Skip Navigation


JAC Advance Access originally published online on November 18, 2002
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
50/6/1059    most recent
dkg006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Drago, L.
Right arrow Articles by Gismondo, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Drago, L.
Right arrow Articles by Gismondo, M. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


Journal of Antimicrobial Chemotherapy (2002) 50, 1059-1063
© 2002 The British Society for Antimicrobial Chemotherapy

Bactericidal activity of levofloxacin, gatifloxacin, penicillin, meropenem and rokitamycin against Bacillus anthracis clinical isolates

Lorenzo Drago*, Elena De Vecchi, Alessandra Lombardi, Lucia Nicola, Marilena Valli and Maria Rita Gismondo

Laboratory of Clinical Microbiology, L. Sacco Teaching Hospital, University of Milan, Via GB Grassi 74, 20157 Milan, Italy

Received 30 May 2002; returned 18 July 2002; revised 17 September 2002; accepted 22 September 2002


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
This study aimed to evaluate the bactericidal rates of levofloxacin, gatifloxacin, penicillin, meropenem and rokitamycin against seven isolates of Bacillus anthracis clinically isolated between 1960 and 1970. After determination of MIC and MBC, time–kill experiments were carried out. Antimicrobial activity was evaluated at concentrations equal to 1 x, 2 x, 4 x and 8 x MIC after 0, 3, 6, 12 and 24 h of incubation with the drugs. Bactericidal activity was defined as a decrease in bacterial count of at least 3 log10. All the isolates were susceptible to all the antibiotics, by considering the antistaphylococcal breakpoints. Levofloxacin was bactericidal at 1 x MIC after 24 h and at 4 x MIC after 12 h, and gatifloxacin was bactericidal at 2 x MIC after 24 h and at 8 x MIC after 12 h. Meropenem, rokitamycin and penicillin also showed bactericidal activity at concentrations of 4 x and 8 x MIC, respectively, but only after 24 h incubation; after the same time, meropenem and rokitamycin showed a more marked killing than penicillin at 2 x MIC.

Keywords: Bacillus anthracis, anthrax, fluoroquinolones, penicillin, meropenem, rokitamycin, macrolides, in vitro susceptibility testing


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bacillus anthracis, the aetiological agent of anthrax, has gained new attention due to its recent use as an agent of biological warfare. B. anthracis is a rod-shaped Gram-positive bacterium. In humans, three forms of anthrax may occur. Cutaneous anthrax is the most common form, accounting for >95% of reported cases,1 and it is due to introduction of spores into the skin. In the past, cutaneous anthrax was considered as an occupational disease, since it naturally follows exposure to infected animals.2 Although self-limiting and fatal only if infection becomes systemic, antibiotic treatment is recommended.

Pharyngeal and gastrointestinal anthrax follow ingestion of insufficiently cooked contaminated meat. Oropharyngeal anthrax is less common than the gastrointestinal form, and generally has a more favourable prognosis, whereas the gastrointestinal form may result in high mortality due to intestinal perforation or anthrax toxaemia.3

Inhalational anthrax was, until recently, a disease mainly of historical interest, with sporadic cases in persons in close contact with animals. It is contracted from breathing airborne anthrax spores and, as evidenced by the Sverdlovsk experience, is often fatal.4

Given the rapid course of symptomatic inhalational anthrax, early and appropriate antibiotic administration is essential for successful treatment of anthrax. Doxycycline and ciprofloxacin are the drugs of choice for the therapy of anthrax.5,6 Penicillins represent an alternative for antimicrobial prophylaxis for children and pregnant women and for complete treatment of cutaneous disease caused by penicillin-susceptible B. anthracis.1

Recently, in vitro development of resistance to some antimicrobial agents after serial passages has been reported for B. anthracis Sterne.7 This study suggested that serial subculturing using quinolones and macrolides led to selection of a subpopulation of bacteria with increasing MICs. This feature is particularly alarming because, in the last cases of exposure to anthrax spores, ciprofloxacin was chosen for post-exposure prophylaxis, and macrolides could represent potential alternative drugs.

A main concern in selecting anthrax therapy is the limited availability of clinical data on B. anthracis susceptibility to antimicrobials. In addition, the in vitro studies on susceptibility have been carried out by determination of MICs.

Time–kill methods represent a useful method for evaluating the kinetic interactions between bacteria and antimicrobial agents. Moreover, they generally appear to be more sensitive than MIC–MBC methods for evaluating antimicrobial activity.8

Therefore, for a preliminary evaluation and comparison of antimicrobial compounds to be used as an alternative to the recommended primary therapeutic agents for treatment and prophylaxis of anthrax, knowledge of bactericidal activity may be useful. To the best of our knowledge, the killing rate of antimicrobials against this microorganism has never been studied.

