Skip Navigation


JAC Advance Access originally published online on March 17, 2004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
53/5/759    most recent
dkh155v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Thompson, C. I.
Right arrow Articles by Zambon, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thompson, C. I.
Right arrow Articles by Zambon, M. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


Journal of Antimicrobial Chemotherapy (2004) 53, 759-765
© 2004 The British Society for Antimicrobial Chemotherapy

Changes in in vitro susceptibility of influenza A H3N2 viruses to a neuraminidase inhibitor drug during evolution in the human host

Catherine I. Thompson1,2, Wendy S. Barclay1,* and Maria C. Zambon2

1 School of Animal and Microbial Sciences, University of Reading, Whiteknights PO Box 228, Reading RG6 6AJ; 2 Enteric, Respiratory and Neurological Virus Laboratory, Health Protection Agency, Central Public Health Laboratory, London, UK

Received 28 November 2003; returned 23 December 2003; revised 28 January 2004; accepted 2 February 2004


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Objectives: Influenza A H3N2 viruses isolated recently have characteristic receptor binding properties that may decrease susceptibility to neuraminidase inhibitor drugs. A panel of clinical isolates and recombinant viruses generated by reverse genetics were characterized and tested for susceptibility to zanamivir.

Methods: Plaque reduction assays and neuraminidase enzyme inhibition assays were used to assess susceptibility to zanamivir. Receptor binding properties of the viruses were characterized by differential agglutination of red blood cells (RBCs) from different species. Sequence analysis of the haemagglutinin (HA) and neuraminidase (NA) genes was carried out.

Results: Characterization of a panel of H3N2 clinical isolates from 1968 to 2000 showed a gradual decrease in agglutination of chicken and guinea pig RBCs over time, although all isolates could agglutinate turkey RBCs equally. Sequence analysis of the HA and NA genes identified mutations in conserved residues of the HA1 receptor binding site, in particular Leu-226 -> Ile-226/Val-226, and modification of potential glycosylation site motifs. This may be indicative of changes in virus binding to sialic acid (SA) receptors in recent years. Although recent isolates had reduced susceptibility to zanamivir in MDCK cell based plaque reduction assays, no difference was found in an NA enzyme-inhibition assay. Assays with recombinant isogenic viruses showed that the recent HA, but not the NA, conferred reduced susceptibility to zanamivir.

Conclusion: This study demonstrates that recent clinical isolates of influenza A H3N2 virus no longer agglutinate chicken RBCs, but despite significant receptor binding changes as a result of changes in HA, there was little variation in sensitivity of the NA to zanamivir.

Keywords: haemagglutinin, neuraminidase, reverse genetics, sialic acid, zanamivir


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Influenza A virus is an important human pathogen, which, because of its constant evolution, cannot always be effectively controlled by vaccination. Recent advances have led to the licensure of a new class of anti-influenza drugs, the neuraminidase (NA) inhibitors (NIs). The NIs, such as zanamivir, are sialic acid (SA) analogues that block the NA enzyme active site of the virus by mimicking the natural substrate. To date, limited resistance of influenza viruses to zanamivir has been described in vivo,1 although resistant isolates have been generated during replication of the virus in tissue culture2 (and references therein).

The H3N2 subtype of influenza A has circulated widely in the human population since its introduction from an avian source in 1968. Adaptation of a virus in a new host may produce further changes. The factors that govern the adaptation of influenza A to humans are not completely understood although the virus receptor specificity is considered to be important.

Influenza viruses gain entry into the host cell via binding of their HA protein to SA receptors. Human viruses preferentially bind SA linked to galactose by {alpha}2,6 linkages (SA{alpha}2,6Gal) whereas avian influenza viruses preferentially bind SA{alpha}2,3Gal.3,4 This difference reflects the predominant receptor in the respective hosts, for example, the ciliated epithelial cells of the human respiratory tract carry an abundance of SA{alpha}2,6Gal.5,6

The influenza receptor binding site (RBS) is a pocket of conserved amino acids on the globular head of the haemagglutinin (HA) surrounded by varying antigenic regions.7 Changes in HA receptor binding are concomitant with changes in the viral NA because of the requirement for a functional balance between receptor binding activity and the receptor destroying activity of NA.811

Receptor binding specificity of influenza viruses can be analysed by agglutination of RBCs from different animal species.12 The A/Aichi/2/68 (H3N2) strain of human influenza virus, which preferentially binds SA{alpha}2,6Gal,3 agglutinates chicken RBCs but not RBCs from horses. Recent clinical isolates of influenza A H1N1 and H3N2 no longer bind chicken RBCs,1316 and this may reflect an underlying change in receptor binding properties.

