Skip Navigation


JAC Advance Access originally published online on June 12, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
52/1/116    most recent
dkg299v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Walsh, T. R.
Right arrow Articles by Jones, R. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Walsh, T. R.
Right arrow Articles by Jones, R. N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


Journal of Antimicrobial Chemotherapy (2003) 52, 116-119
© 2003 The British Society for Antimicrobial Chemotherapy

Evolution of an integron carrying blaVIM-2 in Eastern Europe: report from the SENTRY Antimicrobial Surveillance Program

Timothy R. Walsh1,*, Mark A. Toleman1, Waleria Hryniewicz2, Peter M. Bennett1 and Ronald N. Jones3,4

1 Department of Pathology and Microbiology, University of Bristol, Bristol BS8 1TD, UK; 2 Central Research Laboratory, Warsaw, Poland; 3 The JONES Group/JMI Laboratories, North Liberty, IA; 4 Tufts University School of Medicine, Boston, MA, USA

Received 22 November 2002; returned 18 December 2002; revised 14 April 2003; accepted 16 April 2003


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
As part of the SENTRY Antimicrobial Surveillance Program, an imipenem-resistant Pseudomonas aeruginosa strain (81-11963A) was isolated from the blood culture of a female neonate institutionalized at the local children’s hospital in Warsaw, Poland. Cloning of an imipenem resistance determinant revealed it to be a VIM-2 metallo-ß-lactamase, but sequence analysis of DNA adjacent to blaVIM-2 revealed it to have a unique gene context. Downstream of the blaVIM-2 gene resides an aacA4 gene encoding the AAC(6')-Ib aminoglycoside acetyltransferase. The integron containing blaVIM-2 shows high similarity to that reported from In58 in France but was novel in that it possessed a gene cassette with a 59 truncated base element only 19 base pairs (bp) long, consisting of a conserved core site and an inverse core site separated by only 5 bp. This appears to be the first report of a metallo-ß-lactamase gene arising from a pathogenic strain in Eastern Europe.

Keywords: metallo-ß-lactamases, Poland, Pseudomonas aeruginosa


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In recent years reports of clinical isolates of Pseudomonas aeruginosa that are resistant to virtually all ß-lactams have become more common. These isolates have been shown to produce metallo-ß-lactamases, enzymes that are usually zinc dependent. These metal ions co-ordinate water molecules that serve as nucleophiles, which attack and break the cyclic amide bond of the ß-lactam ring, rendering the antibiotic biologically inactive. The enzyme types are IMP, VIM and the recently described SPM ß-lactamase.1 VIM-type enzymes have been found in P. aeruginosa isolated in Europe and Southeast Asia, and VIM-1 in Italy,2,3 VIM-2 in France,4,5 Greece,6 Italy,7 Korea8 and Spain.9 VIM-2 and VIM-3 have been found in isolates from Taiwan and VIM-4 in isolates from Greece.10 Most genes encoding IMP- and VIM-type metallo-ß-lactamases are found on gene cassettes of class 1 integrons. Integrons are genetic elements that possess a specific recombination site, attI1, into which resistance genes, in the form of gene cassettes, can be inserted by site-specific recombination.

As part of the SENTRY Antimicrobial Surveillance Program, an imipenem-resistant isolate of P. aeruginosa (strain 81-11963A) was recovered from a blood culture of a female neonate from the local children’s hospital in Warsaw, Poland. Here we report the genetic characterization of the carbapenem resistance determinant from P. aeruginosa 81-11963A. We also offer an explanation as to how this new integron may have arisen from In58. The isolation of P. aeruginosa 81-11963A represents the first reported appearance of the metallo-ß-lactamase VIM-2 in Eastern Europe.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bacterial strains and plasmids

P. aeruginosa 81-11963A was a clinical isolate from Warsaw, Poland. Escherichia coli strain DH5{alpha} [supE44 {Delta}lacU169 ({phi}80lacZ{Delta}M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1] was used as the host strain to express the cloned ß-lactamase gene. Positive controls for the IMP- and VIM-type metallo-ß-lactamases were P. aeruginosa strains carrying the respective genes. The genomic library was generated in the cloning vector pK18 as previously described.1

Materials

Antimicrobial agents used were ceftazidime (GlaxoSmithKline, Worthing, UK) and kanamycin (Sigma Chemical Co., St Louis, MO, USA). PCR primers were purchased from Sigma-Genosys Ltd (Pampisford, UK). General reagents for DNA manipulation were obtained from Invitrogen (Groningen, The Netherlands). All other reagents were obtained from Sigma Chemicals Co. or BDH (both of Poole, UK).

