JAC Advance Access originally published online on June 12, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Antimicrobial Chemotherapy (2003) 52, 43-49
© 2003 The British Society for Antimicrobial Chemotherapy
DHFR and DHPS genotypes of Plasmodium falciparum isolates from Gabon correlate with in vitro activity of pyrimethamine and cycloguanil, but not with sulfadoxinepyrimethamine treatment efficacy
1 Centre International de Recherches Médicales de Franceville, Unité de Parasitologie Médicale, BP 769 Franceville; 4 Bakoumba Hospital, BP52, Bakoumba, Gabon; 2 Hôpital Bichat-Claude Bernard, Laboratoire de Parasitologie, 46 rue Henri Huchard, 75877 Paris; 5 IRD UR010, Faculté de Pharmacie, Laboratoire de Parasitologie, 4 Avenue de lObservatoire, 75006 Paris, France; 3 Institut de Recherche pour le Développement (IRD), UR010, Mother and Child Health in the Tropics, BP1386, Dakar, Senegal
Received 25 September 2002; returned 7 March 2003; revised 17 March 2003; accepted 22 April 2003
| Abstract |
|---|
|
|
|---|
Objectives: To assess the relationship between the presence of DHFR and DHPS mutations in Plasmodium falciparum, parasite in vitro resistance, and in vivo efficacy of sulfadoxinepyrimethamine (SP) treatment.
Patients and methods: Measurement of SP treatment efficacy in malaria-infected children in Gabon was combined with in vitro tests of susceptibility to pyrimethamine and cycloguanil, and molecular genotyping at several DHFR and DHPS loci of parasites isolated before treatment. DHFR was studied at codons 108, 51, and 59, whereas DHPS gene was typed at positions 436, 437, 540 and 581.
Results: SP treatment was effective in 86% of children by day 28. Seventy-five percent of isolates were in vitro resistant to pyrimethamine and 65.5% to cycloguanil. No mutation was detected at codons 540 and 581 of the DHPS gene. Most isolates (71.8%) presented with the triple mutant DHFR genotype, whereas 64.3% combined at least three DHFR and one DHPS mutations. The increase in the number of DHFR mutations was associated with an increase in in vitro resistance to pyrimethamine and cycloguanil; three DHFR mutations conferred pyrimethamine and to a lesser extent cycloguanil resistance. Treatment failures only occurred with isolates presenting at least two DHFR mutations (S108N and C59R) and one DHPS mutation (S436A or A437G), but SP treatment of infections with such parasites gave treatment success in 82.0% of children.
Conclusions: DHFR mutations that lead to high-level in vitro resistance to pyrimethamine plus 12 DHPS mutations are not sufficient to induce in vivo failure of SP treatment in young children from Gabon.
Keywords: malaria, drug resistance, antifolates, molecular markers
| Introduction |
|---|
|
|
|---|
The spread of Plasmodium falciparum resistance to cheap drugs is a serious world-wide problem, considering the limited number of drugs available, the lack of vaccine, and the morbidity and mortality impact of malaria. The combinations of proguanil with atovaquone or chlorproguanil plus dapsone, may constitute effective alternative treatments in chloroquine-resistant areas.13 Currently, the most common alternative drug to chloroquine remains the sulfadoxinepyrimethamine (SP) combination. The extensive use of SP combination has led however to rapid emergence and spread of resistant parasites.4 Pyrimethamine and proguanil (or cycloguanil, its active metabolite) inhibit the dihydrofolate reductase (DHFR) present in Plasmodium as a bifunctional enzyme with thymidylate synthase (DHFR-TS). The target of sulfadoxine is the dihydropteroate synthase (DHPS), also part of a bifunctional enzyme, the 7,8-dihydro-6-hydroxymethylpterin pyrophosphokinase-DHPS (PPK-DHPS). The molecular basis of P. falciparum resistance to antifolates consists of point mutations in genes encoding for both DHFR and DHPS. The understanding of resistance molecular mechanisms is of utmost importance for both designing new drugs and providing molecular markers to monitor drug activity and treatment efficacy.
In vitro resistance to pyrimethamine and cycloguanil has been attributed to the key mutation DHFR S108N; additive mutations in DHFR N51I and C59R conferring higher levels of resistance.59 Mutations DHPS S436A, A437G and K540E were related to in vitro resistance to sulfadoxine.10 Alternative mutations DHFR S108T plus A16V or additional mutations DHFR I164L, A613S/T, and DHPS A581G, are more rare in Africa, but are thought to increase the levels of resistance.11,12 Relation to treatment efficacy is more controversial, but DHFR triple mutant at codons 108, 51 and 59 was mostly associated with SP treatment failure, regardless of DHPS genotype.3, 13
As additional field data are needed for understanding antifolate drug resistance molecular mechanisms, we studied the major mutations present in Central Africa in relation to SP treatment outcome in Gabonese children and measured the in vitro susceptibility of isolates to pyrimethamine and cycloguanil.
| Materials and methods |
|---|
|
|
|---|
Data shown in this article are part of a treatment efficacy study that compared the sulfadoxinepyrimethamine (SP) combination and amodiaquine treatments, involving 252 children in Gabon.14 In vivo follow-up summarizes the results for the 128 subjects treated with SP, whereas in vitro tests, as well as DHFR and DHPS genotyping, involve the 252 subjects.
