Skip Navigation


JAC Advance Access originally published online on March 13, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
51/4/991    most recent
dkg173v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Morita, Y.
Right arrow Articles by Tsuchiya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morita, Y.
Right arrow Articles by Tsuchiya, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


Journal of Antimicrobial Chemotherapy (2003) 51, 991-994
© 2003 The British Society for Antimicrobial Chemotherapy

Induction of mexCD-oprJ operon for a multidrug efflux pump by disinfectants in wild-type Pseudomonas aeruginosa PAO1

Yuji Morita1, Takeshi Murata2, Takehiko Mima1, Sumiko Shiota1, Teruo Kuroda1, Tohru Mizushima1, Naomasa Gotoh2, Takeshi Nishino2 and Tomofusa Tsuchiya1,*

1 Department of Microbiology, Faculty of Pharmaceutical Sciences, Okayama University, Tsushima, Okayama 700-8530; 2 Department of Microbiology, Kyoto Pharmaceutical University, Yamashina, Kyoto 607-8414, Japan

Received 11 December 2002; returned 24 December 2002; revised 21 January 2003; accepted 22 January 2003


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Induction of the MexCD-OprJ multidrug efflux pump was investigated in wild-type Pseudomonas aeruginosa PAO1. MexCD-OprJ was induced by clinically important disinfectants such as benzalkonium chloride and chlorhexidine gluconate, and by some cytotoxic agents such as tetraphenylphosphonium chloride, ethidium bromide and rhodamine 6G. MexCD-OprJ was not induced by norfloxacin, tetracycline, chloramphenicol, streptomycin, erythromycin or carbenicillin, although they are substrates for the pump. Cells of PAO1 showed increased resistance to norfloxacin when grown in the presence of the inducers of the mexCD-oprJ operon mentioned above. These results indicate that MexCD-OprJ plays an important role in intrinsic multidrug resistance in wild-type P. aeruginosa in hospitals where disinfectants are used frequently.

Keywords: MexCD-OprJ, multidrug efflux pump, inducers, P. aeruginosa


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Pseudomonas aeruginosa, a clinically significant pathogen, is a leading cause of hospital-acquired infections. A major factor in its importance as a pathogen is its intrinsic resistance to many antimicrobial agents, which is mainly attributed to the activity of several multidrug efflux pumps. This microorganism harbours three-component multidrug efflux pumps (Mex pumps), each comprised of an inner membrane protein, an outer membrane protein and a periplasmic protein, which play important roles in its intrinsic and acquired multidrug resistance. To date, five Mex pumps have been reported: MexAB-OprM,1 MexCD-OprJ,2 MexEF-OprN,3 MexXY-OprM4 and MexJK.5 Additional operons encoding further homologues exist in the P. aeruginosa genome.6

MexAB-OprM is expressed constitutively in P. aeruginosa cells grown in standard laboratory media and contributes to intrinsic resistance to a number of antimicrobial agents, including ß-lactams, macrolides, chloramphenicol, tetracycline and fluoroquinolones. MexEF-OprN is not expressed in cells grown in standard laboratory media, but is expressed in nfxC-type mutants.3 MexXY-OprM contributes to intrinsic resistance to a number of antimicrobial agents including aminoglycosides, tetracycline, macrolides and fluoroquinolones.4,7

It has been reported that MexCD-OprJ is not significantly expressed in cells grown in standard laboratory media, but is expressed in so-called nfxB-type multidrug-resistant mutants.2 In these mutants, MexCD-OprJ contributes to resistance to fluoroquinolones, macrolides, tetracycline and some ß-lactams (e.g. cefpirome).2 Recently, we found that expression of MexCD-OprJ was induced by tetraphenylphosphonium chloride (TPPCl) and ethidium bromide in mutant P. aeruginosa YM63 cells lacking mexAB-oprM, mexEF-oprN and mexXY.8 This suggests that the mexCD-oprJ operon is inducible in wild-type P. aeruginosa, because we deleted only the internal regions, and not the regulatory region, of the mex operons in strain YM63.

In this study, we investigated the induction of mexCD-oprJ in wild-type P. aeruginosa PAO1.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Bacterial strains and growth conditions

P. aeruginosa strains PAO1 and YM7 (a derivative of PAO1 lacking mexCD-oprJ) were used in this study. For construction of YM7, plasmid pTEM314, in which mexCD-oprJ was deleted, was used, and gene replacement was performed with Flp-FRT recombination technology.8 We confirmed by PCR that the mexCD-oprJ was deleted in the YM7 strain (data not shown). Cells of P. aeruginosa were grown in L broth (1% tryptone, 0.5% yeast extract, 0.5% NaCl)9 under aerobic conditions at 37°C. Where indicated, drugs were added to the medium. Cell growth was monitored turbidometrically at 650 nm.

