acta 286, 191–205.[CrossRef][Web of Science][Medline]

13 . Freira-de-Lima, C. G., Nascimento, D. O., Soares, M. B. P. et al. (2000). Uptake of apoptotic cells drives the growth of a pathogenic trypanosome in macrophages. Nature 403, 199–203.[CrossRef][Medline]

14 . Balaña-Fouce, R., Reguera, R. M., Cubría, C. et al. (1998). The pharmacology of leishmaniasis. General Pharmacology 30, 35–443.

15 . Roberts, W. L., Berman, J. D. & Rainey, P. M. (1995). In vitro antileishmanial properties of tri- and pentavalent antimonial preparations. Antimicrobial Agents and Chemotherapy 39, 1234–9.[Abstract/Free Full Text]

16 . Ephros, M., Bitnun, A., Shaked, P. et al. (1999). Stage-specific activity of pentavalent antimony against Leishmania donovani axenic amastigotes. Antimicrobial Agents and Chemotherapy 43, 278–82.[Abstract/Free Full Text]

17 . Mesa-Valle, C. M., Moraleda, V., Lazuen, J. et al. (1997). Action of new organometallic complexes against Leishmania donovani. Journal of Antimicrobial Chemotherapy 40, Suppl. 1, 47–57.[Abstract/Free Full Text]

18 . Tempone, A. G., Andrade, H. F., Spencer, P. J. et al. (2001). Bothrops moojeni venom kills Leishmania spp. with hydrogen peroxide generated by its L-amino acid oxidase. Biochemical and Biophysical Research Communications. 280, 620–4.[CrossRef][Web of Science][Medline]

19 . Banerjee, G., Nandi, G., Mahato, S. B. et al. (1996). Drug delivery system: targeting of pentamidines to specific sites using sugar grafted liposomes. Journal of Antimicrobial Chemotherapy 38, Suppl. 1, 145–50.[Abstract/Free Full Text]

20 . Adler-Moore, J. & Proffitt, R. T. (2002). AmBisome: liposomal formulation, structure, mechanism of action and pre-clinical experience. Journal of Antimicrobial Chemotherapy 49, Suppl. 1, 21–30.[Abstract]

21 . Yardley, V. & Croft, S. L. (1999). In vitro and in vivo activity of amphotericin B-lipid formulations against experimental Trypanosoma cruzi infections. American Journal of Tropical Medicine and Hygiene 61, 193–7.[Abstract]

22 . Sharma, A. & Sharma, U. S. (1997). Liposomes in drug delivery: progress and limitations. International Journal of Pharmaceutics 154, 123–40.[CrossRef]

23 . Nishikawa, K., Arai, H. & Inoue, K. (1990). Scavenger receptor-mediated uptake and metabolism of lipid vesicles containing acidic phospholipids by mouse peritoneal macrophages. Journal of Biological Chemistry 265, 5226–31.[Abstract/Free Full Text]

24 . Rigotti, A., Acton, S. L. & Krieger, M. (1995). The class B scavenger receptors SR-BI and CD36 are receptors for anionic phospholipids. Journal of Biological Chemistry 270, 16221–4.[Abstract/Free Full Text]

25 . Yamaguchi, A., Yamamoto, N., Akamatsu, N. et al. (2000). PS-liposome and ox-LDL bind to different sites of the immunodominant domain (#155-183) of CD36: a study with GS95, a new anti-CD36 monoclonal antibody. Thrombosis Research 97, 317–26.[CrossRef][Web of Science][Medline]

26 . Van der Laan, L. J. W., Dopp, E. A., Haworth, R. et al. (1999). Regulation and functional involvement of macrophage scavenger receptor MARCO in clearance of bacteria in vivo. Journal of Immunology 162, 939–47.[Abstract/Free Full Text]

27 . Teupser, D., Thiery, J. & Seidel, D. (1999). {alpha}-Tocopherol down-regulates scavenger receptor activity in macrophages. Atherosclerosis 144, 109–15.[CrossRef][Web of Science][Medline]

28 . Stauber, L. A., Franchino, E. M. & Grun, J. (1958). An eight-day method for screening compounds against Leishmania donovani in golden hamsters. Journal of Protozoology 5, 269–73.

29 . Szoka, F. & Papahadjopoulos, D. (1980). Procedure for preparation of liposomes with large internal aqueous space and high capture by reverse-phase evaporation. Proceedings of the National Academy of Sciences, USA 75, 4194–8.