Study area and population
The study was conducted between January and June 2000 in Bakoumba, a village located in southeast Gabon in the Haut-Ogooué province. This village of 3000 inhabitants is surrounded by the equatorial forest, and belongs to a meso- to hyper-endemic area for P. falciparum malaria where parasite transmission is perennial with seasonal variations according to the rains.15 During this study, the multiplicity of infection (defined as the mean number of parasite genotypes per man) was 4.0, according to msp-1 and msp-2 polymorphism (Aubouy et al., unpublished results). Children aged 6 months to 10 years, presenting at the outpatient clinic with non-severe malaria attack were enrolled for a 28 day follow-up according to the WHO protocol.16 The study was approved by the Centre International de Recherches Médicales de Franceville (CIRMF) ethical committee, and verbal informed consent was obtained from all parents or guardians.
Treatment and follow-up of children
At enrolment, a medical history was taken and a clinical examination was made. A finger-prick blood sample was obtained to measure parasite density, and children were given orally 25 mg/kg of sulfadoxine and 1.25 mg/kg of pyrimethamine (Creat, Vernouillet, France) as a single dose on Day 0 under supervision. Treatment was completed with three doses of paracetamol per day (10 mg/kg per day) at Day 0 and Day 1. Children fulfilling the criteria of early or late clinical failure (see below) were given an alternative treatment. Parents were asked to bring their child back on Days 1, 2, 3, 7, 14 and 28, as well as any other day if the child was unwell. Temperature and parasite density were measured at each visit. Following finger-prick puncture, three drops of blood were collected on Whatman 3MM filter paper at Day 0 for DHFR and DHPS genotyping.
Both clinical and parasitological data were considered to analyse treatment efficacy, according to the revised WHO in vivo protocol for areas of intense transmission,17 but the follow-up was extended to 28 days. This classification differs from the preceding one by the recognition of an additional group (inside the late treatment failures group) of late parasitological failures defined by the presence of parasitaemia on any day after Day 14, without meeting any of the criteria of early treatment failure or late clinical failure.
In vitro drug susceptibility tests
Distilled water and ethanol were, respectively, used to prepare stock solutions and dilutions of cycloguanil (Cy; Astra-Zeneca, Courbevoie, France) and pyrimethamine (Pyr; Sigma Aldrich, Saint Quentin Fallavier, France). The final concentrations ranged from 50 to 40 000 nM for Pyr, and 10 to 20 000 nM for Cy. Twenty microlitres of each concentration were distributed in triplicate, in 96-well tissue culture plates, and dried under a laminar flow hood before conservation at room temperature in dark and dry conditions. The venous blood samples collected at Day 0 were treated within 48 h after sampling. The erythrocytes were washed twice in RPMI 1640 medium, after isolation by centrifugation. The erythrocytes (haematocrit of 1.5% and initial parasitaemia of 0.11.0%) were resuspended in RPMI SP 241 medium (Gibco BRL, Paisley, UK) with a low concentration of folic acid and p-aminobenzoic acid, containing 10% human non-immune serum (Valbiotech, Paris, France), 25 mM HEPES, 25 mM NaHCO3, and 0.2% [3H]hypoxanthine (specific activity 5 Ci/mmol, Amersham). The in vitro drug sensitivity assay was assessed by the isotopic semi-microtest as described.17
The 50% inhibitory concentration (IC50) values were calculated, defined as the drug concentration corresponding to 50% of the uptake of [3H]hypoxanthine measured in the drug-free control wells. The calculation was based on linear regression analysis of the logarithm of concentrations plotted against the percentage growth inhibition. Isolates were defined as susceptible to pyrimethamine when IC50 values were <100 nM, and resistant when >2000 nM. For cycloguanil, thresholds for susceptibility and resistance were, respectively, defined as <50 nM and >500 nM. Data were expressed as median IC50 values and 25th75th percentiles.
DNA extraction and DHFR, DHPS genotyping
Blood collected on Whatman 3MM filter paper before treatment was dried and conserved at room temperature until DNA chelex extraction, as described.18 The molecular beacons method19 was used to study the DHFR S108N mutation in all isolates with the following primers: 5' TGTGGATAATGTAAATGATATGCC 3' (upper) and 5' CATTTATCCTATTGCTTAAAGGTT 3' (lower). Point mutations DHFR N51I, C59R and DHPS S436A, A437G, K540E, A581G were analysed by sequencing in 97 samples from children having been treated with SP. Additionally, one out of five samples (27) corresponding to children treated with amodiaquine were tested for DHPS mutation. Briefly, 4 µL of chelex extracted DNA was amplified in a 50 µL reaction mixture containing 0.3 µM of each primer (DHFR 5159 upper: 5' CACATTTAGAGGTCTAGGAAATAAAGGA 3'; DHFR 5159 lower: 5' TCAATTTTTCATATTTTGATTCATTCAC 3'; DHPS upper: 5' TTTGTTGAACCTAAACGTGTCT 3'; DHPS lower: 5' TCTTCGCAAATCCTAATCCAA 3'), 200 µM of dNTPs, buffer (50 mM KCl, 10 mM TrisHCl, pH 8.3, 1 mM MgCl2), and 2.5 U of Thermus aquaticus DNA polymerase (AmpliTaq Gold, Perkin Elmer, Courtaboeuf, France). Samples were incubated for 5 min at 94°C for denaturation before cycles (94°C 45 s, 59°C 45 s, 72°C 45 s). After 35 cycles, 5 min at 72°C allowed primer extension. PCR products were purified using a QIAquick PCR purification kit (Qiagen, Courtaboeuf, France), before sequencing with an ABI PRISM Big Dye Terminator Cycle sequencing kit (Perkin Elmer Cetus), following the manufacturers instructions (P/N 4303149 revision C, 1998). Fluorescent PCR products were sequenced in an ABI PRISM 3100 Genetic Analyser.