Determination of MICs

Mid-log phase grown cultures (optical density of 0.6 at 600 nm) were diluted to 1/10–4 in water. Ten microlitres from each dilution was spotted onto Mueller–Hinton agar (BBL; Becton Dickinson, Oxford, UK), containing serial dilutions of the appropriate agent, using a multipoint inoculator. After 24 h incubation at 37°C, the MIC was noted as the lowest concentration of antimicrobial that inhibited the growth in those dilutions which, when inoculated onto nutrient agar containing no drug, gave rise to single colonies.

PCR screening for blaVIM and blaIMP metallo-ß-lactamase genes

For amplification using primers based on the conserved regions of the imp and vim genes, PCR was performed using AB-gene Expand Hi-Fidelity master mix containing a mix of Pfu non-proof reading Taq polymerases and dNTPs. Primers used to detect vim/imp genes were: VIM forward, TTATGGAGCAGCAAGCAGTG; VIM reverse, CGAATGCGCAGCACCAGG; IMP forward, ATGAGCAAGTTATCCTTATTC; and IMP reverse, GCTGCAACGACTTGTTAG. Primers were used at 10 pM concentrations and 1 µl of bacterial culture at density OD 1 at 600 nm was used as template. Cycling parameters were: 95°C for 5 min followed by 30 cycles of 95°C for 1 min, annealing at 45°C for 1 min and extension 68°C for 1 min, and ending with a 5 min incubation at 68°C.

Recombinant DNA methodology and DNA sequencing analysis

Genomic DNA was isolated from P. aeruginosa strain 81-11963A by the cetyl-trimethyl-ammonium bromide method and gene libraries were created using size fractionated DNA as described previously.1 The ligation mixture was subsequently dialysed and used to transform E. coli DH5{alpha} to ceftazidime resistance by electroporation. The clone containing the metallo-ß-lactamase gene was recovered by plating the gene library on to plates containing kanamycin (25 mg/L) and ceftazidime (6 mg/L). Sequencing was carried out on both strands by the dideoxy-chain termination method with a Perkin Elmer Biosystems 377 DNA sequencer. Sequence analysis was performed using the Lasergene DNASTAR software package. Sequence alignments were performed using Clustal_W with a PAM 250 matrix.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
P. aeruginosa 81-11963A produces a VIM-type ß-lactamase

By NCCLS criteria, P. aeruginosa 81-11963A was susceptible only to polymyxin (MIC 2 mg/L). The isolate was intermediately susceptible to aztreonam (MIC 16 mg/L), amikacin (MIC, 32 mg/L) and ciprofloxacin (MIC 2 mg/L) and highly resistant (MIC > 256 mg/L) to all other common antimicrobial agents tested, including penicillins, cephalosporins and carbapenems. When the isolate was screened with the imipenem-EDTA Etest strip (AB Biodisk, Solna, Sweden), the MIC of imipenem decreased from >256 to 4 mg/L in the presence of the metal chelator, EDTA, indicating production of a zinc-dependent ß-lactamase. To determine which type of enzyme was produced, the strain was investigated for carriage of blaIMP- or blaVIM-type genes. Two PCR primer pairs, one targeted to conserved regions of blaIMP-type genes and the other to blaVIM-type genes, were used in low stringency PCRs (annealing temperature 45°C). Metallo-ß-lactamase ‘positive controls’ were strains of P. aeruginosa carrying blaIMP-1 or blaVIM-1. Using genomic DNA from P. aeruginosa 81-11963A, a PCR amplicon of the expected size was obtained using the primer pair to detect blaVIM-type genes, but not with the blaIMP-type primers (data not shown).