Preparation of cell envelopes

P. aeruginosa cells were grown in 30 mL of L broth or L broth containing an appropriate antibacterial agent. The cells were harvested at the exponential phase of growth by centrifugation (5000g for 15 min at room temperature). Cell pellets were washed once with 20 mL of 50 mM sodium phosphate buffer (pH 7.2), re-suspended in 3 mL of the same buffer and stored on ice. Cells were disrupted by sonication using the Ultrasonic Disruptor Model UR-200P (TOMY SEIKO Co., Ltd, Tokyo, Japan). Unbroken cells were removed by centrifugation (6000g for 10 min at 4°C), and the cell envelope fraction was pelleted by centrifugation (260 000g, for 30 min at 4°C). The pellet was washed once with 2 mL of the ice-cold sodium phosphate buffer, and resuspended in 250 µL of the same buffer.

RT–PCR

Cells of P. aeruginosa were harvested at the exponential phase of growth (1.5 mL culture). Total cellular RNA was isolated from the cells using the Qiagen RNeasy Mini Kit (Qiagen Inc.), treated with RNase-free DNase (Promega) (1 U of enzyme/µg RNA for 2 h at 37°C) and re-purified using the same kit. A 0.2 µg sample of DNase-treated RNA was used as template for RT–PCR with the Qiagen OneStep RT–PCR kit (Qiagen Inc.) according to the manufacturer’s protocol. Primer pairs specific for and internal to both mexC and the rpsL genes (encoding a constitutively expressed ribosomal protein that was used as a control) were used for RT–PCR. Primers used for the mexC were: AGCCAGCAGGACTTCGATACC (forward) and ACGTCGGCGAACTGCAAC (reverse); and for the rpsL: GCAACTATCAACCAGCTGGTG (forward) and GCTGTGCTCTTGCAGGTTGTG (reverse). A 15 µL sample of each reaction product was analysed by agarose (2% w/v) gel electrophoresis for presence of the expected RT–PCR products (for mexC, 314 bp; for rpsL, 220 bp).

Western blotting of envelope proteins

Samples of cell envelopes prepared as described above were subjected to SDS–PAGE. Proteins resolved in the gel were transferred electrophoretically to nitrocellulose membranes (Toyo Roshi Co. Ltd, Tokyo, Japan). The membranes were incubated with a murine monoclonal antibody specific for OprJ (HJ001)10 at 4°C overnight in phosphate-buffered saline containing 0.1% Tween-20 (PBST) containing 1% skimmed milk, and washed five times with PBST. The membranes were incubated with an anti-mouse immunoglobulin, horseradish peroxidase (HRP)-linked whole antibody (from sheep) (Amersham Life Science, USA) at 37°C for 1 h. The activity of HRP was detected with ECL detection reagents RPN2105 (Amersham Pharmacia Biotech) after exposure of the blots to X-film (Kodak Co., USA).

Measurement of bacterial growth

P. aeruginosa cells were grown in L broth at 37°C until the late-exponential phase of growth (optical density at 650 nm was ~0.7). A 50 µL aliquot of pre-culture was inoculated into 5 mL of fresh L broth or L broth containing an appropriate antibacterial agent, and shaken at 37°C under aerobic conditions. The optical density at 650 nm was automatically recorded with Advantec TN1506 Biophotorecorder (Advantec Toyo Co. Ltd, Tokyo, Japan).


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
RT–PCR analysis

To investigate induction of the mexCD-oprJ operon, first we tested for gene expression using the RT–PCR method. We used internal primers specific for the first gene of the operon, mexC. No RT–PCR product was detected with cells grown in L broth (Figure 1a1, lane 2). Thus, it is clear that the mexC gene is not expressed in PAO1 cells under normal growth conditions. Addition of TPPCl, ethidium bromide, rhodamine 6G, benzalkonium chloride or chlorhexidine gluconate, identified as possible inducers of the mexCD-oprJ operon, each resulted in the production of mexC mRNA (Figure 1a1, lanes 3–7), but addition of norfloxacin, erythromycin, tetracycline, chloramphenicol, streptomycin or carbenicillin did not (Figure 1a1, lanes 8–13). The amounts of mRNA from a constitutively expressed rpsL gene were the same in cells grown under all the conditions examined (Figure 1a2, lanes 2–13).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 1. (a) RT–PCR and (b) western immunoblot analyses. (a) RT–PCR products indicating the expression of the mexC (a1) and rpsL (a2) genes of P. aeruginosa PAO1. A 2 µL (a1) or 0.5 µL (a2) aliquot of each reaction product was analysed by agarose (2% w/v) gel electrophoresis. pBR322 digested with the restriction enzyme MspI was used as a molecular weight standard (lanes 1 and 14). Wild-type PAO1 cells were grown in L broth (lane 2) or L broth containing 1 g/L TPPCl (lane 3), 256 mg/L ethidium bromide (lane 4), 64 mg/L rhodamine 6G (lane 5), 40 mg/L benzalkonium chloride (0.0625 x MIC) (lane 6), 21 mg/L chlorhexidine gluconate (0.0625 x MIC) (lane 7), 0.25 mg/L norfloxacin (lane 8), 64 mg/L erythromycin (lane 9), 8 mg/L tetracycline (lane 10), 8 mg/L chloramphenicol (lane 11), 8 mg/L streptomycin (lane 12) or 16 mg/L carbenicillin (lane 13). (b) Western blot analysis of OprJ with anti-OprJ antiserum. Each lane contains 20 µg of total membrane protein. PAO1 cells were grown under the same conditions as in (a).

