JAC Advance Access originally published online on June 12, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Antimicrobial Chemotherapy (2003) 52, 116-119
© 2003 The British Society for Antimicrobial Chemotherapy
Evolution of an integron carrying blaVIM-2 in Eastern Europe: report from the SENTRY Antimicrobial Surveillance Program
1 Department of Pathology and Microbiology, University of Bristol, Bristol BS8 1TD, UK; 2 Central Research Laboratory, Warsaw, Poland; 3 The JONES Group/JMI Laboratories, North Liberty, IA; 4 Tufts University School of Medicine, Boston, MA, USA
Received 22 November 2002; returned 18 December 2002; revised 14 April 2003; accepted 16 April 2003
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
As part of the SENTRY Antimicrobial Surveillance Program, an imipenem-resistant Pseudomonas aeruginosa strain (81-11963A) was isolated from the blood culture of a female neonate institutionalized at the local children’s hospital in Warsaw, Poland. Cloning of an imipenem resistance determinant revealed it to be a VIM-2 metallo-ß-lactamase, but sequence analysis of DNA adjacent to blaVIM-2 revealed it to have a unique gene context. Downstream of the blaVIM-2 gene resides an aacA4 gene encoding the AAC(6')-Ib aminoglycoside acetyltransferase. The integron containing blaVIM-2 shows high similarity to that reported from In58 in France but was novel in that it possessed a gene cassette with a 59 truncated base element only 19 base pairs (bp) long, consisting of a conserved core site and an inverse core site separated by only 5 bp. This appears to be the first report of a metallo-ß-lactamase gene arising from a pathogenic strain in Eastern Europe.
Keywords: metallo-ß-lactamases, Poland, Pseudomonas aeruginosa
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
In recent years reports of clinical isolates of Pseudomonas aeruginosa that are resistant to virtually all ß-lactams have become more common. These isolates have been shown to produce metallo-ß-lactamases, enzymes that are usually zinc dependent. These metal ions co-ordinate water molecules that serve as nucleophiles, which attack and break the cyclic amide bond of the ß-lactam ring, rendering the antibiotic biologically inactive. The enzyme types are IMP, VIM and the recently described SPM ß-lactamase.1 VIM-type enzymes have been found in P. aeruginosa isolated in Europe and Southeast Asia, and VIM-1 in Italy,2,3 VIM-2 in France,4,5 Greece,6 Italy,7 Korea8 and Spain.9 VIM-2 and VIM-3 have been found in isolates from Taiwan and VIM-4 in isolates from Greece.10 Most genes encoding IMP- and VIM-type metallo-ß-lactamases are found on gene cassettes of class 1 integrons. Integrons are genetic elements that possess a specific recombination site, attI1, into which resistance genes, in the form of gene cassettes, can be inserted by site-specific recombination.
As part of the SENTRY Antimicrobial Surveillance Program, an imipenem-resistant isolate of P. aeruginosa (strain 81-11963A) was recovered from a blood culture of a female neonate from the local children’s hospital in Warsaw, Poland. Here we report the genetic characterization of the carbapenem resistance determinant from P. aeruginosa 81-11963A. We also offer an explanation as to how this new integron may have arisen from In58. The isolation of P. aeruginosa 81-11963A represents the first reported appearance of the metallo-ß-lactamase VIM-2 in Eastern Europe.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Bacterial strains and plasmids
P. aeruginosa 81-11963A was a clinical isolate from Warsaw, Poland. Escherichia coli strain DH5
[supE44 
lacU169 (
80lacZM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1] was used as the host strain to express the cloned ß-lactamase gene. Positive controls for the IMP- and VIM-type metallo-ß-lactamases were P. aeruginosa strains carrying the respective genes. The genomic library was generated in the cloning vector pK18 as previously described.1
Materials
Antimicrobial agents used were ceftazidime (GlaxoSmithKline, Worthing, UK) and kanamycin (Sigma Chemical Co., St Louis, MO, USA). PCR primers were purchased from Sigma-Genosys Ltd (Pampisford, UK). General reagents for DNA manipulation were obtained from Invitrogen (Groningen, The Netherlands). All other reagents were obtained from Sigma Chemicals Co. or BDH (both of Poole, UK).
