Skip Navigation


JAC Advance Access originally published online on September 1, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
52/4/572    most recent
dkg390v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (27)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Li, Y.
Right arrow Articles by Tsuchiya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Y.
Right arrow Articles by Tsuchiya, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


Journal of Antimicrobial Chemotherapy (2003) 52, 572-575
© 2003 The British Society for Antimicrobial Chemotherapy

A new member of the tripartite multidrug efflux pumps, MexVW–OprM, in Pseudomonas aeruginosa

Yang Li, Takehiko Mima, Yukiko Komori, Yuji Morita, Teruo Kuroda, Tohru Mizushima and Tomofusa Tsuchiya*

Department of Microbiology, Faculty of Pharmaceutical Sciences, Okayama University, Tsushima, Okayama, 700–8530, Japan

Received 30 April 2003; returned 25 May 2003; revised 19 June 2003; accepted 25 June 2003


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Objectives: Multidrug efflux pumps are thought to be involved in mediating multidrug resistance in Pseudomonas aeruginosa. Here we aim to characterize hitherto uncharacterized multidrug efflux pumps from P. aeruginosa.

Materials and methods: We isolated a mutant, YM442, which showed elevated resistance to several antimicrobial agents from P. aeruginosa YM44 lacking four major multidrug efflux pumps, MexAB, MexCD–OprJ, MexEF–OprN and MexXY. We cloned genes responsible for the resistance from chromosomal DNA of YM442 using YM44 as host.

Results: We designated the genes mexVW. Introduction of a recombinant plasmid pTAJ2 carrying the mexVW into YM44 cells conferred resistance to fluoroquinolones, tetracycline, chloramphenicol, erythromycin, ethidium bromide and acriflavine. Elevated ethidium bromide extrusion was observed with cells of YM442 and of YM44/pTAJ2. An outer membrane protein OprM was able to cooperate with MexVW. Elevated expression of the mexV gene was observed with YM442 compared with YM44.

Conclusions: MexV (membrane fusion protein)–MexW (RND-type membrane protein)–OprM is a tripartite multidrug efflux pump. It is suggested that other outer membrane component(s) could cooperate with MexVW.

Keywords: MexVW, multidrug efflux pump, RND-type, P. aeruginosa


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Several mechanisms are known by which microorganisms escape the toxicity of antimicrobial agents. Extrusion of toxic compounds from microbial cells is one of these mechanisms. Multidrug efflux pumps extrude many structurally unrelated compounds, and are thus involved in multidrug resistance. So far, five major groups of multidrug efflux pump are known: the MFS (major facilitator super) family, the SMR (small multidrug resistance) family, the RND (resistance nodulation cell division) family, the MATE (multidrug and toxic compounds extrusion) family and the ABC (ATP binding cassette) family.

Pseudomonas aeruginosa shows significant degrees of intrinsic and acquired resistance to a wide variety of antimicrobial agents, including most ß-lactams, fluoroquinolones, tetracycline, chloramphenicol, erythromycin and so on. This is a serious clinical problem because P. aeruginosa is a major opportunistic pathogen and a leading cause of nosocomial infections. At least six RND family drug efflux pumps are known to exist in cells of P. aeruginosa, MexAB–OprM,1 MexCD–OprJ,2 MexEF–OprN,3 MexXY–OprM,4 MexJK–OprM5 and MexHI–OpmD6 (H. Sekiya and T. Tsuchiya, unpublished results). Among these Mex pumps, expression of MexAB–OprM is constitutive and is further enhanced in the presence of antimicrobial agents in the growth medium. Both MexCD–OprJ and MexXY–OprM are expressed only under conditions where inducing drugs are present. MexEF–OprN and MexJK are silent in wild-type P. aeruginosa. Whole genome sequence information of P. aeruginosa is now available,7 and suggests the presence of about 10 RND family multidrug efflux pumps in this microorganism. Previously, we reported the functional cloning of multidrug resistance genes of P. aeruginosa using a drug-hypersensitive Escherichia coli mutant as a host, and obtained many candidate plasmids conferring multidrug resistance.4 We were able to clone mexAB, mexCD and mexXY, but not others.4 These three pumps are functional in wild-type P. aeruginosa. It seems possible that other genes for multidrug efflux pumps are silent, or expression or pump activity is very weak in wild-type P. aeruginosa. Thus, it is impossible to clone such gene(s) by functional cloning.