Alteration in receptor binding may lead to virus variants altered in susceptibility to NI drugs. Viruses generated by passage in cell culture in the presence of NIs often contain mutations mapping to the RBS of the HA gene.17 The reduction in affinity of HA binding to SA alleviates the requirement for a functional NA in vitro. We investigated the relationship between natural evolution in humans and antiviral susceptibility to NI drugs. Specifically we asked whether the natural evolution of HA in H3N2 viruses has any impact on antiviral susceptibility of natural isolates. We have assembled a panel of H3N2 viruses representative of the virus evolution in the population during circulation over more than three decades from 1969 to 2000 and examined the relationship between receptor binding properties of the viruses and NI susceptibility.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Viruses and cells

Influenza A H3N2 human clinical isolates (England isolates) from 1969 to 2000 were obtained from archives at the Central Public Health Laboratory (CPHL), Colindale, London, UK. A panel of viruses was selected from archived strains that had been passaged in cell culture from the original respiratory sample before storage at –80°C. Viruses selected to form a panel were amplified by 2–3 passages in MDCK cells, and infectious supernatants were stored at –80°C.

MDCK cells were cultured in Dulbecco’s modified Eagle’s medium (MEM) supplemented with 4500 mg/L glucose, pyridoxine HCl and 10% FBS (Invitrogen, Paisley, UK). Virus stocks were grown in the presence of TPCK-treated trypsin (Worthington, NJ, USA) added to media at a final concentration of 1 µg/mL.

NA inhibitors

Zanamivir (4-guanidino-Neu5Ac2en) was provided by Dr Margaret Tisdale of GlaxoSmithKline (Stevenage, UK).

Virus concentration

Tissue culture supernatants were purified by centrifugation at 25 000 r.p.m. in a Beckman SW28 rotor through a cushion of 30% sucrose in NTE (100 mM NaCl; 10 mM Tris–HCl, pH 7.8; 1 mM EDTA) and viral pellets resuspended in PBS.

Plaque reduction assay

Confluent monolayers of MDCK cells were infected with virus (200 pfu). After 1 h of adsorption, the virus inoculum was removed and the cells overlaid with supplemented MEM containing trypsin (1 µg/mL) and 10-fold dilutions of zanamivir (0.001–10 µg/mL). The cells were fixed and stained after 4 days incubation at 37°C. The IC50 value is defined as the concentration of zanamivir (µg/mL) at which the plaque number is reduced by 50%.

NA enzyme-inhibition assay

Fluorometric analysis based on previously described methods18,19 was used to determine inhibition of NA activity in the presence of zanamivir. NA activity of serial two-fold dilutions of purified virus diluted to a standard titre of 64 haemagglutinating units (HAU) (turkey RBCs) was determined. A suitable dilution of virus falling in the linear part of the NA activity curve was chosen for NA inhibition assays. NA inhibition was evaluated in the presence of serial four-fold dilutions of zanamivir (final drug concentration in the assay ranged between 0.0038 and 1000 nM) mixed with an equal volume of virus diluted in enzyme buffer (32.5 mM MES pH 6.5, 10 mM CaCl2) in a black 96-well plate (Greiner Bio-One, Frickenhausen, Germany) incubated at 37°C for 30 min. Substrate mix containing 4-methyl-umbelliferyl-N-acetyl neuraminic acid (MUNANA) (Sigma–Aldrich, Dorset, UK) at a final concentration of 100 µM was then added and incubated at 37°C for 1 h. The reaction was stopped by adding 150 µL 0.1 M NaOH in 80% ethanol, and the plate read immediately at an excitation wavelength of 360 nm and an emission wavelength of 465 nm on a GENios plate reader (Tecan, UK). The IC50 value reflects the concentration of drug that reduces the NA activity by 50%.

PCR amplification and sequencing of the HA and NA genes

Viral RNA was extracted from 150 µL of tissue culture fluid using guanidinium thiocyanate (Severn Biotech Ltd, Kidderminster, UK).20 cDNA synthesis was carried out using random hexamers as described previously.21 PCR amplification and sequencing of the HA1 region of HA used primers described previously.22 PCR amplification and sequencing of the coding region of NA genes was carried out with nested primer sets (primers sequences available on request). Sequencing was carried out on a Applied Biosystems 373A automated DNA sequencer using cycle sequencing dye-terminator chemistry (Applied Biosystems, Foster City, CA, USA).

Haemagglutination assays

Haemagglutination assays were carried out in V-bottomed microtitre plates using 50 µL of 0.5% suspensions of turkey, chicken or guinea pig RBCs in PBS (Harlan Sera-Lab Ltd, Loughborough, UK) added to 50 µL virus serially diluted in PBS. Virus titres were initially standardized to 32 HAU with turkey RBCs and this standard titre was tested with different species of RBCs. Horse RBCs were used at 1% with 0.5% BSA. Haemagglutination elution assays were carried out at 37°C.

PCR amplification and cloning of A/England/26/99 HA and NA

cDNA synthesis was carried out using universal primer RT F (AGCAAAAGCAGG). HA was amplified using PCR primers H3 F (CTGCAGGCTCTTCGACCCAGCAAAAGCAGGGGATAATTC) and H3 R (CTGCAGGCTCTTCTTATTAGTAGAAACAAGGGTGTTTT). NA was amplified using PCR primers N2 F (TATTGGCGT- CTCACCCAGCAAAAGCAGGAGT) and N2 R (ATATGCCGTCTC TTATTAGTAGAAACAAGGAGTTTTTT). All primer sequences are given in a 5'–3' direction. Viral genes were cloned into the SapI or BsmBI site of pPolI-RT vector kindly supplied by Dr Thomas Zurcher, GlaxoSmithKline.