Determination of MICs
Mid-log phase grown cultures (optical density of 0.6 at 600 nm) were diluted to 1/10–4 in water. Ten microlitres from each dilution was spotted onto Mueller–Hinton agar (BBL; Becton Dickinson, Oxford, UK), containing serial dilutions of the appropriate agent, using a multipoint inoculator. After 24 h incubation at 37°C, the MIC was noted as the lowest concentration of antimicrobial that inhibited the growth in those dilutions which, when inoculated onto nutrient agar containing no drug, gave rise to single colonies.
PCR screening for blaVIM and blaIMP metallo-ß-lactamase genes
For amplification using primers based on the conserved regions of the imp and vim genes, PCR was performed using AB-gene Expand Hi-Fidelity master mix containing a mix of Pfu non-proof reading Taq polymerases and dNTPs. Primers used to detect vim/imp genes were: VIM forward, TTATGGAGCAGCAAGCAGTG; VIM reverse, CGAATGCGCAGCACCAGG; IMP forward, ATGAGCAAGTTATCCTTATTC; and IMP reverse, GCTGCAACGACTTGTTAG. Primers were used at 10 pM concentrations and 1 µl of bacterial culture at density OD 1 at 600 nm was used as template. Cycling parameters were: 95°C for 5 min followed by 30 cycles of 95°C for 1 min, annealing at 45°C for 1 min and extension 68°C for 1 min, and ending with a 5 min incubation at 68°C.
Recombinant DNA methodology and DNA sequencing analysis
Genomic DNA was isolated from P. aeruginosa strain 81-11963A by the cetyl-trimethyl-ammonium bromide method and gene libraries were created using size fractionated DNA as described previously.1 The ligation mixture was subsequently dialysed and used to transform E. coli DH5 to ceftazidime resistance by electroporation. The clone containing the metallo-ß-lactamase gene was recovered by plating the gene library on to plates containing kanamycin (25 mg/L) and ceftazidime (6 mg/L). Sequencing was carried out on both strands by the dideoxy-chain termination method with a Perkin Elmer Biosystems 377 DNA sequencer. Sequence analysis was performed using the Lasergene DNASTAR software package. Sequence alignments were performed using Clustal_W with a PAM 250 matrix.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
P. aeruginosa 81-11963A produces a VIM-type ß-lactamase
By NCCLS criteria, P. aeruginosa 81-11963A was susceptible only to polymyxin (MIC 2 mg/L). The isolate was intermediately susceptible to aztreonam (MIC 16 mg/L), amikacin (MIC, 32 mg/L) and ciprofloxacin (MIC 2 mg/L) and highly resistant (MIC > 256 mg/L) to all other common antimicrobial agents tested, including penicillins, cephalosporins and carbapenems. When the isolate was screened with the imipenem-EDTA Etest strip (AB Biodisk, Solna, Sweden), the MIC of imipenem decreased from >256 to 4 mg/L in the presence of the metal chelator, EDTA, indicating production of a zinc-dependent ß-lactamase. To determine which type of enzyme was produced, the strain was investigated for carriage of blaIMP- or blaVIM-type genes. Two PCR primer pairs, one targeted to conserved regions of blaIMP-type genes and the other to blaVIM-type genes, were used in low stringency PCRs (annealing temperature 45°C). Metallo-ß-lactamase ‘positive controls’ were strains of P. aeruginosa carrying blaIMP-1 or blaVIM-1. Using genomic DNA from P. aeruginosa 81-11963A, a PCR amplicon of the expected size was obtained using the primer pair to detect blaVIM-type genes, but not with the blaIMP-type primers (data not shown).
Cloning of blaVIM-2 and adjacent DNA from P. aeruginosa 81-11963A
The gene encoding the metallo-ß-lactamase was isolated from a size-fractionated genomic library, as described previously.1 Approximately 20 colonies were isolated and subsequent analysis determined ceftazidime MICs were >128 mg/L. In the presence of EDTA (10 mM) the ceftazidime MICs decreased from 256 to <4 mg/L, confirming that the recombinant plasmids carried a metallo-ß-lactamase gene. E. coli carrying the recombinant plasmid gave imipenem and meropenem MICs of 1 and 0.125 mg/L, respectively. One clone, pMATWS1, containing an insert of 
5 kb was further analysed by sequencing to assess the genetic context of the blaVIM-2 derivative. The insert of P. aeruginosa DNA in this plasmid was sequenced. The sequence has been deposited in the EMBL database under accession number AJ515707.