Therefore, we planned to compare the killing kinetics of levofloxacin, gatifloxacin, rokitamycin and meropenem, possessing potential in vitro activity against B. anthracis, with that of penicillin G, which is one of the drugs proposed for anthrax treatment.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Microorganisms

Seven human isolates of B. anthracis clinically isolated in the period 1960–1970 from pharmaceutical company collections were used for the study. Confirmation of identification was obtained by means of real-time PCR, carried out on the Light Cycler PCR System (Roche Diagnostic Co., Monza, Italy), amplifying a portion of the rpoB gene.9 The primers were rpoBF1a (CCACCAACAGTAGAAAATGCC) and rpoBR1a (AAATTTCACCAGTTTCTGGATCT).

The amplification programme comprised an initial denaturation at 95°C for 120 s, followed by 55 cycles of 95°C for 3 s, 63°C for 10 s and 72°C for 10 s. Detection was accomplished by hybridization of a pair of probes (BaP1, TCCAAAGCGCTATGATTTAGCAAATGT-F; and BaP2, Cy5-GGTCGCTACAAGATCAACAAGTTACAC-P) to the amplicons as they were formed.

Drugs

Gatifloxacin (Grunenthal-Formenti, Milan, Italy), levofloxacin (Glaxo Smith Kline SpA, Verona, Italy), penicillin G (Sigma Chemical, St Louis, MO, USA), rokitamycin (Grunenthal-Formenti) and meropenem (AstraZeneca, Milan, Italy) were tested. Stock solutions (1.28 mg/mL) of gatifloxacin, meropenem and penicillin were prepared in sterile water, rokitamycin (5.12 mg/mL) was prepared in ethanol and levofloxacin (1.28 mg/mL) in 0.1 M NaOH and water (50:50, v/v).10 Working solutions of the drugs were obtained by diluting stocks with Mueller–Hinton broth.

Determination of MIC and MBC

Determinations of MIC by means of microdilution broth method and MBC were carried out as follows: an adjusted inoculum of the tested organisms (10 µL) in the stationary phase of growth was added to 0.1 mL of Mueller–Hinton broth containing two-fold serial dilutions of a starting antibiotic solution, so that each well contained ~1–5 x 105 cfu/mL. The inocula were verified by plating 0.1 mL of the microbial suspension after serial 10-fold dilutions (from 10–1 to 10–3) on to Columbia agar plates; when bacterial counts fell below this limit, MIC determinations were repeated. Results were observed after 18 h of incubation at 35°C, and MIC was defined as the lowest concentration able to inhibit visible growth. MBCs were determined by spotting 10 µL in duplicate from the wells showing no visible growth on Columbia blood agar plates and incubating them for 18–24 h. MBC was taken as the concentration at which a 99.9% reduction in cfu of the original inoculum occurred. As used by other authors,11,12 the NCCLS staphylococcal breakpoints were used for determining susceptibility to levofloxacin (<=2 mg/L), gatifloxacin (<=2 mg/L), meropenem (<=4 mg/L) and penicillin (<=0.12 mg/L),10 whereas a breakpoint of <=1 mg/L was used for rokitamycin.

Time–kill experiments

Each strain was grown overnight in Mueller–Hinton broth (37°C, aerobic atmosphere). Sterile drug solutions (0.1 mL) were added to 9.9 mL of the broth cultures (105–106 cfu/mL), to give final drug concentrations equivalent to 1 x, 2 x, 4 x and 8 x MIC. Antibiotic-free growth controls were also included. Tubes were incubated aerobically at 37°C under continuous agitation. Viable counts were carried out in duplicate 0, 3, 6, 12 and 24 h after addition of antimicrobial agents, by spreading 0.1 mL on Columbia blood agar plates, after washing by centrifugation (1500g, 10 min at 4°C) to avoid antibiotic carry-over and serial 10-fold dilution in phosphate-buffered saline (pH 7.3). Colonies were counted after 24 h incubation in an aerobic atmosphere at 37°C.

The limit of count detection was 200 cfu/mL. The killing rate was determined by plotting the total number of viable cells (mean of cfu) as log10 cfu/mL against time. Bactericidal activity was defined as a 3 log10 decrease in cfu/mL (99.9% kill). Bacteriostatic activity was defined as <99.9% kill.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Susceptibilities of B. anthracis isolates to the chosen antimicrobials are shown in Table 1.