It is very likely that mutation in hitherto uncharacterized pumps would lead to other multidrug resistances. It is valuable to isolate multidrug-resistant mutants from a P. aeruginosa strain that lacks major multidrug efflux operons.8 It is expected that silent gene(s) for multidrug efflux pumps is(are) functional in such mutants. Here we report the isolation of such a mutant, the functional cloning of genes for a new member of an RND-type multidrug efflux pump (MexVW) from the mutant and properties of the pump.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Strains and growth

P. aeruginosa PAO1, YM44 ({Delta}mexAB, {Delta}mexCD–oprJ, {Delta}mexEF–oprN, {Delta}mexXY), YM442, a drug-resistant derivative of YM44, and YM64 ({Delta}mexAB–oprM, {Delta}mexCD–oprJ, {Delta}mexEF–oprN, {Delta}mexXY)8 were used in this study. YM44 was constructed by Flp-FRT recombination technology as described for YM64.8,9 Bacterial cells were grown in L medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl, pH 7) at 37°C under aerobic conditions.

Isolation of drug-resistant mutants

Cells of P. aeruginosa YM44 were grown in the L medium and were spread onto L agar plates containing four-fold higher concentrations (0.25 mg/L) than the MICs for norfloxacin. We obtained many colonies that appeared on the plates after incubation at 37°C for 20 h. After single colony isolation, we checked the drug resistance patterns of the mutants. One of the mutants, which showed resistance to several antimicrobial agents, was designated YM442, and used for further analysis.

Gene manipulation

Chromosomal DNA was prepared from cells of YM442. The DNA was partially digested with a restriction endonuclease Sau3AI, separated by sucrose density gradient centrifugation, and 4–10 kilobase pair (kbp) fragments were collected. A shuttle vector pUCP20T for P. aeruginosa and E. coli was used as a cloning vector. The chromosomal DNA fragments were ligated to the BamHI site of pUCP20T. The hybrid plasmids were introduced into cells of YM44 by electroporation. Transformants appeared on LB agar plates containing carbenicillin 50 mg/L and norfloxacin 0.5 mg/L. After single colony isolation, plasmid DNA was prepared from the cells, and re-introduced into cells of YM44. Drug resistance of the re-transformant was confirmed, and the plasmid harboured by the cells was designated pER2. The size of the DNA insert in pER2 was about 14 kbp. We sub-cloned a DNA region responsible for drug resistance from pER2, and obtained plasmid pTAJ2. The size of the DNA insert in pTAJ2 was about 5.1 kbp.

The nucleotide sequence was determined by the dideoxy chain termination method10 with an automated DNA sequencer (ALF Express, Pharmacia Biotech.).

RT–PCR

Cells of P. aeruginosa (PAO1, YM44 and YM442) were harvested at the exponential phase of growth (3 mL culture). Total cellular RNA was isolated from the cells using the Qiagen RNeasy Mini Kit (Qiagen Inc., USA), treated with RNase-free DNase (Promega, USA) (1 U of enzyme/µg RNA for 2 h at 37°C) and re-purified using the same kit. A 1 µg sample of DNase-treated RNA was used as template for RT–PCR with the Qiagen OneStep RT–PCR Kit (Qiagen) according to the manufacturer’s protocol. Primer pairs specific for and internal to both mexV and the rpsL genes (encoding a constitutively expressed ribosomal protein that was used as a control) were used for RT–PCR. Primers used for mexV were: CGTCAGCAGATCGCCCTTTTCAGC (forward) and CGCTTTTCGAGATGGCCTTGCTGC (reverse); and for rpsL: GCAACTATCAACCAGCTGGTG (forward) and GCTGTGCTCTTGCAGGTTGTG (reverse). A 6 µL sample of each reaction product was analysed by agarose X (3% w/v) gel electrophoresis for presence of the expected RT–PCR products (for mexV, 331 bp; for rpsL, 220 bp).

Drug susceptibility

The MICs of various drugs were determined by the broth microdilution method with Mueller–Hinton broth (Difco) as reported previously.8 MICs were read after 24 h at 37°C.

Ethidium bromide efflux

Cells were grown in LB medium at 37°C and harvested at the middle exponential phase of growth. Ethidium bromide efflux was measured as reported previously.4


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Isolation of drug-resistant mutant

A mutant P. aeruginosa YM44 lacking mexAB, mexCD–oprJ, mexEF–oprN and mexXY was constructed. This strain, which possesses the oprM gene, is useful for isolation of mutants showing elevated activity of the RND-type pump, which can utilize OprM as an outer membrane component of the tripartite pump. The mutant we isolated, YM442, showed elevated resistance to norfloxacin, ofloxacin, chloramphenicol, cefpirome, tetracycline, ethidium bromide and acriflavine (Table 1). No detectable changes in the resistance levels to other ß-lactams and aminoglycosides were observed compared with the parental YM44 cells. Thus, it seems that one of the hitherto uncharacterized multidrug efflux pumps became functional in the YM442 strain.