 
Western blot analysis

We confirmed induction of the MexCD-OprJ pump in wild-type P. aeruginosa PAO1 cells with a western immunoblot analysis. We used an OprJ-specific murine monoclonal antibody HJ00110 and cell envelopes from wild-type PAO1 cells that were grown in the presence of various antimicrobial agents. As reported previously,2 production of OprJ was undetectable when cells were grown in L broth (Figure 1b). The OprJ protein was detected with wild-type PAO1 cell envelopes when cells were grown in the presence of either TPPCl, ethidium bromide, rhodamine 6G, benzalkonium chloride or chlorhexidine gluconate, but not when cells were grown in broth containing norfloxacin, erythromycin, tetracycline, chloramphenicol, streptomycin or carbenicillin (Figure 1b). These results indicate clearly that the MexCD-OprJ multidrug efflux pump is an inducible pump in wild-type P. aeruginosa PAO1 cells, inducers of which include benzalkonium chloride, chlorhexidine gluconate, TPPCl, ethidium bromide and rhodamine 6G, and which are completely consistent with those of induction of mexC mRNA synthesis (Figure 1a1).

Growth

We tested the effect of inducers of the operon on the growth of wild-type PAO1 in the presence of antibacterial agents. Growth of wild-type PAO1 cells was strongly inhibited by 1 mg/L (MIC) norfloxacin (Figure 2a). However, cells grew even in the presence of the same concentration of norfloxacin when benzalkonium chloride (20 mg/L, 0.33 x MIC) was added (Figure 2a). We conclude that benzalkonium chloride induced the MexCD-OprJ pump; the pump extruded norfloxacin, and thus cells escaped the inhibition by norfloxacin. Cells of YM7, which lack the mexCD-oprJ operon, however, were unable to grow in the presence of 1 mg/L norfloxacin (MIC) regardless of the absence or presence of benzalkonium chloride (20 mg/L, 0.33 x MIC) (Figure 2b). These results support the above interpretation. We also tested the effects of other inducers (TPPCl, ethidium bromide, rhodamine 6G and chlorhexidine gluconate) and obtained similar results, namely that cells of PAO1, but not of YM7, show increased resistance to norfloxacin when grown in broth containing each of the inducers of the mexCD-oprJ operon (data not shown).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Growth of P. aeruginosa PAO1 (a) and YM7 (b). P. aeruginosa cells were grown at 37°C until the exponential phase in 5 mL of L broth. A 0.05 mL aliquot of pre-culture was used to inoculate 5 mL of L broth (triangles) or L broth containing an appropriate antibacterial agent [1 mg/L norfloxacin (squares), 20 mg/L benzalkonium chloride (diamonds), 1 mg/L norfloxacin and 20 mg/L benzalkonium chloride (circles)]. Inoculates were shaken at 37°C aerobically. The optical density at 650 nm was automatically recorded using the Advantec TN1506 Biophotorecorder (Advantec Toyo Co. Ltd).

 
Our results indicate clearly that the mexCD-oprJ operon is not silent in wild-type P. aeruginosa PAO1. We believe that wild-type NfxB, the repressor of the operon, represses transcription of the mexCD-oprJ operon. It is possible that inducers of the mexCD-oprJ operon bind to the wild-type NfxB protein and prevent the repression of the mexCD-oprJ operon. Thus, it seems that MexCD-OprJ, in addition to MexAB-OprM and MexXY-OprM, could play an important role in the intrinsic resistance to quinolones and other antibacterial agents in wild-type P. aeruginosa.

In particular, it is likely that MexCD-OprJ plays a role in the multidrug resistance of P. aeruginosa in hospitals, where disinfectants such as benzalkonium chloride and chlorhexidine gluconate are often used. Thus, clinically relevant biocides induce MexCD-OprJ, thereby enhancing resistance to clinically relevant antibiotics in P. aeruginosa. It is likely that a variety of other compounds could also be able to induce the mexCD-oprJ operon.