30 . Stewart, J. C. M. (1980). Colorimetric determination of phospholipids with ammonium ferrothiocyanate. Analytical Biochemistry 104, 10–4.[CrossRef][Web of Science][Medline]

31 . Fujiwara, M., Baldeschwieler, J. D. & Grubbs, R. H. (1996). Receptor-mediated endocytosis of poly(acrylic acid)-conjugated liposomes by macrophages. Biochimica et Biophysica Acta 1278, 59–67.[Medline]

32 . Van der Laan, L. J. W., Kangas, M., Döpp, E. D. A. et al. (1997). Macrophage scavenger receptor MARCO: in vitro and in vivo regulation and involvement in the anti-bacterial host defense. Immunology Letters 57, 203–8.[CrossRef][Web of Science][Medline]

33 . Musial, A. & Eissa, N. T. (2001). Inducible nitric-oxide synthase is regulated by the proteasome degradation pathway. Journal of Biological Chemistry 276, 24268–73.[Abstract/Free Full Text]

34 . Tada, H., Shiho, O., Kuroshima, K. et al. (1986). An improved colorimetric assay for interleukin 2. Journal of Immunological Methods 93, 157–65.[CrossRef][Web of Science][Medline]

35 . Watanabe, J., Haba, M., Urano, K. et al. (1996). Uptake mechanism of fractioned [3H] heparin in isolated rat kupffer cells: involvement of scavenger receptors. Biological and Pharmaceutical Bulletin 19, 581–6.

36 . Lee, K. D., Nir, S. & Pappahadjopoulos, D. (1993). Quantitative analysis of liposome-cell interactions in vitro: rate constants of binding and endocytosis with suspension and adherent J774 cells and human monocytes. Biochemistry 32, 889–99.[CrossRef][Medline]

37 . Voshol, P. J., Schwarz, M., Rigotti, A. et al. (2001). Down-regulation of intestinal scavenger receptor class B, type I (SR-BI) expression in rodents under conditions of deficient bile delivery to the intestine. Biochemical Journal 356, 317–25.[CrossRef][Web of Science][Medline]

38 . Draude, G., Hrboticky, N. & Lorenz, R. L. (1999). The expression of the lectin-like oxidized low-density lipoprotein receptor (LOX-1) on human vascular smooth muscle cells and monocytes and its down-regulation by lovastatin. Biochemical Pharmacology 57, 383–6.[CrossRef][Web of Science][Medline]

39 . Bogdan, C. & Rollinghoff, M. (1999). How do protozoan parasites survive inside macrophages? Parasitology Today 15, 22–8.[CrossRef][Web of Science][Medline]

40 . Draude, G. & Lorenz, R. (2000). TGF-ß1 downregulates CD36 and scavenger receptor A but upregulates LOX-1 in human macrophages. American Journal of Physiology. Heart and Circulatory Physiology 278, 1042–8.

41 . Courret, N., Fréhel, C., Gouhier, N. et al. (2002). Biogenesis of Leishmania-harboring parasitophorous vacuoles following phagocytosis of metacyclic promastigote or amastigote stages of the parasites. Journal of Cell Science 115, 2303–16.[Abstract/Free Full Text]

42 . Collins, H. L., Schaible, U. E., Ernst, J. D. et al. (1997). Transfer of phagocytosed particles to the parasitophorous vacuole of Leishmania mexicana is a transient phenomenon preceding the acquisition of annexin I by the phagosome. Journal of Cell Science 110, Suppl. 2, 191–200.[Abstract]

43 . Bouvier, G., Benoliel, A. M., Foa, C. et al. (1994). Relationship between phagosome acidification, phagosome-lysosome fusion, and mechanism of particle ingestion. Journal of Leukocyte Biology 55, Suppl. 6, 729–34.[Abstract]

44 . Meers, P. & Mealy, T. (1993). Calcium-dependent annexin V binding to phospholipids: stoichiometry, specificity, and the role of negative charge. Biochemistry 32, Suppl. 43, 11711–21.[CrossRef][Medline]

45 . Meers, P., Mealy, T. & Tauber, A. I. (1993). Annexin I interactions with human neutrophil specific granules: fusogenicity and coaggregation with plasma membrane vesicles. Biochimica et Biophysica Acta 1147, Suppl. 2, 177–84.[Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
M. R. Jaafari, N. Bavarsad, B. S. Fazly Bazzaz, A. Samiei, D. Soroush, S. Ghorbani, M. M. Lotfi Heravi, and A. Khamesipour
Effect of Topical Liposomes Containing Paromomycin Sulfate in the Course of Leishmania major Infection in Susceptible BALB/c Mice
Antimicrob. Agents Chemother., June 1, 2009; 53(6): 2259 - 2265.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
K. G. Nelson, J. V. Bishop, R. O. Ryan, and R. Titus
Nanodisk-Associated Amphotericin B Clears Leishmania major Cutaneous Infection in Susceptible BALB/c Mice
Antimicrob. Agents Chemother., April 1, 2006; 50(4): 1238 - 1244.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
A. G. Tempone, A. C. M. Pompeu da Silva, C. A. Brandt, F. S. Martinez, S. E. Treiger Borborema, M. A. Barata da Silveira, and H. F. de Andrade Jr.
Synthesis and Antileishmanial Activities of Novel 3-Substituted Quinolines
Antimicrob. Agents Chemother., March 1, 2005; 49(3): 1076 - 1080.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
M. A. Khan, R. Jabeen, T. H. Nasti, and O. Mohammad
Enhanced anticryptococcal activity of chloroquine in phosphatidylserine-containing liposomes in a murine model
J. Antimicrob. Chemother., February 1, 2005; 55(2): 223 - 228.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
54/1/60    most recent
dkh281v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Tempone, A. G.
Right arrow Articles by de Andrade, H. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tempone, A. G.
Right arrow Articles by de Andrade, H. F., Jr
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?