JAC Advance Access originally published online on February 11, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Antimicrobial Chemotherapy (2003) 51, 545-556
© 2003 The British Society for Antimicrobial Chemotherapy
Relative contributions of the AcrAB, MdfA and NorE efflux pumps to quinolone resistance in Escherichia coli

Department of Molecular Virology and Microbiology, One Baylor Plaza, Mail-stop: BCM-280, Baylor College of Medicine, Houston, TX 77030-3411, USA
Received 9 April 2002; returned 11 October 2002; revised 13 November 2002; accepted 16 December 2002
| Abstract |
|---|
|
|
|---|
Quinolones are widely used, broad-spectrum antimicrobial agents. In screens for genes that, when overexpressed, allow Escherichia coli to grow on otherwise lethal concentrations of the fluoroquinolone norfloxacin, the ydhE gene was identified. We have shown that ydhE encodes a multidrug efflux pump with a narrower substrate range than that of its closest homologue, encoded by norM, and named the gene norE. The relative contributions to drug resistance of NorE compared with the two other known E. coli quinolone pumps, AcrAB and MdfA, have been defined. Overexpression of each of the three pumps separately resulted in roughly similar levels of quinolone resistance, whereas simultaneous overexpression of norE or mdfA in combination with acrAB gave synergic increases in quinolone resistance. The level of quinolone resistance mediated by efflux pumps seems to be constrained to an
10-fold maximum, even with increased production of the pumps. We measured the drug resistance of an isogenic set of strains containing the various permutations of single, double and triple drug efflux pump mutants. The
norE and
mdfA mutants were somewhat more susceptible to fluoroquinolones than the parent strain, and acrAB mutants were four- to six-fold more susceptible. Mutants lacking two or all three efflux pumps were not significantly more susceptible to fluoroquinolones than those lacking only one of the three pumps. | Introduction |
|---|
|
|
|---|
Bacterial resistance to antimicrobial agents is one of the most pressing worldwide health problems today.1 The quinolones are a widely used class of antibiotics that affect a broad spectrum of microbes.2,3 Quinolones kill by targeting the DNA metabolic enzymes DNA gyrase and topoisomerase IV.4 These enzymes bind to, cleave and pass DNA strands through each other in order to untangle DNA and regulate its supercoiling. When these enzymes cleave DNA, through a transesterification reaction they are covalently attached to the cleaved DNA. This normally short-lived topoisomeraseDNA adduct becomes a poison when stabilized by quinolones.57 Fluoroquinolones, potent derivatives of the quinolones, are among the most recently approved classes of antimicrobial agents, but resistance has already been documented.8,9 Bacteria develop clinically significant resistance to quinolones through at least two different mechanisms.10 Mutations in the drug targets DNA gyrase and topoisomerase IV are the best-known resistance mechanism, but mutations that lead to increased expression of quinolone transporters are becoming increasingly common. These drug efflux pumps lower the drug concentration in cells to reduce the probability that the drug will encounter the target topoisomerases. Quinolone resistance in clinical strains has been shown to arise through both pathways separately and in combination.11,12
Gram-negative bacteria contain multidrug transporters that belong to four different families: multidrug and toxic compound extrusion (MATE), major facilitator superfamily (MFS), resistance-nodulation-division (RND) and small multidrug resistance (SMR).13 Three transporters, AcrAB, MdfA and YdhE, which represent three distinct families of efflux pumps, have been shown to efflux quinolones in Escherichia coli.1416 The AcrAB pump is a member of the RND family, which is only found in Gram-negative bacteria.13 This transporter consists of three parts: AcrB, a 12 transmembrane-spanning integral inner membrane protein, a periplasmic lipoprotein, AcrA, which facilitates the connection between AcrB and an outer membrane channel, thought to be TolC.17 MdfA is a member of the MFS family of pumps and is a single 12 transmembrane-spanning integral inner membrane protein.15 NorM, from Vibrio parahaemolyticus,16 is the founding member of the most recently identified MATE family of pumps.13,18 YdhE is the E. coli homologue of NorM.16 Like MdfA, NorM is predicted to be a single 12 transmembrane-spanning integral inner membrane protein, which exports compounds into the periplasmic space.
In a screen for genes that when overexpressed allow cells to grow on otherwise lethal amounts of the fluoroquinolone norfloxacin, we identified ydhE in E. coli. We have shown that ydhE encodes a multidrug efflux pump with a narrower substrate range than NorM, and named the gene norE. We compared the relative contributions and drug specificity of the three quinolone pumps in E. coli by overexpression and deletion mutation analyses.
| Materials and methods |
|---|
|
|
|---|
Chemicals and reagents
Oligonucleotide primers were obtained from Integrated DNA Technologies. Restriction endonucleases, DNA ligase and T4 DNA polymerase were from New England Biolabs, and Taq polymerase from Gibco BRL. [14C]Norfloxacin (14.8 mCi/mM specific activity) was a generous gift of Merck Pharmaceuticals, Ltd. Carbenicillin, cefotaxime, chloramphenicol, ciprofloxacin, Crystal Violet, erythromycin, ethidium bromide, nalidixic acid, neomycin, norfloxacin, rifampicin and sodium dodecyl sulphate (SDS) were obtained from Sigma; tetraphenylphosphonium (TPP) was a generous gift from Chemconserve (Holland). Bacto-tryptone and yeast extract were from Difco.
E. coli strains and growth conditions
The bacterial strains used in this study are all derivatives of E. coli K-12 and are listed in Table 1. For simplicity in this manuscript, we refer to the strains by the relevant genotypes. An isogenic set of strains was constructed that allow selective inhibition of topoisomerase IV and gyrase.19 Strain UTL2 mdfA::kan was generously provided by Dr Eitan Bibi (Weizmann Institute of Science, Rehout, Israel); strains N43 and W4573 were gifts from Dr Hiroshi Nikaido (University of California, Berkeley, CA, USA); JC9387 was a gift from Dr Susan M. Rosenberg (Baylor College of Medicine, Houston, TX, USA).
|
Cells were grown with shaking at 37°C in LB medium (10 g/L Difco bacto-trypone, 5 g/L Difco yeast extract, 5 g/L NaCl, pH 7.0) or M9 medium (M9 salts, 7 g/L Na2PO4, 3 g/L KH2PO4, 0.5 g/L NaCl and 1 g/L NH4Cl, supplemented with 1 mM MgSO4, 5 µg/L thiamine, 0.4% glycerol and 0.5% casamino acids). Except when specifically stated, ampicillin was used at 50 mg/L and chloramphenicol at 30 mg/L.