Reverse genetics

Recombinant viruses of A/England/26/99 and A/Victoria/3/75 were generated by plasmid-based reverse genetics as previously described.23,24 Wild-type recombinant A/Victoria/3/75 virus was recovered on day 4 of the rescue. Recombinant viruses containing mixtures of A/Victoria/3/75 and A/England/26/99 segments were recovered after 6–8 days, which probably reflected the impaired growth characteristics of these recombinants. Full-length sequence of the RNA segments 4 and 6 for all recombinant viruses was obtained following RT-PCR in order to verify that no additional sequences changes had been selected during virus recovery.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We assembled a unique panel of human influenza A H3N2 clinical isolates from the year of their first emergence in humans in 1968 through to the 1999–2000 influenza season. These viruses had never been passaged in eggs. Passage of virus in MDCK cells is known to preserve the HA1 sequence across the RBS of the original clinical isolates.25 This panel of 11 isolates was selected to represent each phase of significant antigenic drift over this time based on antigenic characterization, receptor binding changes and HA sequence analysis.

Haemagglutination of RBCs from different species

Isolates were tested in haemagglutination assays with RBCs from different animal species. Viruses isolated from 1990 onwards had a decreasing ability to agglutinate chicken RBCs (Table 1) which was unchanged with the inclusion of the NI drug zanamivir (10 µg/mL) in the assay, indicating that the reduced chicken RBC agglutination was unlikely to be accounted for by increases in receptor destroying (NA) activity (data not shown). Significantly, the most recent isolates (viruses isolated in the 1998–1999 season onwards) were completely unable to haemagglutinate chicken RBCs. Since turkey RBCs have a higher level of SA{alpha}2,6Gal than SA{alpha}2,3Gal, and the amount of SA{alpha}2,6Gal is higher on turkey RBCs than on chicken RBCs, the data indicate a shift towards selective binding of SA{alpha}2,6Gal for recent isolates.


View this table:
[in this window]
[in a new window]
 
Table 1.. Antigenic properties, agglutination characteristics and zanamivir susceptibility of influenza A H3N2 viruses isolated between 1969 and 2000
 
Recent isolates also showed reduced binding to guinea pig RBC (Table 1). The reasons for this are unclear since these erythrocytes also have a higher level of SA{alpha}2,6Gal than SA{alpha}2,3Gal, and illustrate the difficulty of using biological sources of receptor analogues for these studies. If total SA is limiting on guinea pig RBC, then these data may indicate a recent general reduction in affinity for receptor regardless of the type of linkage. The earliest isolate A/England/878/69 did not bind guinea pig RBC to the same extent as turkey RBC, and this may reflect a reduced affinity for SA{alpha}2,6Gal since this early isolate had only recently transferred into the human population. All viruses failed to agglutinate horse RBCs, indicating that there has been no adaptation towards increased specificity for SA{alpha}2,3Gal (data not shown).

Changes in receptor specificity may impact on NI susceptibility. Plaque reduction assays were used to assess the susceptibility of viruses to zanamivir in MDCK cell culture. Control viruses known to be susceptible and resistant to zanamivir had IC50 values of 0.1 and 10 µg/mL, respectively in this assay. The recent isolate A/England/26/99 had an IC50 value 100-fold higher than that of an older isolate A/England/327/90 (1.0 and 0.01 µg/mL, respectively) (Table 1). The oldest H3N2 strain A/Aichi/2/68 is also highly susceptible to zanamivir with an IC50 of 0.014 µM (~0.005 µg/mL) in plaque reduction assays.26 Plaque size was generally reduced before plaque number and, with the exception of A/England/26/99 where there was no difference, IC50 values based on reduction in plaque size were 10-fold lower (data not shown).

Inhibition of NA enzyme activity with zanamivir

We investigated the sensitivity of the NA of each virus in the panel to zanamivir in a fluorometric NA enzyme inhibition assay. As a control, recombinant viruses known to be either susceptible or resistant to zanamivir in MUNANA NA enzyme inhibition assays were used (T. Zurcher, personal communication) and gave values of 0.36 and 101.31 nM, respectively. IC50 values ranged between 0.44 and 2.06 nM for the clinical H3N2 viruses (Table 1). Recent clinical isolates were as susceptible to inhibition by the drug as the oldest isolate A/England/878/69. The IC50 values were similar in range, although slightly lower in the case of recent isolates, to previously published values for susceptible clinical isolates.19,27

The NA activities of these viruses varied throughout the panel to the extent that the NA activity of A/Eng/288/90 was too low to determine an IC50 value in the assay used.