Statistical analysis
The relationship between pyrimethamine and cycloguanil IC50 values was assessed by regression analysis. KruskalWallis test and MannWhitney U-test were used to study the relation between IC50 values and genotypes. The relation between in vivo or in vitro phenotype, with molecular genotypes was studied by
2 tests and Spearman correlation tests.
| Results |
|---|
|
|
|---|
In vivo efficacy of SP
These data were previously reported in detail (Aubouy et al., unpublished results). Briefly, 128 children less than 10 years were enrolled in the in vivo study. Mean age (±S.E.) was 3.9 (±0.2) years, and the group was composed of 43% females. Fourteen children were lost before Day 7 of follow-up and subsequently excluded from the analysis. SP treatment gave adequate clinical and parasitological responses (ACPR) in 98 subjects (86.0%), whereas two early therapeutic failures (ETF) occurred (1.8%), and the 14 late therapeutic failures (LTF) were composed of three late clinical failures (2.6%), and 11 late parasitological failures (9.6%). All treatment failures were due to recrudescent parasites, as shown by msp-1 and msp-2 analysis.14 In several cases, appearance of new populations was also observed.
In vitro susceptibility to pyrimethamine and cycloguanil
The 252 isolates obtained from patients at Day 0 were tested for in vitro susceptibility to drugs. Sixty (23.8%) isolates gave interpretable results for pyrimethamine and 55 (21.8%) for cycloguanil. These low success rates contrast with the higher rates (63.5 and 62.0%) achieved with chloroquine and monodesethyl-amodiaquine using the same blood samples (data not shown). Seventy-three (29.0%) isolates did not grow in the presence, or absence, of any of the four drugs tested, whereas two (0.8%) additional isolates did not grow in the RPMI SP 241 medium, used for pyrimethamine and cycloguanil activity testing. The growth of 117 (46.4%) and 122 (48.4%) were not inhibited at maximal doses of pyrimethamine and cycloguanil, respectively, or furnished uninterpretable results (no dose/activity response or poor homogeneity of triplicate wells). Consequently, these isolates were excluded from the analysis. Forty-five (75.0%) and 36 (65.5%) isolates were in vitro resistant to pyrimethamine and cycloguanil, respectively with IC50 median values (25th75th percentiles) of 7325 (41912 665) nM and 1614 (636826) nM, respectively. Two isolates (3.3%) had an intermediate susceptibility to pyrimethamine with IC50 values of 296 and 306 nM, and six (10.9%) to cycloguanil with an IC50 median value of 83.5 (67330) nM. Thirteen isolates (21.7% and 23.6%, respectively) were susceptible to pyrimethamine and cycloguanil with median IC50 of 19 (1249) nM and 6 (425) nM, respectively. Pyrimethamine and cycloguanil IC50 values were highly correlated (regression analysis, r = 0.86, P < 0.0001), suggesting in vitro cross-resistance to both drugs. In addition, no isolate susceptible to one drug was resistant to the other, although one was susceptible to pyrimethamine (IC50 = 77 nM), and intermediate to cycloguanil (IC50 = 67 nM).
DHFR and DHPS genotypes
The molecular beacons technique was used to study the mutation S108N in 252 isolates with an efficiency of 79.8%. Ninety-seven samples were from children having been treated with SP for the study by sequencing of N51I and C59R DHFR mutations, and of DHPS mutations. Twenty-seven isolates were sequenced in addition at DHPS 436 and 437 loci. Fifty-five isolates were sequenced for mutations at positions 540 and 581, and were all wild-type. As this result was consistent with previous data from the same area,20 the remaining isolates were not analysed. The overall efficiency rate of sequencing was 92.4%. Consequently, results are available for 246 DHFR 108 genotypes, 90 DHFR 51 and 59 genotypes, 110 DHPS 436 and 437 genotypes, and 55 DHPS 540 and 581 genotypes.