Genomic library and plasmids
The genomic library was made by cloning an incomplete Sau3AI digest of E. coli MG1655 genomic DNA into the BamHI site of plasmid pBR322. About half of the transformants contained recombinant plasmids with an evident insert, and the average insert size was
2 kb. The library, containing
10 000 clones, was a gift from Dr Timothy Palzkill (Baylor College of Medicine, Houston, TX, USA).
Plasmids used in this study are listed in Table 1. Plasmid pSUP5 contains the mdfA gene with 356 bp upstream and 1178 bp downstream flanking sequences. Plasmid pSUP4 contains the norE gene and 858 bp upstream flanking sequence and 662 bp downstream flanking sequence inserted in the pBR322 BamHI site. Because the BamHI site is within the tetA gene, all of the screen-derived recombinant plasmids have tetA inactivated. Plasmid pSY2 was generated by digesting pSUP4 with NcoI, which cuts twice to remove the nucleotides corresponding to NorE residues 117208, followed by end-to-end ligation of the larger fragment. Plasmid pSUP1 contains the norE gene together with 858 bp upstream flanking sequence and 1290 bp downstream flanking sequence. The increased flanking sequence was important for the homologous recombination step for allelic replacement. Plasmid pSUP1 was digested with BstXI, which cuts pSUP1 twice, treated with T4 DNA polymerase to generate blunt ends, and ligated to an 800 bp blunt-ended DNA fragment that contained the chloramphenicol acetyltransferase (cam) gene. The resulting plasmid, pSY3, contains the cam gene between nucleotides 126 and 1113 of the norE gene.
Plasmid pAB, a gift from Dr Helen I. Zgurskaya, is derived from vector pACYC184 and contains the acrAB genes under the control of the PBAD promoter, which is tightly regulated by arabinose20 in a dosage-dependent manner.21
Overexpression screen
E. coli strains LZ24 (gyrA+ parC+) and LZ23 (gyrAL83 parC+) were transformed by electroporation with an E. coli genomic library and spread onto LB-agar containing ampicillin and either 0.05 mg/L norfloxacin (LZ24) or 0.5 mg/L norfloxacin (LZ23), and allowed to grow at 37°C for 24 h. A fraction of the transformed strains was spread onto LB-agar with ampicillin to determine the total number of transformants.
A few isolated plasmids were sequenced using an oligonucleotide primer P2 (CACTATCGACTACGCGATCA) complementary to the pBR322 vector sequence just upstream of the BamHI site. The resulting 300400 nucleotide sequence was compared with the E. coli genome.22 From the DNA sequence and the size of the plasmid insert, we were able to ascertain which genes were encoded on the plasmids.
The rest of the plasmids conferring norfloxacin resistance were tested for the presence of the ydhE gene using PCR with purified plasmid DNA as template, and primers P4 (ATCAGTGAAGCGCGTCTG) and P5 (GTTGCAGAATGATGGCTG), which are identical to the 5' and 3' regions of norE, respectively.
Drug susceptibility assays
The MIC of drug that inhibits 99% of cell growth was assessed using Etest antibiotic strips (AB Biodisk, Solna, Sweden). Cells were grown to an optical density at 600 nm of 0.4 and spread on LB-agar or M9-agar of thickness 4.0 ± 0.5 mm. Etest antibiotic strips were placed on the freshly spread cells and the plates were incubated for 1418 h at 37°C. The MIC was read at the point where the zone of growth inhibition intersected the strip. The MIC for TPP was determined by inoculating cells into LB-broth containing various amounts of the drug, incubating at 37°C with shaking for 24 h and determining the concentration that prevented visible growth.
Drug gradient plates23 were also used to assay the drug susceptibility. A colony forming assay was also used: strains were grown to mid-logarithmic phase (OD600 = 0.4) and were diluted such that between 100 and 500 cells were spread onto LB-agar containing 0, 0.03, 0.035, 0.04 or 0.05 mg/L norfloxacin. Plates were incubated at 37°C for 1418 h, when the cfu was determined.
[14C]Norfloxacin accumsulation assay
Cells were grown to mid-logarithmic phase (OD600 = 0.4) in M9 minimal medium containing glycerol, appropriate growth supplements and ampicillin. The protocol used was essentially the same as described previously.24 Briefly, cells were harvested, washed in double-distilled water, resuspended in potassium phosphate buffer (50 mM KH2PO4/K2HPO4, pH 7.0) at
5 mg cells/mL and allowed to equilibrate for 510 min at 25°C. [14C]Norfloxacin was added to a final concentration of 25 µM, to start the time course. At various times, 50 or 100 µL aliquots of cells were removed, placed into 1 mL wash buffer (50 mM KH2PO4/K2HPO4, pH 7.0, 0.1 M NaCl) and then quickly filtered onto 0.45 µm AcetatePlus filters (Osmonics) on a sampling manifold (Millipore). Samples were washed with 5 mL of wash buffer. Filters were dried, placed in Ultima Gold scintillation fluid (Packard) and read on a Beckman LS7500 scintillation counter. The amount of radioactivity on the filter corresponds to the amount of [14C]norfloxacin in the cells.
In order to determine whether the efflux pumps are powered by the membrane proton gradient, the amount of [14C]norfloxacin accumulation was also assayed in the presence of 100 µM carbonyl cyanide m-chlorophenylhydrazone (CCCP), which disrupts the proton gradient across the cell membrane.25 Accumulation assays were carried out as above except that [14C]norfloxacin was added to a final concentration of 50 µM (t = 0), and at t = 15 min, CCCP was added to 100 µM.