View this table:
[in this window]
[in a new window]
 
Table 1..  Antimicrobial susceptibility of the seven strains of B. anthracis
 
By considering the above-mentioned breakpoints, all the isolates were highly susceptible to the test antimicrobials. For gatifloxacin, MICs and MBCs ranged from 0.016 to 0.06 mg/L and MBCs corresponded to the MIC values for all the isolates. Levofloxacin showed an MIC range from 0.03 to 0.125 mg/L and MBCs were equal to MICs, with the exception of two strains, for which the MBCs of levofloxacin were twice the respective MICs. MICs and MBCs of meropenem and penicillin G were in the range 0.004–0.016 mg/L, with MBCs being equal to MICs for all the isolates but two, which had MBC values twice the MIC of meropenem. MICs of rokitamycin corresponded to MBCs and ranged from 0.125 to 0.5 mg/L.

Bactericidal activity, as defined by a 3 log10 reduction in viable count, occurred after 12 h exposure to levofloxacin at 4 x MIC (and above) and gatifloxacin or meropenem at 8 x MIC. Penicillin G (at 8 x MIC) or rokitamycin (at 4 x MIC and above) was bactericidal only after 24 h incubation. A 2 log10 reduction in viable count was observed after 6 h with levofloxacin at 2 x MIC (and above) and gatifloxacin at 8 x MIC. Generally, little or no kill was observed after only 3 h incubation for all the antibiotics tested (Figure 1a–e).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 1. Time–kill curve for B. anthracis. (a) gatifloxacin; (b) levofloxacin; (c) meropenem; (d) penicillin; (e) rokitamycin. Data points are shown as means ± S.D. of the seven strains considered. Filled diamond, 1 x MIC; filled square, 2 x MIC; filled triangle, 4 x MIC; open circle, 8 x MIC; filled circle, control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Although the knowledge of susceptibility of B. anthracis to antimicrobials represents an important issue for evaluating resistance, standardized methods of testing and interpretative criteria are not available. Papers evaluating B. anthracis susceptibility to different antibiotics have outlined the occurrence of resistance to penicillin and production of ß-lactamases.1113

The isolates investigated here have probably never encountered the test antimicrobials because of their ‘clinical history’, with the probable exception of penicillin G. All the isolates were susceptible to the drugs tested, with MICs and MBCs within a narrow range. Other authors have investigated the MIC of penicillin, levofloxacin and gatifloxacin for B. anthracis.11,13 The MIC data presented here are lower than those reported by these authors for penicillin G, but they are within the reported ranges for gatifloxacin and levofloxacin.

This study showed that, although all the strains tested were susceptible to the chosen antimicrobials, the killing rate was different among the antibiotics under evaluation.

The data suggest that the fluoroquinolones tested could represent a valid choice for anthrax therapy. Levofloxacin was bactericidal, killing 99.9% of the initial inoculum within 12 h at concentrations 4 x MIC and gatifloxacin required concentrations 8 x MIC to be bactericidal within 12 h, although killing activity was also present after 24 h at lower concentrations. Although considered for many years the antibiotic of choice for therapy of all forms of anthrax,1 penicillin G bactericidal activity was the weakest among the antimicrobials tested, particularly at low concentrations, whereas a better bactericidal activity was shown by meropenem.

Rokitamycin showed a slow killing rate and furthermore was interesting in that similar levels of bactericidal activity occurred at 1 x, 2 x, 4 x or 8 x MIC.

Data obtained in this study of the killing rate could contribute to the choice of candidate antibiotics as alternatives in anthrax therapy. In fact, in the case of inhalation of B. anthracis spores, vegetative cells are initially involved in the progress of infection and a rapid killing by antibiotics of the vegetative forms would avoid bacterial dissemination and toxin production. The fluoroquinolones were particularly bactericidal and their known potency against other non-dividing bacteria (which may also be true against B. anthracis) could also be important.

In conclusion, in vitro results indicate that all the drugs tested may represent valid alternatives in the treatment of B. anthracis infections, although with different killing rates, even if more data have to be collected for a future in vivo study.


    Acknowledgements
 
This work was partially supported by AstraZeneca, Aventis Pharma, GlaxoSmithKline and Grunenthal-Formenti.


    Footnotes
 
* Corresponding author. Tel: +39-02-3904-2589; Fax: +39-02-5031-9651; E-mail: microbio{at}mailserver.unimi.it Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1 . Dixon, T. C., Meselson, M., Guillemin, J. & Hanna, P. C. (1999). Anthrax. New England Journal of Medicine 341, 815–26.[Free Full Text]

2 . Pienaar, U. V. (1967). Epidemiology of anthrax in wild animals and the control on anthrax epizootics in the Kruger National Park, South Africa. Federal Proceedings 26, 1496–591.