Analysis of HA gene sequences of H3N2 viruses isolated in UK 1969–2000

The HA and NA genes of each isolate were sequenced. Analysis of HA1 showed that some mutations which arose in conserved residues in the HA receptor binding site have become fixed in more recent isolates. Mutations were found in a key receptor binding site residue, amino acid 226. Until the mid-1990s, human H3N2 viruses contained Leu-226. However, all recent isolates had a mutation to either isoleucine or valine that could potentially affect binding to SA receptors. The change Ile-226 was first observed as early as 1994 and became increasingly frequent during the 1994–1995 influenza season,28 although the first isolate in the panel with this mutation was isolated during the 1995–1996 season in the UK (A/England/492/95). The mutation to Val-226 appeared during the 1994–1995 influenza season and became increasingly common the following year.28 Similarly, this mutation is not seen in the panel of UK isolates until the following season (1996–1997). Although Val-226 became predominant in the following years, viruses with Ile-226 still circulated although the incidence of these was much lower.

In addition, mutations were observed in several other residues known to be important in the interaction of HA with its SA receptor. Several amino acid codons in the HA1 receptor binding site at positions 135, 138, 190, 194 and 226, are known to be under positive selection to change and mutations at these positions give a selective advantage to the virus.29 Viruses across our panel had several different amino acid mutations at these positions, with the exception of 194 which was conserved throughout.

The viral HA protein contains N-glycans attached both to the stem region and the globular head of the protein near the receptor binding site. Glycosylation of the viral HA is known to affect affinity of binding to SA receptors. Novel potential glycosylation sites were observed in the HA sequence of recent isolates as a result of changes at residues 124, 126, 133, 144 and 248. In particular, the changes at positions 124, 133 and 144 were first observed in recent isolates (A/England/26/99) concurrent with the complete loss of binding to chicken RBC (Table 1). With the exception of the potential glycosylation site motif created at position 144, which was only observed in A/England/ 26/99, these sites were conserved in viruses from the following season that were represented on the panel.

The NA catalytic region was mostly conserved across the panel of England isolates and no mutations associated with known NI resistance genotypes were observed in any of the clinical isolates.

Zanamivir susceptibility of recombinant isogenic viruses generated by reverse genetics

To determine the basis for the decreased susceptibility to zanamivir displayed by recent H3N2 viruses, one isolate, A/England/26/99, was selected for further analysis. A/England/26/99 has mutations in the receptor-binding site representative of recent H3N2 viruses, and also contains novel potential glycosylation site motifs that were conserved in later isolates. In addition, it was the first virus in the panel to completely lose the ability to agglutinate chicken RBC (Table 1).

To separate the contribution of the HA and NA of A/England/ 26/99 to the apparent decreased susceptibility to zanamivir in plaque reduction assays, the HA and NA genes were cloned and rescued as single and double gene reassortants in an isogenic genetic background using the influenza A plasmid-based reverse genetics system based on A/Victoria/3/75 (also H3N2). The recombinant viruses displayed characteristic plaque sizes in MDCK cells that were defined by the specific HA carried by the virus. Viruses containing A/England 26/99 HA typically have small, turbid plaques, whereas viruses containing A/Victoria/3/75 HA have large, well-defined plaques irrespective of the paired NA (Figure 1a, c, e, g).



View larger version (73K):
[in this window]
[in a new window]
 
Figure 1. Viruses were generated by plasmid-based reverse genetics using influenza A A/Victoria/3/75 (H3N2) as the genetic background. Vic/75 contains all gene segments from A/Victoria/3/75. 26/99 HA/NA contains HA and NA from A/England/26/99 and all remaining genes from A/Victoria/3/75. 26/99 NA-Vic/75 contains NA from A/England/26/99 and remaining genes from A/Victoria/3/75. 26/99 HA-Vic/75 contains HA from A/England/26/99 and remaining genes from A/Victoria/3/75. Plaque assays in MDCK cells were carried out with equal viral inocula in the presence and absence of zanamivir (0.001–10 µg/mL). A decrease in plaque size was observed before a reduction in plaque number. (a) Vic/75 plaques formed in the absence of zanamivir. (b) Vic/75 plaques formed in the presence of 0.01 µg/mL zanamivir. (c) 26/99 HA/NA plaques formed in the absence of zanamivir. (d) 26/99 HA/NA plaques formed in the presence of 0.01 µg/mL zanamivir. (e) 26/99 NA-Vic/75 plaques formed in the absence of zanamivir. (f) 26/99 NA-Vic/75 plaques formed in the presence of 0.01 µg/mL zanamivir. (g) 26/99 HA-Vic/75 plaques formed in the absence of zanamivir. (h) 26/99 HA-Vic/75 plaques formed in the presence of 0.01 µg/mL zanamivir.

 
The recombinant viruses were assessed for susceptibility to zanamivir by plaque reduction assay. Wild-type A/Victoria/3/75 and the single gene reassortant with NA from A/England/26/99 (26/99 NA-Vic/75) were highly susceptible to zanamivir showing a reduction in plaque size at a low drug concentration (0.01 µg/mL) (Figure 1b, f). In contrast, recombinant viruses with HA from A/England/26/99 paired either with its matching NA or that of A/Victoria/3/75 showed low susceptibility to zanamivir. These viruses produced small, turbid plaques in the absence of drug and slightly larger, more distinct plaques in the presence of drug suggesting a partial drug-dependent phenotype (Figure 1d, h). Therefore, the decreased susceptibility to zanamivir observed with wild-type A/England/26/99 (Table 1) can be attributed to properties of the HA of this virus.