Western blot analyses
Cells containing plasmids pAB and either pC108, pSUP4 or pSUP5 were grown in LB medium with ampicillin and chloramphenicol to logarithmic phase, and then inoculated to a cell density of OD600 = 0.01 into LB with ampicillin and chloramphenicol containing either 0.2%, 0.02% or no arabinose, and were allowed to grow with shaking at 37°C. At 3.5 and 8.5 h, equal numbers of cells were harvested and resuspended in loading buffer (50 mM TrisCl, pH 6.8; 100 mM dithiothreitol; 10% glycerol; 2% SDS; 0.1% Bromophenol Blue) and incubated at 100°C for 5 min to generate whole-cell extract. At 3.5 h, the OD600 ranged from
0.6 to 0.8 (late logarithmic phase), and at 8.5 h, the OD600 was >2.0 (stationary phase). Equal amounts of extract were subjected to SDSPAGE and the separated proteins were transferred to nitrocellulose membrane (Schleicher & Schuell). The AcrA antibody17 was used at a 1:100 000 dilution. The secondary antibody, goat anti-rabbit antibodies conjugated to horseradish peroxidase (Pierce), was used at a 1:100 000 dilution. The bands were visualized using Supersignal Chemiluminescent substrates (Pierce) and quantified by measuring directly the fluorescence from the blot with a 40°C cooled CCD camera and Gel Expert image software (Nucleovision Tech).
norE allelic replacement
Plasmid pSY3, which contains the norE::cam allele, was used as the template in PCR with primers P2 (CACTATCGACTACGCGATCA) and P10 (CACGATGCGTCCGGGCGTAG), which are targeted to the pBR322 sequences flanking the BamHI site, generating an
3 kb linear DNA PCR product. Approximately 2 µg of this purified product was used to transform strain JC9387 (recBC sbcBC) to chloramphenicol resistance by allelic replacement of the chromosomal norE gene.
A PCR strategy was used to confirm that the linear fragment had undergone homologous recombination at the norE locus. Genomic DNA was isolated from chloramphenicol-resistant colonies. Oligonucleotide primer P31 (AAAGACACGCTGCGTATTGC), which is identical to the upstream region of norE (outside the linear fragment used in the initial transformation), and primer Pcam (CTCATCGCAGTACTGTTG), which is identical to part of the cam gene, were used in PCR. A product would result only if recombination had occurred at the norE locus. Two recombinants with the desired DNA arrangement (out of 10 tested) were obtained. These two were found to exhibit the same phenotypes in all subsequent assays. P1 transduction (see below) was used to move the
norE::cam allele into the W4573-based strains.
Strain construction
Strain W4573 was chosen as the parent strain from which to make the isogenic set of efflux pump mutants because the acrA1 allele (strain N43), which has no antibiotic marker for selection, was in this wild-type background. Transductions were carried out with P1vira according to Miller,26 in order to move the
norE::cam and
mdfA::kan mutations into E. coli W4573 or N43. The kanamycin- and chloramphenicol-resistant transductants were confirmed by determining drug susceptibility and by PCR screening for
norE::cam.
| Results |
|---|
|
|
|---|
Genes that increase quinolone resistance in E. coli were identified by screening for genes that, when overexpressed, allow growth on medium containing lethal concentrations of the fluoroquinolone norfloxacin. Norfloxacin was chosen as the model quinolone because its cellular targets and mode of killing have been well-studied.19,27,28 E. coli contains two quinolone targets, the two type 2 topoisomerases DNA gyrase and topoisomerase IV. DNA gyrase is encoded by the gyrA and gyrB genes, and topoisomerase IV by the parC and parE genes. In E. coli, DNA gyrase is the primary target for the quinolones19,29 and the gyrAL83 mutant allele confers a 10-fold increase in quinolone resistance.30 An E. coli genomic library cloned into the plasmid vector pBR322 was transformed into wild-type (gyrA+ parC+, LZ24) and gyrAL83 parC+ (LZ23) cells. The transformation mixtures were spread onto LB-agar containing 50 mg/L ampicillin, and norfloxacin at 0.05 mg/L (for the gyrA+ parC+ strain) and 0.5 mg/L (for the gyrAL83 parC+ strain). At these concentrations of norfloxacin, the strains had a spontaneous mutation rate to drug resistance of 105 (data not shown). Of
100 000 transformants in the wild-type screen, 210 formed colonies on agar containing 0.05 mg/L norfloxacin. For the screen with the gyrAL83 allele,
200 000 transformants were screened and 175 colonies were obtained on agar with 0.5 mg/L norfloxacin. These numbers represent >10-fold coverage of the E. coli genome.31 Two classes of isolates
With two exceptions, NorM from V. parahaemolyticus16 and LfrA from Mycobacterium smegmatis,32 all previously characterized drug pumps that efflux norfloxacin also extrude the unrelated drug, chloramphenicol. Therefore, the isolates were tested for their ability to grow in the presence of 5 mg/L chloramphenicol.
Approximately one-third of the initial norfloxacin-resistant isolates from the screens using wild-type and gyrAL83 cells were also resistant to chloramphenicol. Eight plasmids that conferred multidrug resistance from each screen were selected at random for sequencing. All carried the mdfA gene; one of these recombinant plasmids, pSUP5, was chosen for use in subsequent experiments. Because it was found in both screens, it was concluded that the MdfA pump confers resistance independently of whether gyrase is mutated or not.
From the wild-type screen, 10 plasmids that conferred only norfloxacin resistance were sequenced. These plasmids all contained the full-length ydhE gene (38 min on the E. coli chromosome22). Because the closest homologue to ydhE identified is the norM gene from V. parahaemolyticus, we renamed the ydhE open reading frame norE. Plasmids were isolated from the remaining transformants and used as templates in PCR with primers specific to norE. All of the PCR assays yielded a product with the expected DNA length, consistent with the norE gene being on the plasmid. In total, 118 of 124 of the plasmids that conferred norfloxacin, but not chloramphenicol, resistance from the gyrAL83 screen also contained norE, as determined by PCR screening. One of these plasmids, pSUP4, was re-transformed into strains gyrA+ parC+, gyrAL83 parC+ and gyrAL83 parCK84.27 The presence of pSUP4 caused the same (approximately five-fold) increased norfloxacin resistance in all strains. Therefore, norE, like mdfA, confers increased drug resistance when overexpressed, whether or not gyrase or topoisomerase IV is mutated.