As presented in Table 1, the frequency of samples composed of DHFR mutant isolates at codons 108, 51 and 59 were, respectively, 63.0%, 83.3% and 67.8%. In addition, the prevalence rates of mixed genotypes with regard to the DHFR loci, containing both wild and mutant parasites, were 19.5%, 3.3% and 5.6%, respectively. The higher proportion of mixed isolates at codon 108 is probably the consequence of the higher ability of molecular beacons than sequencing to detect minor genotypes. Among the 85 samples typed for the three DHFR loci, 74 contained unmixed (as regards to these loci) parasite populations, and most of these (68.9%) harboured all three DHFR mutations, whereas 16.2% harboured two mutations, and 5.4% a single mutation. Among the mixed genotypes, one resulted in two mutations at codons 108 (mixed) and codon 51 (unmixed). The 10 remaining mixed genotypes with regard to the DHFR loci resulted in three mutations, with mix at codon 108 (five cases), codon 59 (two cases), or at both codons 51 and 59 (three cases), increasing the rate of samples containing isolates presenting with three DHFR mutations to 71.8%. No other polymorphism was detected in the DHFR3959 sequenced region. At the DHPS gene, mutations K540E and A581G were not detected, whereas 28.2% and 57.3% of samples presented the mutations S436A and A437G, respectively (Table 1). Both wild and mutant parasites were detected at a frequency of 6.4% for each of these two DHPS point mutations. Among the 110 samples typed for both 436 and 437 DHPS loci, 103 contained unmixed parasite populations (as regards to these loci). In the wide majority (87.1%), unmixed isolates presented a single DHPS mutation, A437G being the most frequent (Table 1). Two unmixed isolates (2.0%) presented with both S436A and A437G mutations. Two mixed samples at the DHPS loci resulted in one mutation at either codon 436 or 437. In two more samples, mixed genotypes at either codon 436 or 437 resulted in two mutations. Both mixed genotypes at codons 436 and 437 were detected in five samples. No other polymorphism was detected in the DHPS425542 sequenced region. The combined analysis of DHFR and DHPS genotypes showed that most unmixed isolates (62.0%) with regard to the DHFR/DHPS loci harboured at least three DHFR and one DHPS mutations. The most common genotype (43.7%) was N, I, R at positions DHFR 108, 51 and 59, and S and G at positions DHPS 436 and 437. With the addition of mixed samples at the DHFR/DHPS loci, 64.3% of samples included genotypes with at least three DHFR and one DHPS mutation.
|
Relation between DHFR and DHPS genotypes, in vitro and in vivo data
The presence of DHFR point mutations was linked to in vitro resistance to pyrimethamine and cycloguanil. The phenotype of in vitro susceptibility to pyrimethamine or cycloguanil was associated with wild DHFR genotypes at positions 108, 51, and 59 (
2 test, Pyr: P < 0.0001 for codons 108 and 59, P = 0.002 for codon 51; Cy: P = 0.0005 for codon 108, P = 0.03 for codon 51 and P = 0.05 for codon 59) (Table 2), whereas no relationship was observed with DHPS genotypes. Figure 1 shows that low IC50 values were associated with wild DHFR genotypes, as opposed to mixed and mutant genotypes. Again, no difference was evident with DHPS 436 and 437 genotypes. Table 3 shows the different genotypes of all isolates with complete genotyping in relation to in vivo and in vitro results. As mixed and mutant genotypes showed similar in vitro phenotypes (Figure 1), mixed genotypes were considered as mutant for this analysis. Mutations DHPS K540E and A581G were not included in this analysis, as all sequenced isolates presented with the wild genotype. All samples exhibiting in vitro resistance to pyrimethamine and cycloguanil were associated with the presence of the DHFR S108N mutation (Table 2). In vitro data for pyrimethamine and cycloguanil were available for 39 and 29 samples, respectively, presenting with this mutation. Among these, 35 and 25 were resistant to the corresponding drug. Figure 2 represents the impact of the increase in the number of DHFR mutations on SP treatment outcome, and in vitro susceptibility to pyrimethamine and cycloguanil. Such increase was highly correlated to in vitro results (Spearman correlation test, r = 0.84, P = 0.0002 and r = 0.73, P = 0.002). When DHFR and DHPS number of mutations were both analysed, the increase was also highly significant (Spearman correlation test, r = 0.83, P = 0.0003 and r = 0.76, P = 0.0016 for Pyr and Cy, respectively).
|
|
|
|
No such correlations were observed with SP treatment outcome, although 10/11 of treatment failures appeared in the presence of parasites with at least three mutations (Table 3). Failure of SP treatment occurred for one child infected by an isolate in which only a wild genotype for both DHFR and DHPS mutations was detected. In vitro susceptibility of this isolate was not determined, but the child presented with low post-treatment plasma concentrations of sulfadoxine (85 µg/mL) and pyrimethamine (98 ng/mL), compared with the mean (±S.E.) concentrations exhibited by the other children (100.0 ± 4.2 µg/mL and 212.0 ± 14.4 ng/mL, respectively).14 No other in vivo failure arose in children infected with isolates presenting with less than two mutations at DHFR loci (in the presence or not of DHPS mutations). One late failure was due to an isolate presenting the genotype mutant at codons 59 and 108 of DHFR, and 437 of DHPS. The other failures occurred in children infected by isolates presenting three DHFR mutations concomitant to one or two DHPS mutations. Early treatment failure occurred in the presence of a single isolate (among 31) presenting mutations S108N, N51I and C59R of the DHFR gene and A437G of the DHPS gene. However, infection by six isolates presenting three DHFR mutations and two DHPS mutations did not lead to early treatment failure. In addition, infections by isolates presenting three DHFR and one or two DHPS mutations led most often (82.0%) to treatment success (Table 2). Unfortunately, our isolates did not include a genotype mutant at both 436 and 437 DHPS positions, and wild at DHFR locus, that would have allowed us to analyse the consequences of dual DHPS mutation on the response to SP treatment.