    Acknowledgements
 
We thank Dr M. Varela of Eastern New Mexico University for critical reading of the manuscript. This research was supported in part by a grant from the Ministry of Education, Science, Sport and Culture of Japan.


    Footnotes
 
* Corresponding author. Tel/Fax: +81-86-251-7957; E-mail: tsuchiya{at}pharm.okayama-u.ac.jp Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
1 . Poole, K., Krebes, K., McNally, C. & Neshat, S. (1993). Multiple antibiotic resistance in Pseudomonas aeruginosa: evidence for involvement of an efflux operon. Journal of Bacteriology 175, 7363–72.[Abstract/Free Full Text]

2 . Poole, K., Gotoh, N., Tsujimoto, H., Zhao, Q., Wada, A., Yamasaki, T. et al. (1996). Overexpression of mexC-mexD-oprJ efflux operon in nfxB-type multidrug-resistant strains of Pseudomonas aeruginosa. Molecular Microbiology 21, 713–24.[CrossRef][Web of Science][Medline]

3 . Kohler, T., Michea-Hamzehpour, M., Henze, U., Gotoh, N., Curty, L. K. & Pechere, J. C. (1997). Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Molecular Microbiology 23, 345–54.[CrossRef][Web of Science][Medline]

4 . Mine, T., Morita, Y., Kataoka, A., Mizushima, T. & Tsuchiya, T. (1999). Expression in Escherichia coli of a new multidrug efflux pump, MexXY, from Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 43, 415–7.[Abstract/Free Full Text]

5 . Schweizer, H. P. (2001). Triclosan: a widely used biocide and its link to antibiotics. FEMS Microbiology Letters 202, 1–7.[CrossRef][Web of Science][Medline]

6 . Stover, C. K., Pham, X. Q., Erwin, A. L., Mizoguchi, S. D., Warrener, P., Hickey, M. J. et al. (2000). Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406, 959–64.[CrossRef][Medline]

7 . Masuda, N., Sakagawa, E., Ohya, S., Gotoh, N., Tsujimoto, H. & Nishino, T. (2000). Contribution of the MexX-MexY-OprM efflux system to intrinsic resistance in Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 44, 2242–6.[Abstract/Free Full Text]

8 . Morita, Y., Komori, Y., Mima, T., Kuroda, T., Mizushima, T. & Tsuchiya, T. (2001). Construction of a series of mutants lacking all of the four major mex operons for multidrug efflux pumps or possessing each one of the operons from Pseudomonas aeruginosa PAO1: MexCD-OprJ is an inducible pump. FEMS Microbiology Letters 202, 139–43.[CrossRef][Web of Science][Medline]

9 . Lennox, E. S. (1955). Transduction of linked genetic characters of host by bacteriophage P1. Virology 1, 190–206.[CrossRef][Web of Science][Medline]

10 . Hosaka, M., Gotoh, N. & Nishino, T. (1995). Purification of a 54-kilodalton protein (OprJ) produced in NfxB mutants of Pseudomonas aeruginosa and production of a monoclonal antibody specific to OprJ. Antimicrobial Agents and Chemotherapy 39, 1731–5.[Abstract]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
S. Fraud, A. J. Campigotto, Z. Chen, and K. Poole
MexCD-OprJ Multidrug Efflux System of Pseudomonas aeruginosa: Involvement in Chlorhexidine Resistance and Induction by Membrane-Damaging Agents Dependent upon the AlgU Stress Response Sigma Factor
Antimicrob. Agents Chemother., December 1, 2008; 52(12): 4478 - 4482.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
N. Mesaros, Y. Glupczynski, L. Avrain, N. E. Caceres, P. M. Tulkens, and F. Van Bambeke
A combined phenotypic and genotypic method for the detection of Mex efflux pumps in Pseudomonas aeruginosa
J. Antimicrob. Chemother., March 1, 2007; 59(3): 378 - 386.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
E. Marrer, K. Schad, A. T. Satoh, M. G. P. Page, M. M. Johnson, and L. J. V. Piddock
Involvement of the Putative ATP-Dependent Efflux Proteins PatA and PatB in Fluoroquinolone Resistance of a Multidrug-Resistant Mutant of Streptococcus pneumoniae
Antimicrob. Agents Chemother., February 1, 2006; 50(2): 685 - 693.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
H. Sekiya, T. Mima, Y. Morita, T. Kuroda, T. Mizushima, and T. Tsuchiya
Functional Cloning and Characterization of a Multidrug Efflux Pump, MexHI-OpmD, from a Pseudomonas aeruginosa Mutant
Antimicrob. Agents Chemother., September 1, 2003; 47(9): 2990 - 2992.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
51/4/991    most recent
dkg173v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Morita, Y.
Right arrow Articles by Tsuchiya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morita, Y.
Right arrow Articles by Tsuchiya, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?