Plasmids containing norE also contained fragments of two other genes, ribE and b1644. To ensure that the norE gene, alone, was responsible for drug resistance, we constructed an in-frame deletion of the nucleotides encoding residues 117208 of norE. The plasmid containing the resulting norE1 mutant was designated pSY2. E. coli cells containing plasmid pSY2 exhibited the same susceptibility to drug as those with the vector plasmid pBR322 (Figure 1). Thus, norE mediates the observed resistance to norfloxacin, and residues 117208 are essential for its activity.
|
Substrate specificity of NorE
To define which drugs are affected by norE overexpression, cells harbouring pSUP4, pSY2 (negative control) or pBR322 were cultured on LB-agar that contained a gradient of acriflavine, carbenicillin, cefotaxime, chloramphenicol, ciprofloxacin, Crystal Violet, erythromycin, ethidium bromide, nalidixic acid, neomycin, rifampicin, SDS or tetraphenylphosphonium (TPP). Norfloxacin was used as a positive control. These compounds represent several different classes of drugs, and represent most of those effluxed by known transporters.33 Plasmid pSUP4 allowed cells to grow on higher concentrations of TPP and the fluoroquinolones, norfloxacin and ciprofloxacin, compared with pBR322 or pSY2, but not on any of the other drugs (data not shown). pSUP4 increased the TPP MIC two-fold (2 mg/L as opposed to 1 mg/L with pBR322). YdhE/NorE, when overproduced in E. coli that contained an inactive acrAB mutant allele, confers resistance to a wider range of drugs.16,34
To quantify the drug resistance and determine the fluoroquinolone specificity mediated by high-level expression of norE, we measured the MICs for the wild-type strain carrying pBR322, pSUP4, pSY2 or pSUP5 (for comparison) using Etest strips (Figure 1). Plasmids pSUP4 and pSUP5 conferred resistance to a subset of the fluoroquinolones, ciprofloxacin, clinafloxacin, gemifloxacin and norfloxacin, increasing the MICs from three- to six-fold (Figure 1a). Resistance levels to levofloxacin, ofloxacin and sparfloxacin were not affected by pSUP4 or pSUP5. Because LZ24 contains the kan and tetA resistance genes, the MICs for the markerless wild-type strain (W4573) that contained pSUP4 and pC108 (pBR322 with inactive tetA gene35) were determined for kanamycin and tetracycline. Plasmid pSUP4 did not increase the MIC for these two drugs compared with plasmid pC108 (data not shown).
In contrast to what was found for NorE, MdfA overproduction increased chloramphenicol resistance markedly (Figure 1b). The two pumps exhibit the same quinolone specificity, but high-level MdfA production conferred lower levels of resistance to clinafloxacin, gemifloxacin and norfloxacin than NorE overproduction.
NorE is an efflux pump powered by the proton motive force
In order to determine whether norE mediates drug resistance by drug efflux, intracellular [14C]norfloxacin accumulation, which represents the steady-state influx and efflux of the drug, was measured for the wild-type strain containing either pBR322, pSUP5, pSUP4 or pSY2 (Figure 2a). Both pSUP4 and pSUP5 decreased the norfloxacin concentration in cells to about half that in cells carrying pBR322 or pSY2. Cells carrying pSUP4 accumulated slightly less [14C]norfloxacin than cells carrying pSUP5.
|
Because the predicted protein sequence for NorE does not contain any obvious ATP-binding motifs and because the V. parahaemolyticus homologue NorM16 is energized by the proton gradient, we tested whether NorE is powered by the proton motive force. Although NorM is an Na+/drug antiporter, the proton motive force is required for the Na+ gradient.36,37 In the presence of 100 µM m-chlorophenylhydrazone, a drug that disrupts the membrane proton gradient, norfloxacin efflux was blocked. Drug accumulation was the same in cells containing either pBR322 or pSUP4 (Figure 2b). Thus, NorE is dependent on the proton motive force, and is most likely an Na+/drug antiporter.37
Comparison of drug resistance mediated by the overexpression of acrAB, mdfA or norE
To understand better how the three known quinolone efflux pumps affect drug resistance, we examined the effect of overproducing each of them, alone and in combination, on resistance to ciprofloxacin, norfloxacin, the acidic quinolone nalidixic acid and an unrelated drug, rifampicin (Table 2). Neither MdfA nor NorE transports nalidixic acid or rifampicin (Figure 1b), whereas AcrAB does slightly (two-fold).14,33 We determined the effect of high-level production of NorE from pSUP4, mdfA from pSUP5 and acrAB from pAB.21
|
The wild-type strain harbouring vector plasmids pACYC184 and pBAD in LB medium containing no arabinose provided the baseline MIC (1x) to which those reflecting overproduction of the efflux pumps are compared (Table 2). The MIC was unaffected by 0.02% arabinose, but 0.2% arabinose somewhat affected the fluoroquinolone MIC (1.4x) and nalidixic acid MIC (0.7x). Thus, the amount of arabinose in the growth medium may influence the intrinsic drug resistance of E. coli, but only at the highest concentration.
In order to determine the effect on drug resistance caused only by acrAB overexpression, the MICs of various quinolones and rifampicin for strain LZ24 transformed with plasmids pAB and pC108 were determined by Etest strips. Cells containing plasmids pAB and pC108 grown in the presence of 0.02% arabinose were approximately two-fold more resistant to the fluoroquinolones and nalidixic acid compared with cells grown without arabinose; cells grown in the presence of 0.2% arabinose were approximately five-fold more resistant to the fluoroquinolones, and approximately two-fold more resistant to nalidixic acid and rifampicin (Table 2).
To correlate the level of resistance to the amount of AcrAB production, AcrA levels were measured by immunoblot analyses. Whole-cell extract of cells grown in the presence of 0.2%, 0.02% or no arabinose for 3.5 and 8.5 h were obtained and subjected to SDSPAGE and western blot analysis using anti-AcrA antibodies. The 3.5 h timepoint is where the peak induction of AcrA occurs, and the 8.5 h timepoint reveals how stable AcrA is over time. At 3.5 h, both 0.02% and 0.2% arabinose gave similar increases (10-fold) in AcrA levels (Figure 3a, lanes 78). This 10-fold higher AcrA level persisted at 8.5 h only for cells grown in the presence of 0.2% arabinose; those grown in the presence of 0.02% arabinose showed only a two-fold increase compared with cells grown in no arabinose (Figure 3b, lanes 13). The higher arabinose concentration gave a more durable increase in AcrA levels, whereas the lower arabinose concentration generated a more transient effect. This difference probably explains the higher drug resistance seen with the higher arabinose concentration.
|
Drug resistance mediated by the concurrent overexpression of acrAB with mdfA or norE
In order to determine the effect of simultaneous overexpression of acrAB and norE pumps on drug resistance, the wild-type strain was co-transformed with pAB and pSUP4 (Table 2). The MICs of effluxed antibiotics for the cells grown in the absence of arabinose should reflect production of NorE alone, thus allowing direct comparison of the effect of overexpression of acrAB with that of norE. The presence of an extra copy of acrAB on plasmid pAB does not increase drug resistance, as strains containing only plasmid pSUP4 (Figure 1) showed the same or higher levels of drug resistance as strains containing plasmids pSUP4 and pAB grown without arabinose (Table 2). Taking into account the effect of 0.2% arabinose on the baseline MIC, the resistance to fluoroquinolones mediated by overexpression of norE was similar to that exhibited after 0.2% arabinose-induced expression of acrAB. The overexpression of norE, combined with an intermediate level of acrAB overexpression (0.02%), resulted in a synergic increase in fluoroquinolone resistance. The fold increase in resistance observed when both norE and acrAB were overexpressed is roughly the multiple of the individual fold increases, rather than the sum. Finally, norE in combination with higher levels of acrAB expression (0.2%) did not result in increased resistance compared with the 0.02% arabinose-induced levels. Thus, the increased levels of AcrAB did not lead to increased drug resistance when norE was also overexpressed. This result suggests that there may be an upper limit to drug resistance mediated by the overexpression of efflux pumps.