The addition of exogenous bacterial NA (1 mU/mL) to the overlay of plaque assays of 26/99 HA/NA and 26/99 HA-Vic/75 reduced the titre and plaque size of these viruses compared to plaque assays with no additional NA, indicating that NA was not limiting (data not shown). This supports the hypothesis that the small plaque phenotype of these viruses in MDCK cells was due to reduced HA receptor binding.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
One of the implications of the receptor binding changes we observed in this study is that they may be leading to the emergence of circulating viruses which behave (at least in in vitro cell culture assays) as if they are NI drug-resistant. Plaque reduction assays suggested that recent isolates had reduced susceptibility to zanamivir compared to older viruses in the panel. However, it is now clear that classical cell-based methodology for antiviral resistance testing is not always suitable or sensitive enough for measuring resistance to NIs, so the results of the NA enzyme inhibition assay are considered to be a more accurate prediction of in vivo susceptibility.30 This supposition is supported by a recent study where it was found that an isolate with predicted resistance to NIs in cell-based assays was actually highly susceptible to zanamivir in the ferret model.16 Furthermore, in many clinical trials where zanamivir has been tested with circulating viruses, the drug has been found to be effective.31

Experiments with recombinant isogenic viruses generated by reverse genetics demonstrated that decreased susceptibility observed in plaque reduction assays was conferred by the HA of the recent H3N2 viruses which has reduced affinity for receptors on MDCK cells. This is in agreement with the findings of a previous study where reduced susceptibility of viruses to zanamivir in tissue culture correlated with the possession of an HA that can be readily released from SA receptors with reduced dependence on NA.32 The molecular determinants of this change in recent H3N2 viruses are likely to be the result of cumulative changes in the HA during evolution in the human host in the last three decades. Indeed sequence analysis of the HA and NA genes of each virus in the panel identified changes in potential glycosylation site motifs and key receptor binding site residues in HA1, in particular at position 226 which has been shown previously to be important in determining specificity of binding to SA{alpha}2,6Gal or SA{alpha}2,3Gal.4 Similar changes at this position were identified in published sequences and have been observed by others.15,16 During the 1995–1996 influenza A season in the UK, two antigenically similar strains co-circulated, one of which had the amino acid change Ile-226 in the receptor binding site.33 The predominant circulating strain in following seasons had the Ile-226 amino acid change suggesting that this mutation in the receptor binding site was advantageous to the virus. The importance of the mutation E190D in the reduced virus binding to chicken RBC has been shown,14 and we also found this mutation in isolates from 1993 onwards. Virus A/England/26/99 has three mutations in the HA1 gene that generate new potential glycosylation site motifs (G124S; D133N; V144N) that are not seen in isolates before this time and two of which become fixed in viruses from later seasons. Additional glycosylation near the HA RBS may affect affinity of SA binding by steric hindrance of the receptor–SA interaction. Interestingly, an isolate from the following season A/England/919/99 has a coding change (K93N) that results in a novel potential glycosylation site in the NA gene. Changes in HA resulting in reduced affinity for SA, as suggested by the reduced RBC agglutination, may be driving changes in the NA gene to maintain the balance between the two proteins that is crucial for the viability of the virus. Similarly A/England/356/96, which has an unusual mutation in the NA gene (D198N), also contains a new mutation (K135T) in a receptor binding site residue in HA1 that encodes a novel potential glycosylation site. These mutations in the HA and NA proteins may provide complementary effects that maintain the balance of functions in the virus. In future studies, we will dissect the functional importance of the receptor binding site mutations and potential glycosylation site motif changes that we have observed, by introducing them singly into recombinant viruses generated by reverse genetics.

In this study, we have observed that recent human influenza A viruses displayed markedly reduced agglutination of RBC species with either less SA{alpha}2,6Gal or less SA overall. These observations could be explained by a general reduction in affinity for SA and/or by a change in affinity for specifically linked SA residues. These two possibilities might be better distinguished by measuring HA affinity for synthetic receptor analogues displaying either {alpha}2,3- or {alpha}2,6-linked SA such as those used in recent studies.34 If the changes seen represent an adaptation of the virus to replication in humans, then the question is what is the selective pressure driving the virus towards this receptor binding change? Human influenza viruses infect ciliated epithelial cells of the human respiratory tract, which display SA{alpha}2,6Gal.5,6 However, human respiratory mucins present in the mucosal layer of the airway carry SA{alpha}2,3Gal and the presence of these highly glycosylated inhibitory proteins may be driving evolution of human viruses towards a decreased affinity for SA{alpha}2,3Gal.35