3 . Inglesby, T. V., Henderson, D. A., Bartlett, J. G., Ascher, M. S., Eitzen, E., Friedlander, A. M. et al. (1999). Anthrax as a biological weapon. Medical and public health management. Journal of the American Medical Association 281, 1735–45.[Abstract/Free Full Text]

4 . Meselson, M., Guillemin, J., Hugh-Jones, M., Langmuir, A., Popova, I., Shelokov, A. et al. (1994). The Sverdlovsk anthrax outbreak of 1979. Science 266, 1202–8.[Abstract/Free Full Text]

5 . Centers for Disease Control and Prevention. (2001). Update: interim recommendations for antimicrobial prophylaxis for children and breastfeeding mothers and treatment of children with anthrax. Morbidity and Mortality Weekly Report 50, 1014–6.

6 . Shafazand, S., Doyle, R., Ruoss, S., Weinacker, A. & Raffin, T. (1999). Inhalational anthrax. Epidemiology, diagnosis and management. Chest 116, 1369–76.[Abstract/Free Full Text]

7 . Brook, I., Elliott, T. B., Pryor, H. I., II, Sautter, T. E., Gnade, B. T., Thakar, J. H. et al. (2001). In vitro resistance of Bacillus anthracis Sterne to doxycycline, macrolides and quinolones. International Journal of Antimicrobial Agents 18, 559–62.[ISI][Medline]

8 . Stratton, C. W. & Cooksey, R. C. (1991). Susceptibility tests: special tests. In Manual of Clinical Microbiology, 5th edn (Balows, A., Hausler, W. J., Jr, Herrmann, K. L., Isenberg, H. D. & Shadomy, H. J., Eds), pp. 1153–65. American Society for Microbiology, Washington, DC, USA.

9 . Qi, Y., Patra, G., Liang, X., Williams, L., Rose, S., Redkar, R. J. & Del Vecchio, V. G. (2001). Utilization of the rpoB gene as a specific chromosomal marker for real time PCR detection of Bacillus anthracis. Applied Environmental Microbiology 67, 3720–7.[Abstract/Free Full Text]

10 . National Committee for Clinical Laboratory Standards. (2001). Performance Standards for Antimicrobial Susceptibility Testing—Eleventh Informational Supplement M100-S11. NCCLS, Villanova, PA, USA.

11 . Mohammed, J., Marston, C. K., Popovic, T., Weyant, R. S. & Tenover, F. C. (2002). Antimicrobial susceptibility testing of Bacillus anthracis: comparison of results obtained by using the National Committee for Clinical Laboratory Standards broth microdilution reference and Etest agar gradient diffusion methods. Journal of Clinical Microbiology 40, 1902–7.[Abstract/Free Full Text]

12 . Cavallo, J. D., Ramisse, F., Girardet, M., Vaissaire, J., Mock, M. & Hernandez, E. (2002). Antibiotic susceptibilities of 96 isolates of Bacillus anthracis isolated in France between 1994 and 2000. Antimicrobial Agents and Chemotherapy 46, 2307–9.[Abstract/Free Full Text]

13 . Doganay, M. & Aydin, N. (1991). Antimicrobial susceptibility of Bacillus anthracis. Scandinavian Journal of Infectious Diseases 23, 333–5.[ISI][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Antimicrob ChemotherHome page
V. A. Luna, D. S. King, J. Gulledge, A. C. Cannons, P. T. Amuso, and J. Cattani
Susceptibility of Bacillus anthracis, Bacillus cereus, Bacillus mycoides, Bacillus pseudomycoides and Bacillus thuringiensis to 24 antimicrobials using Sensititre(R) automated microbroth dilution and Etest(R) agar gradient diffusion methods
J. Antimicrob. Chemother., September 1, 2007; 60(3): 555 - 567.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
J. Steward, M. S. Lever, A. J. H. Simpson, A. M. Sefton, and T. J. G. Brooks
Post-exposure prophylaxis of systemic anthrax in mice and treatment with fluoroquinolones
J. Antimicrob. Chemother., July 1, 2004; 54(1): 95 - 99.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
A. Athamna, M. Massalha, M. Athamna, A. Nura, B. Medlej, I. Ofek, D. Bast, and E. Rubinstein
In vitro susceptibility of Bacillus anthracis to various antibacterial agents and their time-kill activity
J. Antimicrob. Chemother., February 1, 2004; 53(2): 247 - 251.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
50/6/1059    most recent
dkg006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Drago, L.
Right arrow Articles by Gismondo, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Drago, L.
Right arrow Articles by Gismondo, M. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?