One alternative explanation for this result is that the overproduction of NorE might affect AcrAB levels. To test this, we measured AcrA levels by immunoblot analyses (Figure 3) as described above. AcrA levels were unaffected by the concurrent overexpression of norE in LB medium supplemented with 0.02% or 0.2% arabinose at 3.5 and 8.5 h (Figure 3a, compare lanes 1 and 2 with 3 and 4; and 3b, compare lanes 13 with 46). To test whether NorE overproduction negatively affects AcrAB activity, we measured resistance to nalidixic acid and rifampicin. These drugs are not effluxed by NorE, and thus test the effect of NorE on AcrAB activity. The MICs were determined for cells containing pAB and pSUP4, and for cells containing pAB and pC108 when grown in the presence of arabinose. The presence of pSUP4 did not prevent the approximately two-fold increased resistance mediated by AcrAB overproduction (Table 2). Cells containing plasmids pSY2 and pAB show the same MIC as cells containing the vector plasmid pC108 and pAB (Table 2). Thus, the inactive norE1 mutant does not increase drug resistance, and the synergic effects observed with co-overexpression of norE and acrAB are dependent on active norE.
To test whether the effects observed with simultaneous overexpression of acrAB and norE are specific to this combination, we determined the effect on drug resistance of acrAB in combination with mdfA. The results were similar to that seen with norE (Table 2). pSUP5 mediated similar norfloxacin resistance and slightly lower ciprofloxacin resistance compared with high expression levels of acrAB. pSUP5, in combination with intermediate levels of expression of acrAB, caused a multiplicative increase in drug resistance. pSUP5 in combination with high levels of expression of acrAB did not cause an additional increase in drug resistance.
Similar to NorE, overproduction of MdfA did not affect AcrA levels (Figure 3a, compare lanes 1 and 2 with 5 and 6 and 3b, compare lanes 13 with 79). Like NorE, MdfA does not efflux nalidixic acid or rifampicin or prevent the approximately two-fold increased resistance to nalidixic acid and rifampicin mediated by AcrAB overproduction. These data indicate that the ceiling on drug resistance due to drug efflux is independent of the pumps being overexpressed.
Relative contributions of AcrAB, MdfA and NorE to quinolone resistance
In order to determine the relative contributions of the AcrAB, MdfA and NorE efflux pumps to the intrinsic drug resistance in E. coli, we assembled an isogenic set of strains containing all the various permutations of single, double and triple pump mutants (Table 1). To do this, we first generated a
norE chromosomal mutant. Chromosomal null mutant alleles of mdfA38 and acrAB39 were obtained. Etest strips were used to measure the drug resistance of these strains (Table 3). In agreement with previous findings,33 the removal of the acrAB genes was found to reduce the MICs two- to six-fold of all drugs tested except kanamycin.
|
Compared with the isogenic wild-type strain, the
norE::cam mutant is slightly more susceptible to ciprofloxacin and norfloxacin, but not to any of the other drugs (Table 3). To test whether the small increase in susceptibility is relevant, we used the more precise colony formation assay. The
norE::cam mutant was more susceptible to norfloxacin than the parental strain, with an MIC
85% that of wild-type cells (Figure 4). However, the
norE mutation, when combined with the acrA1 mutation, did not result in increased susceptibility as measured by either the Etest (Table 3) or the colony formation assay compared with acrA1 alone (data not shown).
|
The
mdfA mutant alone was slightly more susceptible to ciprofloxacin, norfloxacin and chloramphenicol than the wild-type strain (Table 3). Although these effects are small, they may be significant because the susceptibility is only observed for those drugs for which mdfA overexpression conferred resistance (Figure 1). The
mdfA
norE double mutant exhibited similar drug susceptibility to the single mutants alone. The acrA1
mdfA double mutant exhibited increased susceptibility compared with the acrA1 single mutant to chloramphenicol. The acrA1
mdfA
norE triple mutant was not more susceptible to the drugs tested compared with the double mutants that contained acrA1 (Table 3). These data indicate that simultaneous deletion of drug pumps does not result in a synergic increase in drug susceptibility, or even, in the case of quinolones, an additive increase. These results stand in contrast with the synergic increase in drug resistance observed with the increased expression of multiple drug pumps. | Discussion |
|---|
|
|
|---|
We carried out overexpression screens for quinolone resistance determinants in E. coli. Two genes that encode drug efflux pumps, mdfA and norE, were identified. Although known to transport quinolones, acrAB was not identified in our screen, perhaps because uncontrolled overexpression of acrAB may be detrimental to the cell. However, in a separate overexpression screen, we identified a transcription factor, sdiA, which up-regulates the acrAB genes.40 There are at least 26 additional predicted efflux pumps in E. coli.41 In a previous study,37 E. coli genes encoding putative efflux pumps were systematically overexpressed and only acrAB, mdfA and norE were able to confer quinolone resistance from their native promoters.34 When overexpressed using a heterologous lactose-inducible promoter, acrEF, acrD, yegO, yjiO and yceL were able to confer quinolone resistance.34
The closest homologue to norE is norM from V. parahaemolyticus. Based upon the high homology, Morita et al.16 previously cloned the norE (ydhE) gene from E. coli. They reported that the overexpression of norE caused resistance to quinolones in an E. coli
acrAB mutant.
Overexpression of any of the quinolone pumps, AcrAB, MdfA or NorE, which belong to three different transporter families, led to a three- to six-fold increase in fluoroquinolone resistance. Increasing the level of AcrAB through the overexpression of the transcriptional regulator, sdiA, resulted in about the same (approximately six-fold) increase in drug resistance.40 The effect of mdfA overexpression, using the IPTG-inducible lac promoter, on quinolone resistance has not been tested previously.42 However, overexpression of mdfA from the IPTG-inducible lac promoter resulted in roughly the same increased level (four-fold42) of chloramphenicol resistance observed in our study (eight-fold, see Figure 1b). Therefore, it seems that there is a maximum level of drug resistance that can be achieved through overexpression of any one efflux pump.