| Discussion |
|---|
|
|
|---|
Our study combined in vitro and in vivo tests, as well as molecular genotyping at DHFR and DHPS loci. SP treatment failed in 14.0% of children, whereas 75.0% of isolates were resistant in vitro to pyrimethamine and 65.5% to cycloguanil, and whereas 64.3% presented the triple mutant DHFR genotype combined with a DHPS 436 and/or 437 mutation. Molecular and in vitro data were strongly related, whereas both methods rarely reflected in vivo data.
SP combination was efficient in treating malaria attacks in young Gabonese children, although most isolates were in vitro resistant to pyrimethamine. A similar discrepancy between in vivo and in vitro results was observed in Cameroon,21 where SP treatment failure rate was 12.1%, and 60.5% of isolates were in vitro resistant to pyrimethamine. Several factors may explain these disparities, such as the use of pyrimethamine only for carrying out the in vitro tests whereas both pyrimethamine and sulfadoxine are given simultaneously as treatment. Unfortunately, in vitro testing of sulfadoxine gives inconsistent results.22 Secondly, treatment failures reflect the combination of several parameters, including parasite resistance to the drug, drug level achieved in the host, and action of the host immune response (although this latter parameter is likely not to play a major role in this study, given the young age of our study population).
The triple DHFR mutant at codons 108, 51 and 59 was highly prevalent (71.8%) among our isolates. Such high prevalence rates above 50% were also reported in Vietnam,10,12 Malaysia23 and Brazil.24 In East Africa, this rate reaches around 30%.25 Our method did not allow detection of DHFR S108T mutant isolates. However, a previous study in a nearby area of Gabon detected this mutation in a single sample among 81, and as in our study, did not reveal any DHPS mutations at codons 540 and 581.20 In the Bakoumba area, the common DHPS 436 and 437 mutations were frequent, particularly at codon 437. Double DHPS mutation was detected in two isolates only, resulting in the high prevalence (64.3%) of the genotype presenting with at least three DHFR mutations and one DHPS (436 or 437) mutation.
Our results confirm DHFR S108N is a key mutation for in vitro resistance to pyrimethamine and cycloguanil,5,6,8,9 as all in vitro resistant isolates presented the mutant N genotype. Conversely, among samples presenting this mutation and for which in vitro data are available, one of 16 was susceptible to pyrimethamine and one of 12 was susceptible to cycloguanil. PCR-based methods do not detect minor clones in a mixed population, but although a wild-type clone may remain undetected, this is unlikely for in vitro susceptibility, as IC50 mainly reflects the susceptibility of the major clone(s) present in the blood sample. Mutations DHFR N51I and C59R are thought to increase in vitro resistance to both drugs.7 However, in Papua New Guinean isolates, the presence of mutant genotypes at both codons 59 and 108 did not imply pyrimethamine or cycloguanil in vitro resistant phenotype.8 Similarly, the three Gabonese isolates presenting concomitant mutations at S108N and N51I (in the absence of the C59R mutation) of the DHFR gene included isolates that were either in vitro susceptible or resistant to pyrimethamine, and either intermediate or resistant to cycloguanil. Although four samples presented with the three DHFR mutations at codons 108, 51 and 59 and no DHPS mutation, the in vitro activity of pyrimethamine and cycloguanil against these was determined in a single sample, which was highly resistant to pyrimethamine and presented an intermediate susceptibility to cycloguanil. The triple DHFR mutant at positions 108, 51 and 59 has been strongly associated with in vitro resistance to pyrimethamine,13,26 whereas other point mutations, DHFR S108T plus A16V, and I164L are also thought to be of importance for in vitro resistance to both cycloguanil and pyrimethamine. Although these mutations have mostly been detected in South America and southeast Asia,7,10,12,27,28 the latter mutation I164L in combination with two or three other DHFR point mutations including S108N, has been shown to be associated with high in vitro resistance levels to pyrimethamine, and to a lesser extent to cycloguanil.28 DHFR V16 plus T108 mutation seems to confer more specifically resistance to cycloguanil.27,28,30
One striking result is shown in Table 2 where isolates presenting with two or three DHFR mutations, whatever DHPS genotype, were preferentially associated with both in vitro resistant parasites and treatment failure in children. At such a level of mutations, most isolates (100.0% and 66.7% for pyrimethamine and cycloguanil, respectively, in the case of at least three DHFR mutations) were in vitro highly resistant but were originating from treatment failures in a minority of children (16.7% in the case of at least three DHFR mutations). In Malawi, Kublin et al.31 demonstrated a strong correlation between SP treatment failure and the DHFR triple mutant. Nevertheless, DHPS 437 and 540 mutations had a great importance in their study, as both double DHPS mutant and quintuple DHFR and DHPS mutants were highly correlated with SP treatment failure. Furthermore, in areas of such endemicity as southeast Gabon, parasites need to combine point mutations with other mechanisms to escape host regulation of infection, essentially immune mechanisms. The parasite may acquire more easily an efficient mechanism of resistance to drugs than to immune response, which may explain part of the in vivo and in vitro result disparities.