Sequence analysis of the P. aeruginosa 81-11963A DNA insert in pMATWS1
Analysis of the nucleotide sequence of the DNA from P. aeruginosa 81-11963A carried on recombinant plasmid pMATWS1 revealed the presence of blaVIM-2 (Figure 1). Adjacent to and downstream from blaVIM-2 was aacA4, a gene that encodes AAC(6')-Ib, which confers resistance to the aminoglycosides, kanamycin and netilmicin. Beyond aacA4 was the 3'-CS region typical of class 1 integrons. On the other side of the blaVIM-2 gene was int1, encoding the integrase of a class 1 integron. Between int1 and blaVIM-2 was an attI1 site. Thus, blaVIM-2 from P. aeruginosa 81-11963A was a component of a previously undescribed class 1 integron. While the aacA4 gene on the integron was followed by a typical 59 base element (be), as previously reported,4 the blaVIM-2 gene was not. Instead, there was a truncated version of only 19 base pairs (bp) (Figure 2), comprising an inverse core site and a core site separated by only 5 bp.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
This is the first report of a P. aeruginosa strain possessing a metallo-ß-lactamase gene in Central Europe and illustrates the continuing dissemination of these genes throughout the continent. While strain 81-11963A was resistant to virtually all antimicrobials, the cloned gene, pMATWS1, when expressed in E. coli conferred resistance to all ß-lactams except the carbapenems and aztreonam (data not shown). Despite this, crude cell extracts from both strain 81-11963A and E. coli (pMATWS1) demonstrated hydrolytic activity against imipenem that was fully inhibited by the presence of EDTA (20 mM) (results not shown).
The blaVIM-2 gene from strain 81-11963A could not be transferred to a susceptible P. aeruginosa recipient, and was shown by PCR to be chromosomally encoded as judged by blaVIM amplicons obtained from genomic DNA preparations but not plasmid DNA preparations. The blaVIM-2-containing integron from P. aeruginosa 81-11963A was very similar to the blaVIM-2-containing integron, In58, found in France.4 In58 also carries the aacA4 gene cassette, but is separated from the blaVIM-2 gene cassette by an aacC1 gene cassette. These gene cassette assortments are somewhat different from other blaVIM-2-containing integrons (Figure 1). The blaVIM-2 gene recovered from P. aeruginosa 81-11963A was unusual in that it is not accompanied by a full-size 59 be. Instead, it was followed by what appears to be a deleted 59 be of 19 bp. The deletion appears to have removed all but 5 bp of the sequence between the inverse core site and the core site of the 59 be (Figure 2). When the sequences were analysed further, it seems likely that the deleted element was the result of integrase-mediated excision. Indeed, the integron found in P. aeruginosa 81-11963A can be derived readily from In58 by two integrase-mediated gene cassette excisions. The first would remove the aacA7 gene cassette to leave the blaVIM-2 gene cassette at the attI1 site. The second excision would remove the aacC1 gene cassette and part of the blaVIM-2 gene cassette 59 be as the result of integrase mistaking the 2L sequence (GTTGCAG) of the blaVIM-2 gene cassette 59 be for the core sequence (GTTAGAT) of the 59 be, separating the blaVIM-2 and aacC1 genes (Figure 2), where recombination would normally occur. Such an event would fuse the first 13 bp of the blaVIM-2 gene cassette 59 be, GCATAACATGAAG, to the terminal 6 bp, TTAGGC, of the core site of the 59 be separating the aacC1 and aacA4 genes, in the process creating the 19 bp hybrid element found (Figure 2). Database searches for other examples of shortened 59 be revealed two blaVIM-2 genes in Italy7 and Korea.8 The 59 be of the blaVIM-2 gene cassette may be prone to a particular aberrant integrase-mediated recombination. An alternative, but perhaps less likely, explanation is that integrase mediates recombination between the 2L site and the core site of the hybrid 59 be that follow the blaVIM-2 gene in different integrons, as suggested by Pallecchi et al.7 One consequence of the misdirected integrase-mediated recombination is the possibility that the blaVIM-2 gene cassettes might become fused to other gene cassettes, in the case of the integron from P. aeruginosa 81-11963A encoding resistance to ß-lactams and aminoglycosides, and become permanently linked and to move genetically as a pair. Consequently, if one was selected by use of one agent so will be the other.