Simultaneous overexpression of acrAB and either mdfA or norE resulted in synergic increases in resistance to the fluoroquinolones. This is consistent with previous results that showed that simultaneous overexpression of an RND-type pump (such as AcrAB) with an MFS-type pump (such as MdfA) gave multiplicative increases in drug resistance.42 Simultaneous overexpression of two inner-membrane pumps (MFS family) did not result in any additional increase in drug resistance.42 Concurrent overproduction of AcrAB and NorE resulted in seven- and 11-fold increased resistance to ciprofloxacin and norfloxacin, respectively, and overproduction of AcrAB and MdfA led to eight- and 11-fold increased resistance (these values are from Figure 4, but normalized for the effect of arabinose on MIC). Thus, as with the resistance levels mediated by each of the pumps individually, the drug resistance mediated by simultaneous overexpression of multiple pumps also appears to be subject to limits, and this limit may be
10-fold. This suggests that there may be limitations in the amount of active pump that can be present at any time in the cell. Alternatively, although the production of the pump proteins is increased, perhaps not all of the resulting protein is folded correctly or inserted properly in the membrane. For example, the increased production of these proteins might saturate the membrane targeting apparatus.
As stated above, the AcrAB pump is thought to utilize the outer membrane channel, TolC. This channel may be limiting in the cell. Thus, the absence of sufficient TolC to activate all the arabinose-induced AcrAB might be a factor for the observed ceiling in drug resistance from increased AcrAB levels (although not for MdfA or NorE). However, AcrAB is probably able to efflux drugs even without TolC.43 Thus, overexpression of AcrAB without a concurrent increase in an outer membrane channel might result in AcrAB behaving like an inner membrane pump that effluxes its substrate into the periplasm instead of directly out of the cell.
As had been stated previously,14,33,43 AcrAB is the most important contributor to intrinsic quinolone resistance under normal circumstances. The acrA1 mutant exhibited a four- to six-fold decrease in the resistance to the fluoroquinolones and to nalidixic acid. The
norE mutant is also more susceptible to the fluoroquinolones, with an
15% decrease in norfloxacin MIC. Cells lacking mdfA are slightly more susceptible to the fluoroquinolones as well. The
norE or
mdfA mutations, in combination with the acrA1 mutation, did not confer additional quinolone susceptibility. It had been found previously that strains lacking several multidrug efflux pumps that are all members of one family rarely exhibit increased drug susceptibility beyond that observed for the major efflux pump mutant (i.e. acrAB for the RND family).43 Our results show that this lack of additive increase in drug susceptibility also holds true for mutant strains lacking efflux pump genes from different families. Thus, despite the similar levels of increased drug resistance conferred by overexpression of each of these pumps, they contribute unequally to the E. coli intrinsic quinolone resistance.
Fluoroquinolone resistance is an important current clinical problem,1,44 and efflux pump-derived resistance is an important component of this issue. Inactivation of the AcrAB efflux pump confers clinical susceptibility to quinolones in an otherwise gyrAr drug-resistant mutant.45 In some instances, it has been reported that increased production of efflux pumps alone can account for clinical resistance.12 Some fluoroquinolones, such as ofloxacin, levofloxacin and sparfloxacin, are not affected by the overproduction of any of the three quinolone pumps (Figure 1a), indicating that these drugs may not be good substrates for the efflux pumps. Resistance to ofloxacin arose in the clinics relatively slowly compared with other fluoroquinolones.2 Thus, it might be useful to test new fluoroquinolones against a panel of quinolone efflux pump mutants and overexpressors to try to find a drug not resisted intrinsically by bacteria.
| Acknowledgements |
|---|
We thank Drs Eitan Bibi, Janet S. Butel, Amy L. Davidson, Timothy Palzkill, Susan M. Rosenberg, Hiroshi Nikaido and Helen I. Zgurskaya for plasmids, strains, antibodies, reagents and advice; Drs Katherine A. Borkovich, Amy L. Davidson, Timothy Palzkill, Helen I. Zgurskaya and members of the laboratory for critically reading the manuscript; and Merry J. Maynard for technical assistance. We are grateful to Dr Karen K. Hirschi for the generous donation of her laboratory space while our laboratory was shut down by Tropical Storm Allison. S.Y. is supported from a National Research Service Award CA 09197 from the National Cancer Institute (USA). E.L.Z. is supported by National Science Foundation (USA) grant MCB0090880, is a New Investigator in the Toxicological Sciences for the Burroughs Welcome Fund and recipient of the Curtis Hankamer Research Award.
| Footnotes |
|---|
* This author has previously published as Sonia Rahmati.
Corresponding author. Tel: +1-713-798-5126; Fax: +1-713-798-7375; E-mail: elz{at}bcm.tmc.edu ![]()
| References |
|---|
|
|
|---|
1 . Binder, S., Levitt, A. M., Sacks, J. J. & Hughes, J. M. (1999). Emerging infectious diseases: public health issues for the 21st century. Science 284, 13113.
2 . Cunha, B. A. (1998). Quinolones: clinical use and formulary considerations. Advances in Therapy 15, 27787.[Web of Science][Medline]
3 . Hooper, D. C. (1998). Clinical applications of quinolones. Biochimica et Biophysica Acta 1400, 4561.[Medline]
4 . Levine, C., Hiasa, H. & Marians, K. J. (1998). DNA gyrase and topoisomerase IV: biochemical activities, physiological roles during chromosome replication, and drug sensitivities. Biochimica et Biophysica Acta 1400, 2943.[Medline]
5
.
Kreuzer, K. N. & Cozzarelli, N. R. (1979). Escherichia coli mutants thermosensitive for deoxyribonucleic acid gyrase subunit A: effects on deoxyribonucleic acid replication, transcription, and bacteriophage growth. Journal of Bacteriology 140, 42435.
6 . Osheroff, N., Corbett, A. H. & Robinson, M. J. (1994). Mechanism of action of topoisomerase II-targeted antineoplastic drugs. Advances in Pharmacology 29B, 10526.[Medline]
7
.
Froelich-Ammon, S. J. & Osheroff, N. (1995). Topoisomerase poisons: harnessing the dark side of enzyme mechanism. Journal of Biological Chemistry 270, 2142932.