Interestingly, the infection by the single mutant isolate at codons 59 and 108 (and not 51) of DHFR, and 437 of DHPS, gave treatment failure, whereas all seven isolates presenting mutations at codons 51 and 108 (and not 59) of DHFR, and 437 of DHPS, gave treatment success. This result stresses the importance of the mutation C59R for SP treatment outcome. DHPS mutations are known to have an effect on sulfadoxine resistance, as proven by genetic crossbreeding between sensitive and resistant sulfadoxine parasites.10,32 In humans, many studies reported the poor predictive value of DHPS mutations for SP treatment failure.13,33 SP treatment gave treatment success in all three children infected with isolates that were triple DHFR mutant and double DHPS wild-type. However, the unbalanced numbers of genotypes does not allow us to draw conclusions on the impact of DHPS mutations.
We conclude that failure of SP treatment in this area of Gabon is related to the combination of at least two DHFR (C59R and S108N) and one DHPS mutations (S436A or A437G). However, such mutations were not sufficient to lead to SP treatment failure in most Gabonese children. In vitro, the three DHFR mutations conferred pyrimethamine and to a lesser extent, cycloguanil resistance. The increase in the number of DHFR and DHPS mutations was strongly correlated to resistance to pyrimethamine and cycloguanil. Further studies are needed to determine the precise incidence of the combination of DHFR and DHPS mutations on SP treatment outcome and in vitro resistance to antifolates. However, the poor success rate of in vitro tests to pyrimethamine and cycloguanil (as compared to schizontocidal drugs), as well as the high prevalence of site-specific DHFR and DHPS genotypes, make difficult the precise analysis of the role of each genotype on the in vivo and in vitro parasite susceptibilities. In many areas where chloroquine is not effective anymore, SP has been proposed, and used in several African countries, as first-line treatment for malaria attacks. Although SP appears to be effective in treating falciparum malaria attacks in children from Gabon, the high prevalence among the parasite populations of in vitro resistance to both pyrimethamine and cycloguanil, and of DHFR- and DHPS-encoding gene mutations is alarming. Changes in anti-malarial policies in favour of the use of SP in this area of Gabon, are likely to increase SP drug pressure, and the clinical efficacy of SP may rapidly wane. New antimalarial combinations should be tested in order to have other effective treatments available.
| Acknowledgements |
|---|
We are grateful to the children who participated in the study, as well as to their mothers and guardians. We thank J. Bourgeais, SODEPAL, for logistical support in Bakoumba, Zorica Jesic for help in molecular genotyping, as well as Bernard Mbomat and Jean Ruffin Makita for technical help. This work was supported by the French Ministry of Research (VIHPAL grant) and by the Fondation pour la Recherche Médicale. A. Aubouy was the recipient of a fellowship from the French Ministry of Research. S. Jafari was the recipient of a fellowship grant from WHO.
| Footnotes |
|---|
* Corresponding author. Tel: +33-1-53-73-96-21; Fax: +33-1-42-16-26-54; E-mail: Philippe.Deloron{at}ird.fr
| References |
|---|
|
|
|---|
1 . Bouchaud, O., Monlun, E., Muanza, K. et al. (2000). Atovaquone plus proguanil versus halofantrine for the treatment of imported acute uncomplicated Plasmodium falciparum malaria in non-immune adults: a randomized comparative trial. American Journal of Tropical Medicine and Hygiene 63, 2749.[Abstract]
2 . Llanos-Cuentas, A., Campos, P., Clendenes, M. et al. (2001). Atovaquone and proguani hydrochloride compared with chloroquine or pyrimethamine/sulfodaxine for treatment of acute Plasmodium falciparum malaria in Peru. Brazilian Journal of Infectious Disease 5, 6772.[Medline]
3 . Mutabingwa, T., Nzila, A., Mberu, E. et al. (2001). Chlorproguanil-dapsone for treatment of drug-resistant falciparum malaria in Tanzania. Lancet 358, 121823.[CrossRef][Web of Science][Medline]
4 . Wongsrichanalai, C., Pickard, A. L., Wernsdorfer, W. H. et al. (2002). Epidemiology of drug-resistant malaria. Lancet Infectious Diseases 2, 20918.[CrossRef][Web of Science][Medline]
5 . Hyde, J. E. (1990). The dihydrofolate reductase-thymidylate synthetase gene in the drug resistance of malaria parasites. Pharmacology and Therapeutics 48, 4559.
6
.
Peterson, D. S., Di Santi, S. M., Povoa, M. et al. (1991). Prevalence of the dihydrofolate reductase Asn-108 mutation as the basis for pyrimethamine-resistant falciparum malaria in the Brazilian Amazon. American Journal of Tropical Medicine and Hygiene 45, 4927.