The enzymes encoded by these mobile cassettes can hydrolyse almost all clinically useful ß-lactams, irrespective of class, and that they are resistant to the effects of serine ß-lactamase inhibitors makes such reports particularly alarming. We suggest that monitoring of multidrug-resistant, non-fermenting Gram-negative bacilli for production of metallo-ß-lactamases should become a standard aspect of any local or global surveillance systems.
|
Acknowledgements |
|---|
The SENTRY Antimicrobial Surveillance Program was funded by an educational/research grant from Bristol-Myers Squibb.
|
Footnotes |
|---|
* Correspondence address. Bristol Centre for Antibiotic Research and Evaluation, University of Bristol, Bristol BS8 1TD, UK. Tel: +44-117-928-7897; Fax: +44-117-928-7896; E-mail: t.r.walsh{at}bristol.ac.uk
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
1 . Toleman, M. A., Simm, A. M., Murphy, T. A. et al. (2002). Molecular characterization of SPM-1, a novel metallo-ß-lactamase isolated in Latin America: report from the SENTRY antimicrobial surveillance programme. Journal of Antimicrobial Chemotherapy 50, 673–9.
2 . Cornaglia, G., Mazzariol, A., Lauretti, L. et al. (2000). Hospital outbreak of carbapenem-resistant Pseudomonas aeruginosa producing VIM-1, a novel transferable metallo-ß-lactamase. Clinical Infectious Diseases 31, 1119–25.[CrossRef][Web of Science][Medline]
3
.
Lauretti, L., Riccio, M. L., Mazzariol, A. et al. (1999). Cloning and characterization of blaVIM, a new integron-borne metallo-ß-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrobial Agents and Chemotherapy 43, 1584–90.
4
.
Poirel, L., Lambert, T., Turkoglu, S. et al. (2001). Characterization of Class 1 integrons from Pseudomonas aeruginosa that contain the blaVIM-2 carbapenem-hydrolyzing ß-lactamase gene and of two novel aminoglycoside resistance gene cassettes. Antimicrobial Agents and Chemotherapy 45, 546–52.
5
.
Poirel, L., Naas, T., Nicolas, D. et al. (2000). Characterization of VIM-2, a carbapenem-hydrolyzing metallo-ß-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrobial Agents and Chemotherapy 44, 891–7.
6
.
Mavroidi, A., Tsakris, A., Tzelepi, E. et al. (2000). Carbapenem-hydrolysing VIM-2 metallo-ß-lactamase in Pseudomonas aeruginosa from Greece. Journal of Antimicrobial Chemotherapy 46, 1041–2.
7 . Pallecchi, L., Riccio, M. L., Docquier, J. D. et al. (2001). Molecular heterogeneity of blaVIM-2-containing integrons from Pseudomonas aeruginosa plasmids encoding the VIM-2 metallo-ß-lactamase. FEMS Microbiology Letters 195, 45–50.
8
.
Lee, K., Lim, J. B., Yum, J. H. et al. (2002). blaVIM-2 cassette-containing novel integrons in metallo-ß-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrobial Agents and Chemotherapy 46, 1053–8.
9
.
Pratts, G., Miro, E., Mirelis, B. et al. (2002). First isolation of a carbapenem-hydrolyzing ß-lactamase in Pseudomonas aeruginosa in Spain. Antimicrobial Agents and Chemotherapy 46, 932–3.
10
.