A reduction in the affinity of HA for its SA receptor should produce a corresponding decrease in NA activity due to the necessity of balancing HA and NA activities for virus fitness.9,11 Therefore, we wanted to establish whether the NA activities of the viruses in the panel had changed over time to match HA. NA elution assays demonstrated that the earliest isolate A/England/878/69 had much stronger NA activity compared to more recent isolates, but there were few differences between the later isolates using this relatively insensitive method (data not shown). Therefore, we attempted to determine relative specific NA activities for the virus panel by standardizing input NA in an ELISA and determining NA activity in a fluorometric assay.36,37 The virus panel was tested by ELISA using monoclonal antibodies or fetuin to capture purified virus and then detection with a polyclonal anti-N2 NA antibody. However, as a result of antigenic drift, we were not able to accurately quantify NA by this method as the antibodies available did not recognize the drifted NAs equally.

Our observations demonstrate the importance of using substrates and reagents with appropriate receptors both in isolation and characterization of natural influenza A isolates. This study clearly indicates that the use of chicken RBC in haemagglutination assays or HI tests with recent clinical isolates is no longer appropriate. Turkey RBCs are recommended for such tests as they carry higher levels of the appropriate SA receptor.

Similarly, although the importance of using MDCK isolates rather than egg-grown isolates in the study has already been stressed, the use of primary human airway epithelial cells and the development of cell lines bearing increased levels of SA{alpha}2,6Gal will be more appropriate for the study of human isolates.38 This is particularly pertinent for the testing of isolates for susceptibility to NIs, as plaque reduction assays in MDCK cells have been shown to produce misleading data because of the presence of both SA{alpha}2,3Gal and SA{alpha}2,6Gal on these cells.26,39

In conclusion, the recent influenza A H3N2 viruses isolated in the UK showed little change in the level of sensitivity of NA to zanamivir, although changes in HA binding to the SA receptor complicate the interpretation of cell-based drug susceptibility assays.


    Acknowledgements
 
The zanamivir resistant and susceptible control viruses used in the NA enzyme inhibition assay were kindly supplied by Thomas Zurcher (GlaxoSmithKline). We also thank Dr Zurcher for sharing the A/Victoria/3/75 reverse genetics system. The control viruses used in the plaque reduction assay were kindly provided by Dr Margaret Tisdale (GlaxoSmithKline). We thank Adriana Alvarez-Aguero for help with sequencing HA and NA. This work was presented in part at The First European Influenza Conference, October 2002, St.-Julians, Malta (W2-3). Financial support was from the British Society for Antimicrobial Chemotherapy (BSAC) (Grant Number GA386), H.C. Roscoe Fellowship from the British Medical Association, and the Public Health Laboratory Service, London, UK.


    Footnotes
 
* Corresponding author. Tel: +44-1189-316638; Fax: +44-1189-316671; E-mail: w.s.barclay@reading.ac.uk Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1 . Gubareva, L. V., Matrosovich, M. N., Brenner, M. K. et al. (1998). Evidence for zanamivir resistance in an immunocompromised child infected with influenza B virus. Journal of Infectious Diseases 178, 1257–62.[CrossRef][Web of Science][Medline]

2 . Tisdale, M. (2000). Monitoring of viral susceptibility: new challenges with the development of influenza NA inhibitors. Reviews in Medical Virology 10, 45–55.[CrossRef][Web of Science][Medline]

3 . Rogers, G. N. & Paulson, J. C. (1983). Receptor determinants of human and animal influenza virus isolates: differences in receptor specificity of the H3 hemagglutinin based on species of origin. Virology 127, 361–73.[CrossRef][Web of Science][Medline]

4 . Connor, R. J., Kawaoka, Y., Webster, R. G. et al. (1994). Receptor specificity in human, avian, and equine H2 and H3 influenza virus isolates. Virology 205, 17–23.[CrossRef][Web of Science][Medline]

5 . Couceiro, J. N. S. S., Paulson, J. C. & Baum, L. G. (1993). Influenza virus strains selectively recognise sialyloligosaccharides on human respiratory epithelium; the role of the host cell in selection of hemagglutinin receptor specificity. Virus Research 29, 155–65.[CrossRef][Web of Science][Medline]

6 . Baum, L. G. & Paulson, J. C. (1990). Sialyloligosaccharides of the respiratory epithelium in the selection of human influenza virus receptor specificity. Acta Histochemica 40, Suppl., 35–8.