8 . Acar, J. F. & Goldstein, F. W. (1997). Trends in bacterial resistance to fluoroquinolones. Clinical Infectious Diseases 24, Suppl. 1, S6773.[Medline]
9
.
Chen, D. K., McGeer, A., de Azavedo, J. C. & Low, D. E. (1999). Decreased susceptibility of Streptococcus pneumoniae to fluoroquinolones in Canada. New England Journal of Medicine 341, 2339.
10 . Hooper, D. C. (2001). Emerging mechanisms of fluoroquinolone resistance. Emerging Infectious Diseases 7, 33741.[Web of Science][Medline]
11 . Piddock, L. J. (1999). Mechanisms of fluoroquinolone resistance: an update 19941998. Drugs 58, 118.
12
.
Giraud, E., Cloeckaert, A., Kerboeuf, D. & Chaslus-Dancla, E. (2000). Evidence for active efflux as the primary mechanism of resistance to ciprofloxacin in Salmonella enterica serovar Typhimurium. Antimicrobial Agents and Chemotherapy 44, 12238.
13 . Paulsen, I. T., Nguyen, L., Sliwinski, M. K., Rabus, R. & Saier, M. H. J. (2000). Microbial genome analyses: comparative transport capabilities in eighteen prokaryotes. Journal of Molecular Biology 301, 75100.[CrossRef][Web of Science][Medline]
14
.
Okusu, H., Ma, D. & Nikaido, H. (1996). AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants. Journal of Bacteriology 178, 3068.
15
.
Edgar, R. & Bibi, E. (1997). MdfA, an Escherichia coli multidrug resistance protein with an extraordinarily broad spectrum of drug recognition. Journal of Bacteriology 179, 227480.
16
.
Morita, Y., Kodama, K., Shiota, S., Mine, T., Kataoka, A., Mizushima, T. et al. (1998). NorM, a putative multidrug efflux protein, of Vibrio parahaemolyticus and its homolog in Escherichia coli. Antimicrobial Agents and Chemotherapy 42, 177882.
17
.
Zgurskaya, H. I. & Nikaido, H. (1999). Bypassing the periplasm: reconstitution of the AcrAB multidrug efflux pump of Escherichia coli. Proceedings of the National Academy of Sciences, USA 96, 71905.
18 . Brown, M. H., Paulsen, I. T. & Skurray, R. A. (1999). The multidrug efflux protein NorM is a prototype of a new family of transporters. Molecular Microbiology 31, 3945.[CrossRef][Web of Science][Medline]
19
.
Khodursky, A. B., Zechiedrich, E. L. & Cozzarelli, N. R. (1995). Topoisomerase IV is a target of quinolones in Escherichia coli. Proceedings of the National Academy of Sciences, USA 92, 118015.
20
.
Guzman, L. M., Belin, D., Carson, M. J. & Beckwith, J. (1995). Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. Journal of Bacteriology 177, 412130.
21
.
Zgurskaya, H. I. & Nikaido, H. (2000). Cross-linked complex between oligomeric periplasmic lipoprotein AcrA and the inner-membrane-associated multidrug efflux pump AcrB from Escherichia coli. Journal of Bacteriology 182, 42647.
22
.
Blattner, F. R., Plunkett, G. R., Bloch, C. A., Perna, N. T., Burland, V., Riley, M. et al. (1997). The complete genome sequence of Escherichia coli K-12. Science 277, 145374.
23 . Eisenstadt, E., Carlton, B. C. & Brown, B. J. (1994). Gene mutation. In Methods for General and Molecular Bacteriology (Gerhardt, P., Murray, R. G. E., Wood, W. A. & Krieg, N. R., Eds), p. 304. American Society for Microbiology, Washington, DC, USA.
24
.
McMurry, L., Petrucci, R. E. J. & Levy, S. B. (1980). Active efflux of tetracycline encoded by four genetically different tetracycline resistance determinants in Escherichia coli. Proceedings of the National Academy of Sciences, USA 77, 39747.
25 . Kaback, H. R., Reeves, J. P., Short, S. A. & Lombardi, F. J. (1974). Mechanisms of active transport in isolated bacterial membrane vesicles. Archives of Biochemistry and Biophysics 160, 21522.[CrossRef][Web of Science][Medline]
26 . Miller, J. H. (1972). Experiments in Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA.
27
.
Zechiedrich, E. L., Khodursky, A. B. & Cozzarelli, N. R. (1997). Topoisomerase IV, not gyrase, decatenates products of site-specific recombination in Escherichia coli. Genes and Development 11, 258092.
28
.
Khodursky, A. B. & Cozzarelli, N. R. (1998). The mechanism of inhibition of topoisomerase IV by quinolone antibacterials. Journal of Biological Chemistry 273, 2766877.
29
.
Heisig, P. (1996). Genetic evidence for a role of parC mutations in development of high-level fluoroquinolone resistance in Escherichia coli. Antimicrobial Agents and Chemotherapy 40, 87985.
30 . Yoshida, H., Kojima, T., Yamagishi, J.-I. & Nakamura, S. (1988). Quinolone-resistant mutations of the gyrA gene of Escherichia coli. Molecular and General Genetics 211, 17.
31 . Clark, L. & Carbon, J. (1976). A colony bank containing synthetic ColE1 hybrid plasmids representative of the entire Escherichia coli genome. Cell 9, 919.[CrossRef][Web of Science][Medline]
32
.
Liu, J., Takiff, H. E. & Nikaido, H. (1996). Active efflux of fluoroquinolones in Mycobacterium smegmatis mediated by LfrA, a multidrug efflux pump. Journal of Bacteriology 178, 37915.
33
.
Nikaido, H. (1996). Multidrug efflux pumps of gram-negative bacteria. Journal of Bacteriology 178, 58539.
34
.
Nishino, K. & Yamaguchi, A. (2001). Analysis of a complete library of putative drug transporter genes in Escherichia coli. Journal of Bacteriology 183, 580312.
35
.
Lynch, A. S. & Wang, J. C. (1993). Anchoring of DNA to the bacterial cytoplasmic membrane through cotranscriptional synthesis of polypeptides encoding membrane proteins or proteins for export: a mechanism of plasmid hypernegative supercoiling in mutants deficient in DNA topoisomerase I. Journal of Bacteriology 175, 164555.
36 . Paulsen, I. T., Brown, M. H. & Skurray, R. A. (1996). Proton-dependent multidrug efflux systems. Microbiology Reviews 60, 575608.