Cloning of blaVIM-2 and adjacent DNA from P. aeruginosa 81-11963A

The gene encoding the metallo-ß-lactamase was isolated from a size-fractionated genomic library, as described previously.1 Approximately 20 colonies were isolated and subsequent analysis determined ceftazidime MICs were >128 mg/L. In the presence of EDTA (10 mM) the ceftazidime MICs decreased from 256 to <4 mg/L, confirming that the recombinant plasmids carried a metallo-ß-lactamase gene. E. coli carrying the recombinant plasmid gave imipenem and meropenem MICs of 1 and 0.125 mg/L, respectively. One clone, pMATWS1, containing an insert of ~5 kb was further analysed by sequencing to assess the genetic context of the blaVIM-2 derivative. The insert of P. aeruginosa DNA in this plasmid was sequenced. The sequence has been deposited in the EMBL database under accession number AJ515707.

Sequence analysis of the P. aeruginosa 81-11963A DNA insert in pMATWS1

Analysis of the nucleotide sequence of the DNA from P. aeruginosa 81-11963A carried on recombinant plasmid pMATWS1 revealed the presence of blaVIM-2 (Figure 1). Adjacent to and downstream from blaVIM-2 was aacA4, a gene that encodes AAC(6')-Ib, which confers resistance to the aminoglycosides, kanamycin and netilmicin. Beyond aacA4 was the 3'-CS region typical of class 1 integrons. On the other side of the blaVIM-2 gene was int1, encoding the integrase of a class 1 integron. Between int1 and blaVIM-2 was an attI1 site. Thus, blaVIM-2 from P. aeruginosa 81-11963A was a component of a previously undescribed class 1 integron. While the aacA4 gene on the integron was followed by a typical 59 base element (be), as previously reported,4 the blaVIM-2 gene was not. Instead, there was a truncated version of only 19 base pairs (bp) (Figure 2), comprising an inverse core site and a core site separated by only 5 bp.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Genetic context of pMATSW1 compared with characterized inserts containing blaVIM-2 genes. (a) Schematic map of the recombinant plasmid PMATSW1 carrying blaVIM-2 compared with examples of other cloned inserts carrying vim-2. These constructs are blaVIM-2 within class 1 integrons isolated in (b) France, EMBL accession no. AF191564; (c) Korea, accession no. AF369871; (d) accession no. AY030343; (e) Poirel et al.5 Hatched rectangles indicates 5'–3' conserved sequences (5'-CS, 3'-CS); black circles, 59 be; open ellipses, attI1 sites. Open reading frames of the various resistance genes are boxed with an arrow indicating the direction of transcription.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Comparison of blaVIM-2 integrons isolated in Paris and Warsaw. (a) Diagram of organization of the blaVIM-2 containing integron In58 (nucleotide EMBL accession number AF263519) compared with the integron containing blaVIM-2 harboured by P. aeruginosa isolate 81-11963 found in Poland. Oblong boxes represent the positions of the various genes and the arrows indicate their direction of translation. The different 59 be are represented by open and shaded circles, and attI1 sites by open ellipses. The 59 be of blaVIM-2 found in Poland is a chimera of the blaVIM-2 and aacC1 59 be. The shortened 59 be of the blaVIM-2 gene cassette found in Poland can be explained by a recombinational crossover event between the L1 sequence (GTTGCAG) of the blaVIM-2 59 be and the core sequence of the aacC1 59 be as depicted in (b) and (c).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
This is the first report of a P. aeruginosa strain possessing a metallo-ß-lactamase gene in Central Europe and illustrates the continuing dissemination of these genes throughout the continent. While strain 81-11963A was resistant to virtually all antimicrobials, the cloned gene, pMATWS1, when expressed in E. coli conferred resistance to all ß-lactams except the carbapenems and aztreonam (data not shown). Despite this, crude cell extracts from both strain 81-11963A and E. coli (pMATWS1) demonstrated hydrolytic activity against imipenem that was fully inhibited by the presence of EDTA (20 mM) (results not shown).