7 . Basco, L. K., Eldin de Pecoulas, P., Wilson, C. M. et al. (1995). Point mutations in the dihydrofolate reductase-thymidylate synthase gene and pyrimethamine and cycloguanil resistance in Plasmodium falciparum. Molecular and Biochemical Parasitology 69, 1358.[CrossRef][Web of Science][Medline]
8
.
Reeder, J. C., Rieckmann, K. H., Genton, B. et al. (1996). Point mutations in the dihydrofolate reductase and dihydropteroate synthetase genes and in vitro susceptibility to pyrimethamine and cycloguanil of Plasmodium falciparum isolates from Papua New Guinea. American Journal of Tropical Medicine and Hygiene 55, 20913.
9 . Durand, R., Ramiliarisoa, O., Secardin, Y. et al. (1997). DHFR gene point mutation as a predictor of Plasmodium falciparum resistance to cycloguanil in malaria cases from Africa imported to France. Transactions of the Royal Society of Tropical Medicine and Hygiene 91, 4601.[CrossRef][Web of Science][Medline]
10 . Wang, P., Read, M., Sims, P. F. et al. (1997). Sulfadoxine resistance in the human malaria parasite Plasmodium falciparum is determined by mutations in dihydropteroate synthetase and an additional factor associated with folate utilization. Molecular Microbiology 23, 97986.[CrossRef][Web of Science][Medline]
11 . Plowe, C. V., Cortese, J. F., Djimde, A. et al. (1997). Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase and epidemiologic patterns of pyrimethamine-sulfadoxine use and resistance. Journal of Infectious Diseases 176, 15906.[Web of Science][Medline]
12 . Wang, P., Lee, C. S., Bayoumi, R. et al. (1997). Resistance to antifolates in Plasmodium falciparum monitored by sequence analysis of dihydropteroate synthetase and dihydrofolate reductase alleles in a large number of field samples of diverse origins. Molecular and Biochemical Parasitology 89, 16177.[CrossRef][Web of Science][Medline]
13
.
Basco, L. K., Tahar, R. & Ringwald, P. (1998). Molecular basis of in vivo resistance to sulfadoxine-pyrimethamine in African adult patients infected with Plasmodium falciparum malaria parasites. Antimicrobial Agents and Chemotherapy 42, 18114.
14
.
Aubouy, A., Bakary, M., Keundjian, A. et al. (2003). Combination of drug level measurement and parasite genotyping data for improved assessment of amodiaquine and sulfadoxine-pyrimethamine efficacies in treating Plasmodium falciparum malaria in Gabonese children. Antimicrobial Agents and Chemotherapy 47, 2317.
15 . Elissa, N., Karch, S., Bureau, P. et al. (1999). Malaria transmission in a region of savanna-forest mosaic, Haut-Ogooue, Gabon. Journal of the American Mosquito Control Association 15, 1523.[Medline]
16 . World Health Organization. (2002). Monitoring Antimalarial Drug Resistance, WHO/CDS/CSR/EPH/2002.17. WHO, Geneva.
17 . Le Bras, J. & Deloron, P. (1983). In vitro study of drug sensitivity of Plasmodium falciparum: evaluation of a new semi-micro test. American Journal of Tropical Medicine and Hygiene 32, 44751.[Web of Science][Medline]
18
.
Plowe, C. V., Djimde, A., Bouare, M. et al. (1995). Pyrimethamine and proguanil resistance-conferring mutations in Plasmodium falciparum dihydrofolate reductase: polymerase chain reaction methods for surveillance in Africa. American Journal of Tropical Medicine and Hygiene 52, 5658.
19
.
Durand, R., Eslahpazire, J., Jafari, S. et al. (2000). Use of molecular beacons to detect an antifolate resistance-associated mutation in Plasmodium falciparum. Antimicrobial Agents and Chemotherapy 44, 34614.
20 . Mawili-Mboumba, D., Ekala, M., Lekoulou, F. et al. (2001). Molecular analysis of DHFR and DHPS genes in P. falciparum clinical isolates from the Haut-Ogooue region in Gabon. Acta Tropica 78, 23140.[CrossRef][Web of Science][Medline]
21 . Ringwald, P., Keundjian, A., Same Ekobo, A. et al. (2000). Chemoresistance of Plasmodium falciparum in the urban region of Yaounde, Cameroon. Part 2: Evaluation of the efficacy of amodiaquine and sulfadoxine-pyrimethamine combination in the treatment of uncomplicated Plasmodium falciparum malaria in Yaounde, Cameroon. Tropical Medicine and International Health 5, 6207.
22
.
Bickii, J., Basco, L. K. & Ringwald, P. (1998). Assessment of three in vitro tests and an in vivo test for chloroquine resistance in Plasmodium falciparum clinical isolates. Journal of Clinical Microbiology 36, 2437.
