JAC Advance Access originally published online on October 8, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Antimicrobial Chemotherapy (2002) 50, 673-679
© 2002 The British Society for Antimicrobial Chemotherapy
Molecular characterization of SPM-1, a novel metallo-ß-lactamase isolated in Latin America: report from the SENTRY antimicrobial surveillance programme
1 Department of Pathology and Microbiology, University of Bristol, Bristol BS8 1TD, UK; 2 Division of Infectious Diseases, Universidade Federal de Sao Paulo, Sao Paulo, Brazil; 3 The JONES Group/JMI Laboratories, North Liberty, IA; 4 Tufts University School of Medicine, Boston, MA, USA
Received 5 July 2002; returned 26 July 2002; revised 20 August 2002; accepted 20 August 2002
| Abstract |
|---|
|
|
|---|
The gene encoding the metallo-ß-lactamase SPM-1 was cloned from a genomic library of Pseudomonas aeruginosa strain 48-1997A. The insert carrying spm-1 possessed a GC content of 47%, indicating that it is of non-Pseudomonas origin. Upstream of spm-1 there is a small open reading frame (ORF), which is homologous to the LysR family of proteins (69% identity to the LysR protein from Salmonella enterica serovar Typhimurium). Downstream of spm-1 there is the start of an ORF, the product of which shows close homology with the GroEL-type proteins from Xanthomonas campestris. No transmissible element could be identified upstream or downstream of spm-1. The spm-1 gene is carried on a plasmid that can transform both Escherichia coli and P. aeruginosa to ceftazidime resistance. SPM-1 contains the classic metallo-ß-lactamase zinc-binding motif HXHXD and shows the highest identity (35.5%) to IMP-1. SPM-1 is a distinctly different metallo-ß-lactamase from VIM and IMP and, accordingly, represents a new subfamily of mobile metallo-ß-lactamases. The predicted molecular weight of the protein was 27 515 Da, significantly higher than that of IMP (25 041 Da) or VIM (25 322 Da). SPM-1 possesses a unique loop of 23 residues that accounts for the higher molecular mass.
Keywords: metallo-ß-lactamase, SENTRY, Pseudomonas aeruginosa
| Introduction |
|---|
|
|
|---|
The advent of carbapenems into clinical practice heralded a new treatment option for irradicating serious bacterial infections caused by cephalosporin- and pencillin-resistant bacteria.1 However, carbapenem resistance has now been observed in Enterobacteriaceae and in non-fermenter species such as Pseudomonas aeruginosa and Acinetobacter spp. The common form of resistance is through either lack of drug penetration (i.e. porin mutations and efflux pumps) and/or carbapenem-hydrolysing ß-lactamases. Based on molecular studies, two classes of carbapenem-hydrolysing enzymes have been described: serine enzymes possessing a serine moiety at the active site; and metallo-ß-lactamases (class B), requiring divalent cations, usually zinc, as metal cofactors for enzyme activity.2,3
In 1991, a report of a new plasmid-mediated metallo-ß-lactamase, IMP-1, in a P. aeruginosa isolate caused great concern due to the potential risk of IMP being disseminated widely to other bacterial species.4 A 19961997 survey of IMP-1-producing Gram-negative bacteria in Japan showed that 144 of 3222 (4.4%) Serratia marcescens strains produced IMP-1 through the acquisition of plasmids carrying the imp gene.5 For many years, the detection of IMP-1-producing isolates was restricted to Japan, but recently the appearance of other IMP-type enzymes has been reported throughout South-East Asia, including Hong Kong and Singapore.6,7 An imp allelic variant, which encodes IMP-2, was detected in an Acinetobacter baumannii strain isolated in Italy, the first European example.8 A novel family of class B metallo-ß-lactamases, the VIM family (VIM-1, VIM-2 and VIM-3 enzymes), was described in P. aeruginosa and Acinetobacter spp. in Europe.911 The vim gene, like the imp gene, is carried on mobile gene cassettes inserted into a class 1 integron. The class 1 integrons are the most common way in which resistant gene cassettes are able to move from one bacterium to another and involve recombination sites, known as 59 bp elements.12 Although an IMP variant has been reported from Canada, to date there are no reports of mobile metallo-ß-lactamases being reported from the USA or Latin America.13
In 1999, a 4-year-old female patient was diagnosed with acute lymphoblastic leukaemia and was subsequently admitted to hospital in January 2001 (she also suffered a relapse in November 2000) after her third cycle of chemotherapy at the Instituto de Oncology Pediatricia (Sao Paulo, Brazil). She became neutropenic and presented with episodes of high fever. She was initially treated with ceftriaxone (50 mg/kg/day) and amikacin (15 mg/kg/day) for an ethmoid sinus infection. In early February she had a consolidation of the lower right lobe, and ceftriaxone was replaced by ceftazidime (50 mg/kg/day) for the treatment of suspected pneumonia. Later that month, a urine culture showed a pure growth (>105 cfu/mL) of a P. aeruginosa (designated 48-1997A) susceptible only to polymyxin B, and ceftazidime was replaced by polymyxin B. Five days later, an identical P. aeruginosa isolate exhibiting the same antimicrobial susceptibility profile was isolated from a blood culture. The patient died the following day due to septic shock. As part of the SENTRY programme screening protocol of multidrug-resistant P. aeruginosa strains worldwide, this isolate was tested with the Etest metallo-ß-lactamase strip and, on giving a positive phenotype, was evaluated further.14 Here, we report the molecular characterization of a mobile metallo-ß-lactamase in P. aeruginosa from South America as part of the SENTRY antimicrobial surveillance programme.