Pournaras, S., Tsakris, A., Maniati, M. et al. (2002). Novel variant (blaVIM-4) of the metallo-ß-lactamase gene blaVIM-1 in a clinical strain of Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 46, 4026–8.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  J. A. Patzer, T. R. Walsh, J. Weeks, D. Dzierzanowska, and M. A. Toleman Emergence and persistence of integron structures harbouring VIM genes in the Children's Memorial Health Institute, Warsaw, Poland, 1998-2006 J. Antimicrob. Chemother., February 1, 2009; 63(2): 269 - 273. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Li, M. A. Toleman, P. M. Bennett, R. N. Jones, and T. R. Walsh Complete Sequence of p07-406, a 24,179-Base-Pair Plasmid Harboring the blaVIM-7 Metallo-{beta}-Lactamase Gene in a Pseudomonas aeruginosa Isolate from the United States Antimicrob. Agents Chemother., September 1, 2008; 52(9): 3099 - 3105. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Samuelsen, M. Castanheira, T. R. Walsh, and J. Spencer Kinetic Characterization of VIM-7, a Divergent Member of the VIM Metallo-{beta}-Lactamase Family Antimicrob. Agents Chemother., August 1, 2008; 52(8): 2905 - 2908. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Levings, S. R. Partridge, S. P. Djordjevic, and R. M. Hall SGI1-K, a Variant of the SGI1 Genomic Island Carrying a Mercury Resistance Region, in Salmonella enterica Serovar Kentucky Antimicrob. Agents Chemother., January 1, 2007; 51(1): 317 - 323. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. G. Giske, B. Libisch, C. Colinon, E. Scoulica, L. Pagani, M. Fuzi, G. Kronvall, and G. M. Rossolini Establishing Clonal Relationships between VIM-1-Like Metallo-{beta}-Lactamase-Producing Pseudomonas aeruginosa Strains from Four European Countries by Multilocus Sequence Typing J. Clin. Microbiol., December 1, 2006; 44(12): 4309 - 4315. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-S. Yu, T.-T. Qu, J.-Y. Zhou, J. Wang, H.-Y. Li, and T. R. Walsh Integrons Containing the VIM-2 Metallo-{beta}-Lactamase Gene among Imipenem-Resistant Pseudomonas aeruginosa Strains from Different Chinese Hospitals J. Clin. Microbiol., November 1, 2006; 44(11): 4242 - 4245. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Fiett, A. Baraniak, A. Mrowka, M. Fleischer, Z. Drulis-Kawa, L. Naumiuk, A. Samet, W. Hryniewicz, and M. Gniadkowski Molecular Epidemiology of Acquired-Metallo-{beta}-Lactamase-Producing Bacteria in Poland Antimicrob. Agents Chemother., March 1, 2006; 50(3): 880 - 886. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. R. Walsh, M. A. Toleman, L. Poirel, and P. Nordmann Metallo-{beta}-Lactamases: the Quiet before the Storm? Clin. Microbiol. Rev., April 1, 2005; 18(2): 306 - 325. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Poole Aminoglycoside Resistance in Pseudomonas aeruginosa Antimicrob. Agents Chemother., February 1, 2005; 49(2): 479 - 487. [Full Text] [PDF]
|
|
|
|
|
|
M. L. Riccio, L. Pallecchi, J.-D. Docquier, S. Cresti, M. R. Catania, L. Pagani, C. Lagatolla, G. Cornaglia, R. Fontana, and G. M. Rossolini Clonal Relatedness and Conserved Integron Structures in Epidemiologically Unrelated Pseudomonas aeruginosa Strains Producing the VIM-1 Metallo-{beta}-Lactamase from Different Italian Hospitals Antimicrob. Agents Chemother., January 1, 2005; 49(1): 104 - 110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Toleman, D. Biedenbach, D. M. C. Bennett, R. N. Jones, and T. R. Walsh Italian metallo-{beta}-lactamases: a national problem? Report from the SENTRY Antimicrobial Surveillance Programme J. Antimicrob. Chemother., January 1, 2005; 55(1): 61 - 70. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Castanheira, M. A. Toleman, R. N. Jones, F. J. Schmidt, and T. R. Walsh Molecular Characterization of a {beta}-Lactamase Gene, blaGIM-1, Encoding a New Subclass of Metallo-{beta}-Lactamase Antimicrob. Agents Chemother., December 1, 2004; 48(12): 4654 - 4661. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. E. Mendes, M. A. Toleman, J. Ribeiro, H. S. Sader, R. N. Jones, and T. R. Walsh Integron Carrying a Novel Metallo-{beta}-Lactamase Gene, blaIMP-16, and a Fused Form of Aminoglycoside-Resistant Gene aac(6')-30/aac(6')-Ib': Report from the SENTRY Antimicrobial Surveillance Program Antimicrob. Agents Chemother., December 1, 2004; 48(12): 4693 - 4702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Patzer, M. A. Toleman, L. M. Deshpande, W. Kaminska, D. Dzierzanowska, P. M. Bennett, R. N. Jones, and T. R. Walsh Pseudomonas aeruginosa strains harbouring an unusual blaVIM-4 gene cassette isolated from hospitalized children in Poland (1998-2001) J. Antimicrob. Chemother., March 1, 2004; 53(3): 451 - 456. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||