37
.
Morita, Y., Kataoka, A., Shiota, S., Mizushima, T. & Tsuchiya, T. (2000). NorM of Vibrio parahaemolyticus is an Na+-driven multidrug efflux pump. Journal of Bacteriology 182, 66947.
38 . Edgar, R. & Bibi, E. (1999). A single membrane-embedded negative charge is critical for recognizing positively charged drugs by the Escherichia coli multidrug resistance protein MdfA. EMBO Journal 18, 82232.[CrossRef][Web of Science][Medline]
39
.
Thanassi, D. G., Cheng, L. W. & Nikaido, H. (1997). Active efflux of bile salts by Escherichia coli. Journal of Bacteriology 179, 25128.
40 . Rahmati, S., Yang, S., Davidson, A. L. & Zechiedrich, E. L. (2002). Control of the AcrAB multidrug efflux pump by quorum sensing regulator SdiA. Molecular Microbiology 43, 67785.[CrossRef][Web of Science][Medline]
41
.
Saier, M. H. J., Paulsen, I. T., Sliwinski, M. K., Pao, S. S., Skurray, R. A. & Nikaido, H. (1998). Evolutionary origins of multidrug and drug-specific efflux pumps in bacteria. FASEB Journal 12, 26574.
42
.
Lee, A., Mao, W., Warren, M. S., Mistry, A., Hoshino, K., Okumura, R. et al. (2000). Interplay between efflux pumps may provide either additive or multiplicative effects on drug resistance. Journal of Bacteriology 182, 314250.
43
.
Sulavik, M. C., Houseweart, C., Cramer, C., Jiwani, N., Murgolo, N., Greene, J. et al. (2001). Antibiotic susceptibility profiles of Escherichia coli strains lacking multidrug efflux pump genes. Antimicrobial Agents and Chemotherapy 45, 112636.
44 . Hooper, D. C. (2000). New uses for new and old quinolones and the challenge of resistance. Clinical Infectious Diseases 30, 24354.[CrossRef][Web of Science][Medline]
45
.
Oethinger, M., Kern, W. V., Jellen-Ritter, A. S., McMurry, L. M. & Levy, S. B. (2000). Ineffectiveness of topoisomerase mutations in mediating clinically significant fluoroquinolone resistance in Escherichia coli in the absence of the AcrAB efflux pump. Antimicrobial Agents and Chemotherapy 44, 103.
46
.
Kato, J.-I., Nishimura, Y., Yamada, M., Suzuki, H. & Hirota, Y. (1988). Gene organization in the region containing a new gene involved in chromosome partition in Escherichia coli. Journal of Bacteriology 170, 396777.
47
.
Chang, A. C. Y. & Cohen, S. N. (1978). Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the p15A cryptic miniplasmid. Journal of Bacteriology 134, 114156.
48
.
Bolivar, F., Betlach, M. C., Heyneker, H. L., Shine, J., Rodriguez, R. L. & Boyer, H. W. (1977). Origin of replication of pBR345 plasmid DNA. Proceedings of the National Academy of Sciences, USA 74, 52659.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
N. Tal and S. Schuldiner A coordinated network of transporters with overlapping specificities provides a robust survival strategy PNAS, June 2, 2009; 106(22): 9051 - 9056. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Becnel Boyd, M. J. Maynard, S. K. Morgan-Linnell, L. B. Horton, R. Sucgang, R. J. Hamill, J. R. Jimenez, J. Versalovic, D. Steffen, and L. Zechiedrich Relationships among Ciprofloxacin, Gatifloxacin, Levofloxacin, and Norfloxacin MICs for Fluoroquinolone-Resistant Escherichia coli Clinical Isolates Antimicrob. Agents Chemother., January 1, 2009; 53(1): 229 - 234. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Morgan-Linnell, L. Becnel Boyd, D. Steffen, and L. Zechiedrich Mechanisms Accounting for Fluoroquinolone Resistance in Escherichia coli Clinical Isolates Antimicrob. Agents Chemother., January 1, 2009; 53(1): 235 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Long, C. Rouquette-Loughlin, W. M. Shafer, and E. W. Yu Functional Cloning and Characterization of the Multidrug Efflux Pumps NorM from Neisseria gonorrhoeae and YdhE from Escherichia coli Antimicrob. Agents Chemother., September 1, 2008; 52(9): 3052 - 3060. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Zimhony, I. Chmelnitsky, R. Bardenstein, S. Goland, O. Hammer Muntz, S. Navon Venezia, and Y. Carmeli Endocarditis Caused by Extended-Spectrum-{beta}-Lactamase-Producing Klebsiella pneumoniae: Emergence of Resistance to Ciprofloxacin and Piperacillin-Tazobactam during Treatment despite Initial Susceptibility Antimicrob. Agents Chemother., September 1, 2006; 50(9): 3179 - 3182. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Pumbwe, A. Chang, R. L. Smith, and H. M. Wexler Clinical significance of overexpression of multiple RND-family efflux pumps in Bacteroides fragilis isolates J. Antimicrob. Chemother., September 1, 2006; 58(3): 543 - 548. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yang, C. R. Lopez, and E. L. Zechiedrich Quorum sensing and multidrug transporters in Escherichia coli PNAS, February 14, 2006; 103(7): 2386 - 2391. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Poole Efflux-mediated antimicrobial resistance J. Antimicrob. Chemother., July 1, 2005; 56(1): 20 - 51. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Gruger, J. L. Nitiss, A. Maxwell, E. L. Zechiedrich, P. Heisig, S. Seeber, Y. Pommier, and D. Strumberg A Mutation in Escherichia coli DNA Gyrase Conferring Quinolone Resistance Results in Sensitivity to Drugs Targeting Eukaryotic Topoisomerase II Antimicrob. Agents Chemother., December 1, 2004; 48(12): 4495 - 4504. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Eaves, V. Ricci, and L. J. V. Piddock Expression of acrB, acrF, acrD, marA, and soxS in Salmonella enterica Serovar Typhimurium: Role in Multiple Antibiotic Resistance Antimicrob. Agents Chemother., April 1, 2004; 48(4): 1145 - 1150. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Komp Lindgren, A. Karlsson, and D. Hughes Mutation Rate and Evolution of Fluoroquinolone Resistance in Escherichia coli Isolates from Patients with Urinary Tract Infections Antimicrob. Agents Chemother., October 1, 2003; 47(10): 3222 - 3232. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