The blaVIM-2 gene from strain 81-11963A could not be transferred to a susceptible P. aeruginosa recipient, and was shown by PCR to be chromosomally encoded as judged by blaVIM amplicons obtained from genomic DNA preparations but not plasmid DNA preparations. The blaVIM-2-containing integron from P. aeruginosa 81-11963A was very similar to the blaVIM-2-containing integron, In58, found in France.4 In58 also carries the aacA4 gene cassette, but is separated from the blaVIM-2 gene cassette by an aacC1 gene cassette. These gene cassette assortments are somewhat different from other blaVIM-2-containing integrons (Figure 1). The blaVIM-2 gene recovered from P. aeruginosa 81-11963A was unusual in that it is not accompanied by a full-size 59 be. Instead, it was followed by what appears to be a deleted 59 be of 19 bp. The deletion appears to have removed all but 5 bp of the sequence between the inverse core site and the core site of the 59 be (Figure 2). When the sequences were analysed further, it seems likely that the deleted element was the result of integrase-mediated excision. Indeed, the integron found in P. aeruginosa 81-11963A can be derived readily from In58 by two integrase-mediated gene cassette excisions. The first would remove the aacA7 gene cassette to leave the blaVIM-2 gene cassette at the attI1 site. The second excision would remove the aacC1 gene cassette and part of the blaVIM-2 gene cassette 59 be as the result of integrase mistaking the 2L sequence (GTTGCAG) of the blaVIM-2 gene cassette 59 be for the core sequence (GTTAGAT) of the 59 be, separating the blaVIM-2 and aacC1 genes (Figure 2), where recombination would normally occur. Such an event would fuse the first 13 bp of the blaVIM-2 gene cassette 59 be, GCATAACATGAAG, to the terminal 6 bp, TTAGGC, of the core site of the 59 be separating the aacC1 and aacA4 genes, in the process creating the 19 bp hybrid element found (Figure 2). Database searches for other examples of shortened 59 be revealed two blaVIM-2 genes in Italy7 and Korea.8 The 59 be of the blaVIM-2 gene cassette may be prone to a particular aberrant integrase-mediated recombination. An alternative, but perhaps less likely, explanation is that integrase mediates recombination between the 2L site and the core site of the hybrid 59 be that follow the blaVIM-2 gene in different integrons, as suggested by Pallecchi et al.7 One consequence of the misdirected integrase-mediated recombination is the possibility that the blaVIM-2 gene cassettes might become fused to other gene cassettes, in the case of the integron from P. aeruginosa 81-11963A encoding resistance to ß-lactams and aminoglycosides, and become permanently linked and to move genetically as a pair. Consequently, if one was selected by use of one agent so will be the other.

The enzymes encoded by these mobile cassettes can hydrolyse almost all clinically useful ß-lactams, irrespective of class, and that they are resistant to the effects of serine ß-lactamase inhibitors makes such reports particularly alarming. We suggest that monitoring of multidrug-resistant, non-fermenting Gram-negative bacilli for production of metallo-ß-lactamases should become a standard aspect of any local or global surveillance systems.


    Acknowledgements
 
The SENTRY Antimicrobial Surveillance Program was funded by an educational/research grant from Bristol-Myers Squibb.


    Footnotes
 
* Correspondence address. Bristol Centre for Antibiotic Research and Evaluation, University of Bristol, Bristol BS8 1TD, UK. Tel: +44-117-928-7897; Fax: +44-117-928-7896; E-mail: t.r.walsh{at}bristol.ac.uk Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1 . Toleman, M. A., Simm, A. M., Murphy, T. A. et al. (2002). Molecular characterization of SPM-1, a novel metallo-ß-lactamase isolated in Latin America: report from the SENTRY antimicrobial surveillance programme. Journal of Antimicrobial Chemotherapy 50, 673–9.[Abstract/Free Full Text]