23 . Cox-Singh, J., Zakaria, R., Abdullah, M. S. et al. (2001). Short report: differences in dihydrofolate reductase but not dihydropteroate synthase alleles in Plasmodium falciparum isolates from geographically distinct areas in Malaysia. American Journal of Tropical Medicine and Hygiene 64, 2831.[Abstract]
24 . Vasconcelos, K. F., Plowe, C. V., Fontes, C. J. et al. (2000). Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase of isolates from the Amazon region of Brazil. Memorias do Instituto Oswaldo Cruz 95, 7218.[Web of Science][Medline]
25
.
Nzila, A. M., Mberu, E. K., Sulo, J. et al. (2000). Towards an understanding of the mechanism of pyrimethamine-sulfadoxine resistance in Plasmodium falciparum: genotyping of dihydrofolate reductase and dihydropteroate synthase of Kenyan parasites. Antimicrobial Agents and Chemotherapy 44, 9916.
26 . Basco, L. K. & Ringwald, P. (2000). Molecular epidemiology of malaria in Yaounde, Cameroon. VI. Sequence variations in the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene and in vitro resistance to pyrimethamine and cycloguanil. American Journal of Tropical Medicine and Hygiene 62, 2716.[Abstract]
27
.
Foote, S. J., Galatis, D. & Cowman, A. F. (1990). Amino acids in the dihydrofolate reductase-thymidylate synthase gene of Plasmodium falciparum involved in cycloguanil resistance differ from those involved in pyrimethamine resistance. Proceedings of the National Academy of Sciences, USA 87, 30147.
28
.
Peterson, D. S., Milhous, W. K. & Wellems, T. E. (1990). Molecular basis of differential resistance to cycloguanil and pyrimethamine in Plasmodium falciparum malaria. Proceedings of the National Academy of Sciences, USA 87, 301822.
29 . Hankins, E. G., Warhurst, D. C. & Sibley, C. H. (2001). Novel alleles of the Plasmodium falciparum dhfr highly resistant to pyrimethamine and chlorcycloguanil, but not WR99210. Molecular and Biochemical Parasitology 117, 91102.[CrossRef][Web of Science][Medline]
30 . Cortese, J. F. & Plowe, C. V. (1998). Antifolate resistance due to new and known Plasmodium falciparum dihydrofolate reductase mutations expressed in yeast. Molecular and Biochemical Parasitology 94, 20514.[CrossRef][Web of Science][Medline]
31 . Kublin, J. G., Dzinjalamala, F. K., Kamwendo, D. D. et al. (2002). Molecular markers for failure of sulfadoxine-pyrimethamine and chlorproguanil-dapsone treatment of Plasmodium falciparum malaria. Journal of Infectious Diseases 185, 3808.[CrossRef][Web of Science][Medline]
32 . Triglia, T. & Cowman, A. F. (1999). The mechanism of resistance to sulfa drugs in Plasmodium falciparum. Drug Resistance Update 2, 159.[CrossRef][Web of Science][Medline]
33 . Watkins, W. M., Mberu, E. K., Winstanley, P. A. et al. (1999). More on the efficacy of antifolate antimalarial combinations in Africa. Parasitology Today 15, 1312.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
L. Mobula, B. Lilley, A. K. Tshefu, and P. J. Rosenthal Resistance-mediating Polymorphisms in Plasmodium falciparum Infections in Kinshasa, Democratic Republic of the Congo Am J Trop Med Hyg, April 1, 2009; 80(4): 555 - 558. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. TINTO, J. B. OUEDRAOGO, I. ZONGO, C. VAN OVERMEIR, E. VAN MARCK, T. R. GUIGUEMDE, and U. D'ALESSANDRO SULFADOXINE-PYRIMETHAMINE EFFICACY AND SELECTION OF PLASMODIUM FALCIPARUM DHFR MUTATIONS IN BURKINA FASO BEFORE ITS INTRODUCTION AS INTERMITTENT PREVENTIVE TREATMENT FOR PREGNANT WOMEN Am J Trop Med Hyg, April 1, 2007; 76(4): 608 - 613. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. MENARD, D. DJALLE, F. YAPOU, A. MANIRAKIZA, and A. TALARMIN FREQUENCY DISTRIBUTION OF ANTIMALARIAL DRUG-RESISTANT ALLELES AMONG ISOLATES OF PLASMODIUM FALCIPARUM IN BANGUI, CENTRAL AFRICAN REPUBLIC Am J Trop Med Hyg, February 1, 2006; 74(2): 205 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. DORSEY, C. DOKOMAJILAR, M. KIGGUNDU, S. G. STAEDKE, M. R. KAMYA, and P. J. ROSENTHAL PRINCIPAL ROLE OF DIHYDROPTEROATE SYNTHASE MUTATIONS IN MEDIATING RESISTANCE TO SULFADOXINE-PYRIMETHAMINE IN SINGLE-DRUG AND COMBINATION THERAPY OF UNCOMPLICATED MALARIA IN UGANDA Am J Trop Med Hyg, December 1, 2004; 71(6): 758 - 763. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Gatton, L. B Martin, and Q. Cheng Evolution of Resistance to Sulfadoxine-Pyrimethamine in Plasmodium falciparum Antimicrob. Agents Chemother., June 1, 2004; 48(6): 2116 - 2123. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