7 . Weis, W., Brown, J. H., Cusack, S. et al. (1988). Structure of the influenza virus haemagglutinin complexed with its receptor, sialic acid. Nature 333, 426–31.[CrossRef][Medline]

8 . Baum, L. G. & Paulson, J. C. (1991). The N2 neuraminidase of human influenza virus has acquired a substrate specificity complementary to the hemagglutinin receptor specificity. Virology 180, 10–5.[CrossRef][Web of Science][Medline]

9 . Kaverin, N. V., Gambaryan, A. S., Bovin, N. V. et al. (1998). Postreassortment changes in influenza A virus hemagglutinin restoring HA-NA functional match. Virology 244, 315–21.[CrossRef][Web of Science][Medline]

10 . Matrosovich, M., Zhou, N., Kawaoka, Y. et al. (1999). The surface glycoproteins of H5 influenza viruses isolated from humans, chickens and wild aquatic birds have distinguishable properties. Journal of Virology 73, 1146–55.[Abstract/Free Full Text]

11 . Wagner, R., Wolff, T., Herwig, A. et al. (2000). Interdependence of hemagglutinin glycosylation and neuraminidase as regulators of influenza virus growth: a study by reverse genetics. Journal of Virology 74, 6316–23.[Abstract/Free Full Text]

12 . Ito, T., Suzuki, Y., Mitnaul, L. et al. (1997). Receptor specificity of influenza A viruses correlates with the agglutination of erythrocytes from different animal species. Virology 227, 493–9.[CrossRef][Web of Science][Medline]

13 . Morishita, T., Kobayashi, S., Miyake, T. et al. (1993). Host-specific hemagglutination of influenza A (H1N1) virus. Microbiology and Immunology 37, 661–5.[Web of Science][Medline]

14 . Nobusawa, E., Ishihara, H., Morishita, T. et al. (2000). Change in receptor-binding specificity of recent human influenza A viruses (H3N2): a single amino acid change in hemagglutinin altered its recognition of sialyloligosaccharides. Virology 278, 587–96.[CrossRef][Web of Science][Medline]

15 . Medeiros, R., Escriou, N., Naffakh, N. et al. (2001). Hemagglutinin residues of recent human A (H3N2) influenza viruses that contribute to the inability to agglutinate chicken erythrocytes. Virology 289, 74–85.[CrossRef][Web of Science][Medline]

16 . Abed, Y., Bourgault, A.-M., Fenton, R. J. et al. (2002). Characterization of 2 influenza A (H3N2) clinical isolates with reduced susceptibility to neuraminidase inhibitors due to mutations in the hemagglutinin gene. Journal of Infectious Diseases 186, 1074–80.[CrossRef][Web of Science][Medline]

17 . McKimm-Breschkin, J. L., Blick, T. J., Sahasrabudhe, A. et al. (1996). Generation and characterization of variants of NWS/G70C influenza virus after in vitro passage in 4-amino-Neu5Ac2en and 4-guanidino-Neu5Ac2en. Antimicrobial Agents and Chemotherapy 40, 40–6.[Abstract]

18 . Potier, M., Mameli, L., Belisle, M. et al. (1979). Fluorometric assay of neuraminidase with a sodium (4-methylumbelliferyl-alpha-D-N-acetylneuraminate) substrate. Analytical Biochemistry 94, 287–96.[CrossRef][Web of Science][Medline]

19 . McKimm-Breschkin, J., Trivedi, T., Hampson, A. et al. (2003). Neuraminidase sequence analysis and susceptibilities of influenza virus clinical isolates to zanamivir and oseltamivir. Antimicrobial Agents and Chemotherapy 47, 2264–72.[Abstract/Free Full Text]

20 . Boom, R., Sol, C. J. A., Salimans, M. M. M. et al. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28, 495–503.[Abstract/Free Full Text]

21 . Ellis, J. S., Fleming, D. M. & Zambon, M. C. (1997). Multiplex reverse transcription-PCR for surveillance of influenza A and B viruses in England and Wales in 1995 and 1996. Journal of Clinical Microbiology 35, 2076–82.[Abstract]

22 . Ellis, J. S., Chakraverty, P. & Clewley, J. P. (1995). Genetic and antigenic variation in the haemagglutinin of recently circulating human influenza A (H3N2) viruses in the United Kingdom. Archives of Virology 140, 1889–1904.[CrossRef][Web of Science][Medline]

23 . Neumann, G. & Kawaoka, Y. (1999). Genetic engineering of influenza and other negative-strand RNA viruses containing segmented genomes. Advances in Virus Research 53, 265–300.[Web of Science][Medline]

24 . Elleman, C. & Barclay, W. S. (2004). The influenza A virus matrix protein controls virus morphology. Virology in press.

25 . Katz, J. M., Wang, M. & Webster, R. G. (1990). Direct sequencing of the HA gene of influenza (H3N2) virus in original clinical samples reveals sequence identity with mammalian cell-grown virus. Journal of Virology 64, 1808–11.[Abstract/Free Full Text]

26 . Woods, J. M., Bethell, R. C., Coates, J. A. V. et al. (1993). 4-Guanidino-2,4-dideoxy-2,3-dehydro-N-acetylneuraminic acid is a highly effective inhibitor both of the sialidase (neuraminidase) and of growth of a wide range of influenza A and B viruses in vitro. Antimicrobial Agents and Chemotherapy 37, 1473–9.[Abstract/Free Full Text]

27 . Gubareva, L. V., Webster, R. G. & Hayden, F. G. (2001). Comparison of the activities of zanamivir, oseltamivir, and RWJ-270201 against clinical isolates of influenza virus and neuraminidase inhibitor-resistant variants. Antimicrobial Agents and Chemotherapy 45, 3403–8.[Abstract/Free Full Text]

28 . Macken, C., Lu, H., Goodman, J. et al. (2001). The value of a database in surveillance and vaccine selection. In Options for the Control of Influenza IV (Osterhaus, A. D. M. E., Cox, N. & Hampson, A. W., Eds), pp. 103–6. Elsevier Science, Amsterdam.