View this table:
[in this window]
[in a new window]
 
Table 1.. Antimicrobial susceptibility profiles of YM44, YM442, YM64 and transformants
 
Cloning of genes responsible for multidrug resistance

We tried to clone genes responsible for the multidrug resistance mentioned above from the chromosomal DNA of the mutant YM442. After cloning and sub-cloning using YM44 as a host, we obtained a hybrid plasmid pTAJ2. Cells of YM44/pTAJ2 showed elevated resistance to norfloxacin, ofloxacin, chloramphenicol, cefpirome, tetracycline, ethidium bromide and acriflavine, but not to gentamicin (Table 1). Thus, the drug resistance patterns in YM442 and YM44/pTAJ2 are the same. These results support the idea that the cloned gene(s) is(are) responsible for the elevated drug resistances observed with YM442. The level of drug resistance in YM44/pTAJ2 was higher than that of YM442 to some extent. This may be because of a gene dosage effect since the cloning vector pUCP20T is a multi-copy plasmid.

We determined the nucleotide sequence of several portions of plasmid pTAJ2. We have shown that pTAJ2 carries a DNA region encompassing the open reading frames (ORFs) from PA4374 to a portion of PA4376 (Figure 1), which have been reported in the whole genome sequence of P. aeruginosa.7 Complete ORFs included in pTAJ2 are PA4374 and PA4375. It has been suggested that these two ORFs code for a membrane fusion protein and an RND-type drug efflux protein.7 We designated the ORFs PA4374 and PA4375 as mexV and mexW, respectively, because deduced primary structures of these proteins are similar to those of other Mex proteins. The MexV deduced amino acid sequence showed the highest identity and similarity to MexH, 33% and 48%, respectively, and the MexW to MexI, 46% and 64%, respectively. The mexV (PA4374) gene is preceded by a promoter-like sequence. The lactose promoter of E. coli exists in the vector, but in the opposite direction in the downstream region of the part of PA4376 (Figure 1). Thus, it is very likely that the promoter-like sequence in the pTAJ2 functions as a promoter. A terminator-like sequence is present downstream from the mexW gene.7 We could not find an ORF near the MexVW genes that might encode a regulatory protein.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Restriction map of plasmid pTAJ2 and location of ORFs. The DNA fragment derived from the chromosome of P. aeruginosa YM442 is shown with a thick horizontal bar. Two complete ORFs (solid arrows; mexV(PA4374) and mexW(PA4375)) are present on the pTAJ2 plasmid. The original promoter-like sequence is present upstream from PA4374, and the lactose promoter is present downstream from PA4376 in the vector region, as indicated by arrows at the top.

 
The RND-type multidrug efflux pumps consist of a membrane embedded efflux protein, a membrane fusion protein and an outer membrane channel protein. No gene for an outer membrane protein exists in the downstream region of the mexW gene (PA4375).7 It is likely that PA4376 codes for nicotinate phosphoribosyltransferase judging from sequence similarity. It thus seemed possible that MexVW utilizes OprM as an outer membrane component. We tested this possibility by comparing the MIC values of several antimicrobial agents between YM44/pTAJ2 (possessing OprM) and YM64/pTAJ2 (not possessing OprM). Much higher MIC values were observed with YM44/pTAJ2 than with YM64/pTAJ2 (Table 1). Thus, it is probable that OprM can function as an outer membrane component of the MexVW system. However, YM64/pTAJ2 showed several fold higher MICs than YM64. This indicates that outer membrane component(s) other than OprM can also function as a member of the tripartite MexVW system. We observed no increase in the MIC of chloramphenicol with YM64/pTAJ2, although we observed an increase in the MIC with YM44/pTAJ2 (Table 1). This suggests that the (MexVW)–(OprM) pump can extrude chloramphenicol as a substrate but (MexVW)–(other outer membrane protein) pump cannot. It is interesting that the outer membrane component can affect the substrate specificity of the pump.