2 . Cornaglia, G., Mazzariol, A., Lauretti, L. et al. (2000). Hospital outbreak of carbapenem-resistant Pseudomonas aeruginosa producing VIM-1, a novel transferable metallo-ß-lactamase. Clinical Infectious Diseases 31, 1119–25.[CrossRef][Web of Science][Medline]

3 . Lauretti, L., Riccio, M. L., Mazzariol, A. et al. (1999). Cloning and characterization of blaVIM, a new integron-borne metallo-ß-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrobial Agents and Chemotherapy 43, 1584–90.[Abstract/Free Full Text]

4 . Poirel, L., Lambert, T., Turkoglu, S. et al. (2001). Characterization of Class 1 integrons from Pseudomonas aeruginosa that contain the blaVIM-2 carbapenem-hydrolyzing ß-lactamase gene and of two novel aminoglycoside resistance gene cassettes. Antimicrobial Agents and Chemotherapy 45, 546–52.[Abstract/Free Full Text]

5 . Poirel, L., Naas, T., Nicolas, D. et al. (2000). Characterization of VIM-2, a carbapenem-hydrolyzing metallo-ß-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrobial Agents and Chemotherapy 44, 891–7.[Abstract/Free Full Text]

6 . Mavroidi, A., Tsakris, A., Tzelepi, E. et al. (2000). Carbapenem-hydrolysing VIM-2 metallo-ß-lactamase in Pseudomonas aeruginosa from Greece. Journal of Antimicrobial Chemotherapy 46, 1041–2.[Free Full Text]

7 . Pallecchi, L., Riccio, M. L., Docquier, J. D. et al. (2001). Molecular heterogeneity of blaVIM-2-containing integrons from Pseudomonas aeruginosa plasmids encoding the VIM-2 metallo-ß-lactamase. FEMS Microbiology Letters 195, 45–50.

8 . Lee, K., Lim, J. B., Yum, J. H. et al. (2002). blaVIM-2 cassette-containing novel integrons in metallo-ß-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrobial Agents and Chemotherapy 46, 1053–8.[Abstract/Free Full Text]

9 . Pratts, G., Miro, E., Mirelis, B. et al. (2002). First isolation of a carbapenem-hydrolyzing ß-lactamase in Pseudomonas aeruginosa in Spain. Antimicrobial Agents and Chemotherapy 46, 932–3.[Free Full Text]