29 . Bush, R. M., Bender, C. A., Subbarao, K. et al. (1999). Predicting the evolution of human influenza A. Science 286, 1921–5.[Abstract/Free Full Text]

30 . Zambon, M. & Hayden, F. G. (2001). Position statement: global neuraminidase inhibitor susceptibility network. Antiviral Research 49, 147–56.[CrossRef][Web of Science][Medline]

31 . Hayden, F. G., Osterhaus, A. D. M. E., Treanor, J. J. et al. (1997). Efficacy and safety of the neuraminidase inhibitor zanamivir in the treatment of influenza virus infections. New England Journal of Medicine 337, 874–80.[Abstract/Free Full Text]

32 . Baigent, S. J., Bethell, R. C. & McCauley, J. W. (1999). Genetic analysis reveals that both haemagglutinin and neuraminidase determine the sensitivity of naturally occurring avian influenza viruses to zanamivir in vitro. Virology 263, 323–38.[CrossRef][Web of Science][Medline]

33 . Ellis, J. S., Sadler, C. J., Laidler, P. et al. (1997). Analysis of influenza A H3N2 strains isolated in England during 1995–1996 using polymerase chain reaction restriction. Journal of Medical Virology 51, 234–41.[CrossRef][Web of Science][Medline]

34 . Mochalova, L., Gambaryan, A., Romanova, J. et al. (2003). Receptor-binding properties of modern human influenza viruses primarily isolated in Vero and MDCK cells and chicken embryonated eggs. Virology 313, 473–80.[CrossRef][Web of Science][Medline]

35 . Matrosovich, M., Tuzikov, A., Bovin, N. et al. (2000). Early alterations of the receptor-binding properties of H1, H2, and H3 avian influenza virus hemagglutinins after their introduction into mammals. Journal of Virology 74, 8502–12.[Abstract/Free Full Text]

36 . Bethell, R. C., Hart, G. J., Blick, T. J. et al. (1999). Biochemical methods for the characterization of influenza viruses with reduced sensitivity to 4-Guanidino-Neu5Ac2en. In Antiviral Methods and Protocols (Kinchington, D. & Schinazi, R. F., Eds), pp. 367–73. Humana Press Inc., Totowa, NJ, USA.

37 . Gerentes, L., Kessler, N. & Aymard, M. (1998). A sensitive and specific ELISA immunocapture assay for rapid quantitation of influenza A/H3N2 neuraminidase protein. Journal of Virological Methods 73, 185–95.[CrossRef][Web of Science][Medline]

38 . Matrosovich, M., Matrosovich, T., Carr, J. et al. (2003). Overexpression of the {alpha}-2,6-sialyltransferase in MDCK cells increases influenza virus sensitivity to neuraminidase inhibitors. Journal of Virology 77, 8418–25.[Abstract/Free Full Text]

39 . Gubareva, L. V., Kaiser, L., Matrosovich, M. N. et al. (2001). Selection of influenza virus mutants in experimentally infected volunteers treated with oseltamivir. Journal of Infectious Diseases 183, 523–31.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
I. V. Alymova, G. Taylor, V. P. Mishin, M. Watanabe, K. G. Murti, K. Boyd, P. Chand, Y. S. Babu, and A. Portner
Loss of the N-Linked Glycan at Residue 173 of Human Parainfluenza Virus Type 1 Hemagglutinin-Neuraminidase Exposes a Second Receptor-Binding Site
J. Virol., September 1, 2008; 82(17): 8400 - 8410.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. E. Owen, E. Yamada, C. I. Thompson, L. J. Phillipson, C. Thompson, E. Taylor, M. Zambon, H. M. I. Osborn, W. S. Barclay, and P. Borrow
Alterations in Receptor Binding Properties of Recent Human Influenza H3N2 Viruses Are Associated with Reduced Natural Killer Cell Lysis of Infected Cells
J. Virol., October 15, 2007; 81(20): 11170 - 11178.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Hayman, S. Comely, A. Lackenby, L. C. S. Hartgroves, S. Goodbourn, J. W. McCauley, and W. S. Barclay
NS1 Proteins of Avian Influenza A Viruses Can Act as Antagonists of the Human Alpha/Beta Interferon Response
J. Virol., March 1, 2007; 81(5): 2318 - 2327.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. I. Thompson, W. S. Barclay, M. C. Zambon, and R. J. Pickles
Infection of human airway epithelium by human and avian strains of influenza a virus.
J. Virol., August 1, 2006; 80(16): 8060 - 8068.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
53/5/759    most recent
dkh155v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Thompson, C. I.
Right arrow Articles by Zambon, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thompson, C. I.
Right arrow Articles by Zambon, M. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?