Drug efflux

We confirmed that MexVW is a drug efflux pump by measuring ethidium bromide efflux. Cells of YM44 showed a higher level of intracellular ethidium bromide, suggesting no or very low efflux of ethidium bromide from cells (Figure 2). On the other hand, the intracellular ethidium bromide level in YM442 and YM44/pTAJ2 was lower than that in YM44, suggesting efflux of ethidium bromide. The intracellular ethidium bromide level increased when a H+ conductor carbonylcyanide m-chlorophenylhydrazone (CCCP) was added to the assay mixture. Thus, energy-dependent efflux of ethidium bromide occurred in cells of YM442 and YM44/pTAJ2. Addition of CCCP to a cell suspension of YM44 gave only a slight effect on the intracellular ethidium bromide level, suggesting that energy-dependent efflux of ethidium bromide is very low in YM44. We observed a similar intracellular ethidium bromide level with cells of YM442 compared to that with YM44/pTAJ2 (Figure 2). Thus, the energy-dependent efflux of ethidium bromide is high in these two types of cells. These results support the idea that genes on plasmid pTAJ2, namely mexV and mexW, code for a drug efflux pump.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 2. Ethidium bromide efflux in cells. The levels of intracellular ethidium bromide in P. aeruginosa YM44, YM442 or YM44/pTAJ2 were monitored continuously by measuring the fluorescence of ethidium bromide. Ethidium bromide (final concentration 100 µM) was added to the assay mixture to initiate the assay, and CCCP (final concentration 50 µM) was added to inhibit energy (proton-motive force).

 
Over-expression of the mexVW in YM442

It seemed that the mexVW operon was silent or expression was weak in wild-type P. aeruginosa and in YM44, whereas the operon was over-expressed in the mutant YM442. We confirmed by the RT–PCR method that expression of the mexV gene was very weak in wild-type PAO1 and parental YM44, and the gene was over-expressed in the mutant YM442 (roughly 4.4-fold over-expression) (Figure 3).



View larger version (88K):
[in this window]
[in a new window]
 
Figure 3. RT–PCR analyses. RT–PCR products indicating the expression of the mexV (a) and rpsL (b) genes of P. aeruginosa PAO1 (lane 2), YM44 (lane 3) and YM442 (lane 4) are shown. A 6 µL aliquot of each reaction product was analysed by agarose X (3% w/v) gel electrophoresis. pBR322 digested with the restriction enzyme MspI was used as a molecular weight standard (lane 1).

 
In conclusion, MexVW functions as a multidrug efflux pump using OprM or other outer membrane protein(s) as a component of the tripartite pump in the mutant YM442. Over-expression of the mexVW operon was observed with the mutant YM442 compared with wild-type PAO1 and parental YM44.


    Acknowledgements
 
We thank Dr M. Varela of Eastern New Mexico University for critical reading of the manuscript. This research was supported in part by a grant from the Ministry of Education, Science, Sport and Culture of Japan.


    Footnotes
 
* Corresponding author. Tel/Fax: +81-86-251-7957; E-mail: tsuchiya{at}pharm.okayama-u.ac.jp Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
1 . Poole, K., Krebes, K., McNally, C. et al. (1993). Multiple antibiotic resistance in Pseudomonas aeruginosa: evidence for involvement of an efflux operon. Journal of Bacteriology 175, 7363–72.[Abstract/Free Full Text]

2 . Poole, K., Gotoh, N., Tsujimoto, H. et al. (1996). Overexpression of mexC-mexD-oprJ efflux operon in nfxB-type multidrug-resistant strains of Pseudomonas aeruginosa. Molecular Microbiology 21, 713–24.[CrossRef][Web of Science][Medline]

3 . Kohler, T., Michea-Hamzehpour, M., Henze, U. et al. (1997). Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Molecular Microbiology 23, 345–54.[CrossRef][Web of Science][Medline]

4 . Mine, T., Morita, Y., Kataoka, A. et al. (1999). Expression in Escherichia coli of a new multidrug efflux pump, MexXY, from Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 43, 415–7.[Abstract/Free Full Text]

5 . Chuanchuen, R., Narasaki, C. T. & Schweizer, H. P. (2001). The MexJK efflux pump of Pseudomonas aeruginosa requires OprM for antibiotic efflux but not for efflux of triclosan. Journal of Bacteriology 184, 5036–44.