10 . Pournaras, S., Tsakris, A., Maniati, M. et al. (2002). Novel variant (blaVIM-4) of the metallo-ß-lactamase gene blaVIM-1 in a clinical strain of Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 46, 4026–8.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Antimicrob ChemotherHome page
J. A. Patzer, T. R. Walsh, J. Weeks, D. Dzierzanowska, and M. A. Toleman
Emergence and persistence of integron structures harbouring VIM genes in the Children's Memorial Health Institute, Warsaw, Poland, 1998-2006
J. Antimicrob. Chemother., February 1, 2009; 63(2): 269 - 273.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
H. Li, M. A. Toleman, P. M. Bennett, R. N. Jones, and T. R. Walsh
Complete Sequence of p07-406, a 24,179-Base-Pair Plasmid Harboring the blaVIM-7 Metallo-{beta}-Lactamase Gene in a Pseudomonas aeruginosa Isolate from the United States
Antimicrob. Agents Chemother., September 1, 2008; 52(9): 3099 - 3105.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
O. Samuelsen, M. Castanheira, T. R. Walsh, and J. Spencer
Kinetic Characterization of VIM-7, a Divergent Member of the VIM Metallo-{beta}-Lactamase Family
Antimicrob. Agents Chemother., August 1, 2008; 52(8): 2905 - 2908.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
R. S. Levings, S. R. Partridge, S. P. Djordjevic, and R. M. Hall
SGI1-K, a Variant of the SGI1 Genomic Island Carrying a Mercury Resistance Region, in Salmonella enterica Serovar Kentucky
Antimicrob. Agents Chemother., January 1, 2007; 51(1): 317 - 323.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
C. G. Giske, B. Libisch, C. Colinon, E. Scoulica, L. Pagani, M. Fuzi, G. Kronvall, and G. M. Rossolini
Establishing Clonal Relationships between VIM-1-Like Metallo-{beta}-Lactamase-Producing Pseudomonas aeruginosa Strains from Four European Countries by Multilocus Sequence Typing
J. Clin. Microbiol., December 1, 2006; 44(12): 4309 - 4315.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
Y.-S. Yu, T.-T. Qu, J.-Y. Zhou, J. Wang, H.-Y. Li, and T. R. Walsh
Integrons Containing the VIM-2 Metallo-{beta}-Lactamase Gene among Imipenem-Resistant Pseudomonas aeruginosa Strains from Different Chinese Hospitals
J. Clin. Microbiol., November 1, 2006; 44(11): 4242 - 4245.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
J. Fiett, A. Baraniak, A. Mrowka, M. Fleischer, Z. Drulis-Kawa, L. Naumiuk, A. Samet, W. Hryniewicz, and M. Gniadkowski
Molecular Epidemiology of Acquired-Metallo-{beta}-Lactamase-Producing Bacteria in Poland
Antimicrob. Agents Chemother., March 1, 2006; 50(3): 880 - 886.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
T. R. Walsh, M. A. Toleman, L. Poirel, and P. Nordmann
Metallo-{beta}-Lactamases: the Quiet before the Storm?
Clin. Microbiol. Rev., April 1, 2005; 18(2): 306 - 325.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
K. Poole
Aminoglycoside Resistance in Pseudomonas aeruginosa
Antimicrob. Agents Chemother., February 1, 2005; 49(2): 479 - 487.
[Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
M. L. Riccio, L. Pallecchi, J.-D. Docquier, S. Cresti, M. R. Catania, L. Pagani, C. Lagatolla, G. Cornaglia, R. Fontana, and G. M. Rossolini
Clonal Relatedness and Conserved Integron Structures in Epidemiologically Unrelated Pseudomonas aeruginosa Strains Producing the VIM-1 Metallo-{beta}-Lactamase from Different Italian Hospitals
Antimicrob. Agents Chemother., January 1, 2005; 49(1): 104 - 110.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
M. A. Toleman, D. Biedenbach, D. M. C. Bennett, R. N. Jones, and T. R. Walsh
Italian metallo-{beta}-lactamases: a national problem? Report from the SENTRY Antimicrobial Surveillance Programme
J. Antimicrob. Chemother., January 1, 2005; 55(1): 61 - 70.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
M. Castanheira, M. A. Toleman, R. N. Jones, F. J. Schmidt, and T. R. Walsh
Molecular Characterization of a {beta}-Lactamase Gene, blaGIM-1, Encoding a New Subclass of Metallo-{beta}-Lactamase
Antimicrob. Agents Chemother., December 1, 2004; 48(12): 4654 - 4661.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
R. E. Mendes, M. A. Toleman, J. Ribeiro, H. S. Sader, R. N. Jones, and T. R. Walsh
Integron Carrying a Novel Metallo-{beta}-Lactamase Gene, blaIMP-16, and a Fused Form of Aminoglycoside-Resistant Gene aac(6')-30/aac(6')-Ib': Report from the SENTRY Antimicrobial Surveillance Program
Antimicrob. Agents Chemother., December 1, 2004; 48(12): 4693 - 4702.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
J. Patzer, M. A. Toleman, L. M. Deshpande, W. Kaminska, D. Dzierzanowska, P. M. Bennett, R. N. Jones, and T. R. Walsh
Pseudomonas aeruginosa strains harbouring an unusual blaVIM-4 gene cassette isolated from hospitalized children in Poland (1998-2001)
J. Antimicrob. Chemother., March 1, 2004; 53(3): 451 - 456.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
52/1/116    most recent
dkg299v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Walsh, T. R.
Right arrow Articles by Jones, R. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Walsh, T. R.
Right arrow Articles by Jones, R. N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?