6 . Aendekerk, S., Ghysels, B., Cornelis, P. et al. (2002). Characterization of a new efflux pump, MexGHI-OpmD, from Pseudomonas aeruginosa that confers resistance to vanadium. Microbiology 148, 2371–81.[Abstract/Free Full Text]

7 . Stover, C. K., Pham, X. Q., Erwin, A. L. et al. (2000). Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406, 959–64.[CrossRef][Medline]

8 . Morita, Y., Komori, Y., Mima, T. et al. (2001). Construction of a series of mutants lacking all of the four major mex operons for multidrug efflux pumps or possessing each one of the operons from Pseudomonas aeruginosa PAO1: MexCD-OprJ is an inducible pump. FEMS Microbiology Letters 202, 139–43.[CrossRef][Web of Science][Medline]

9 . Hoang, T. T., Karkhoff, S. R., Kutchma, A. J. et al. (1998). A broad host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212, 77–86.[CrossRef][Web of Science][Medline]

10 . Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74, 5463–7.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
L. Vettoretti, P. Plesiat, C. Muller, F. El Garch, G. Phan, I. Attree, A. Ducruix, and C. Llanes
Efflux Unbalance in Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients
Antimicrob. Agents Chemother., May 1, 2009; 53(5): 1987 - 1997.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
K. Jeannot, S. Elsen, T. Kohler, I. Attree, C. van Delden, and P. Plesiat
Resistance and Virulence of Pseudomonas aeruginosa Clinical Strains Overproducing the MexCD-OprJ Efflux Pump
Antimicrob. Agents Chemother., July 1, 2008; 52(7): 2455 - 2462.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
L. Zhang and T.-F. Mah
Involvement of a Novel Efflux System in Biofilm-Specific Resistance to Antibiotics
J. Bacteriol., July 1, 2008; 190(13): 4447 - 4452.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
J. M. Struble and R. T. Gill
Reverse Engineering Antibiotic Sensitivity in a Multidrug-Resistant Pseudomonas aeruginosa Isolate.
Antimicrob. Agents Chemother., July 1, 2006; 50(7): 2506 - 2515.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
L. Pumbwe, O. Ueda, F. Yoshimura, A. Chang, R. L. Smith, and H. M. Wexler
Bacteroides fragilis BmeABC efflux systems additively confer intrinsic antimicrobial resistance
J. Antimicrob. Chemother., July 1, 2006; 58(1): 37 - 46.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
D. Hocquet, P. Nordmann, F. El Garch, L. Cabanne, and P. Plesiat
Involvement of the MexXY-OprM Efflux System in Emergence of Cefepime Resistance in Clinical Strains of Pseudomonas aeruginosa.
Antimicrob. Agents Chemother., April 1, 2006; 50(4): 1347 - 1351.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
S. A. Alyaseen, K. E. Piper, M. S. Rouse, J. M. Steckelberg, and R. Patel
Selection of Cross-Resistance following Exposure of Pseudomonas aeruginosa Clinical Isolates to Ciprofloxacin or Cefepime
Antimicrob. Agents Chemother., June 1, 2005; 49(6): 2543 - 2545.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. L. Sobel, S. Neshat, and K. Poole
Mutations in PA2491 (mexS) Promote MexT-Dependent mexEF-oprN Expression and Multidrug Resistance in a Clinical Strain of Pseudomonas aeruginosa
J. Bacteriol., February 15, 2005; 187(4): 1246 - 1253.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
J. Kriengkauykiat, E. Porter, O. Lomovskaya, and A. Wong-Beringer
Use of an Efflux Pump Inhibitor To Determine the Prevalence of Efflux Pump-Mediated Fluoroquinolone Resistance and Multidrug Resistance in Pseudomonas aeruginosa
Antimicrob. Agents Chemother., February 1, 2005; 49(2): 565 - 570.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
D. Nehme, X.-Z. Li, R. Elliot, and K. Poole
Assembly of the MexAB-OprM Multidrug Efflux System of Pseudomonas aeruginosa: Identification and Characterization of Mutations in mexA Compromising MexA Multimerization and Interaction with MexB
J. Bacteriol., May 15, 2004; 186(10): 2973 - 2983.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. K. Middlemiss and K. Poole
Differential Impact of MexB Mutations on Substrate Selectivity of the MexAB-OprM Multidrug Efflux Pump of Pseudomonas aeruginosa
J. Bacteriol., March 1, 2004; 186(5): 1258 - 1269.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
G.-X. He, T. Kuroda, T. Mima, Y. Morita, T. Mizushima, and T. Tsuchiya
An H+-Coupled Multidrug Efflux Pump, PmpM, a Member of the MATE Family of Transporters, from Pseudomonas aeruginosa
J. Bacteriol., January 1, 2004; 186(1): 262 - 265.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
52/4/572    most recent
dkg390v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (27)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Li, Y.
Right arrow Articles by Tsuchiya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Y.
Right arrow Articles by Tsuchiya, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?