| Materials and methods |
|---|
|
|
|---|
Bacterial strains/plasmids
P. aeruginosa 48-1997A was a clinical isolate from Sao Paulo as described above. Escherichia coli strain DH5
[supE44
lacU169 (F80lacZ
M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1] was used as the host strain for expressing the cloned ß-lactamase gene. Positive controls for the IMP- and VIM-type metallo-ß-lactamases were P. aeruginosa strains carrying the respective genes. The genomic library was generated in the cloning vector pK18 as described previously.15,16
Determination of MICs
Mid-log phase grown cultures were diluted to 104 in water. Ten microlitres from each dilution was spotted on to dried nutrient Iso-Sensitest agar, containing serial dilutions of the appropriate antibiotic, using a multipoint inoculator. After 24 h incubation at 37°C, the MIC was determined as the lowest concentration of antibiotic that inhibited the growth in those dilutions that, when inoculated on to nutrient agar containing no antibiotic, gave rise to single colonies.
Metallo-ß-lactamase expression in P. aeruginosa 48-1997A and from recombinant DNA in E. coli
Cellular extracts of P. aeruginosa 48-1997A pre-incubated with EDTA (20 mM) or a serine ß-lactamase inhibitor (BRL42715 at 5 µM) had hydrolytic activity determined for cloxacillin, oxacillin, penicillin, ampicillin, imipenem, meropenem, cefaloridine, ceftazidime and nitrocefin. The assays were carried out as described previously by measuring the breakdown of the substrate at a specific wavelength for that ß-lactam, except for nitrocefin, where the accumulation of product was measured at 482 nm.17 Specific activity was measured as nanomoles of substrate hydrolysed/min/mg of protein.
Isoelectric focusing
Isoelectric focusing (IEF) was carried out as described previously.17 ß-Lactamases from P. aeruginosa 48-1997A and recombinant clones expressed in E. coli were visualized by staining the IEF gels with 100 µM nitrocefin. Confirmation of the metallo-ß-lactamase pI value was performed by pre-incubating the crude cell extract with either 20 mM EDTA or 5 µM BRL42715 and repeating the IEF.
PCR screening for vim and imp metallo-ß-lactamase genes
For amplification using primers based on the conserved regions of the imp and vim genes, PCR analysis was carried out using AB-gene Expand Hi-fidelity master mix containing a mix of Pfu/non-proofreading Taq polymerases and dNTPs. Primers were used at 10 pM concentrations, and 1 µL of bacterial culture (OD600 = 1) was used as a template. Cycling parameters were 95°C for 5 min followed by 30 cycles of 95°C for 1 min, annealing at 40°C for 1 min and extension 68°C for 1 min and ending with a 5 min incubation at 68°C. PCR products were visualized by electrophoresis on 0.8% agarose gels in Tris boric acid/EDTA buffer (pH 7.0) and stained with 1% ethidium bromide. The following primers were used for vim and imp PCR screening (reading 5'3') and were based on consensus sequences for each of the genes.4,6,810 The sequences are as follows: vim forward, GTCTATTTGACCGCGTC; vim reverse, CTACTCAACGACTGAGCG; imp forward, ATGAGCAAGTTATCTGTATTC; and imp reverse, GTCGCAACGACTGTGTAG.
Recombinant DNA methodology
Genomic DNA was isolated from P. aeruginosa strain 48-1997A by the cetryl-tri-ammonium bromide method.16 Plasmids were purified by the alkaline lysis method using the Qiagen miniprep kit. For construction of the genomic library, size fractionated Sau3AI fragments (>1 kb) were purified after gel electrophoresis using a Qiagen gel purification kit. Five micrograms of purified genomic fragments were ligated to 1 µg of pK18 that had previously been linearized and dephosphorylated using BamHI and calf intestinal alkaline phophorylase, respectively. The ligation mixture was subsequently dialysed and used to transform E. coli DH5
by electroporation using a Bio-Rad Gene Pulser. Plating of the library on to X-gal (30 mg/L) and kanamycin (25 mg/L) plates yielded in excess of 500 000 recombinants per 500 ng of recombinant DNA.
DNA sequencing and sequence analysis
Sequencing was carried out on both strands by the dideoxy-chain termination method with a Perkin Elmer Biosystems 377 DNA sequencer. Sequence analysis was carried out using the Lasergene DNASTAR software package. Sequence alignments were done using Clustal W and PAM 250 matrix. The pI value of the protein was determined using DNAstar protean. Phylogenetic tree analysis was obtained using DNASTAR. The length of each pair of branches represents the distance between sequence pairs. The scale beneath the tree measures the distance between sequences (DNASTAR, London, UK).
| Results |
|---|
|
|
|---|
Phenotypic expression of a metallo-ß-lactamase from P. aeruginosa 48-1997A
P. aeruginosa strain 48-1997A was resistant to all ß-lactams except for aztreonam, which had an MIC of 4 mg/L. More often than not, the level of resistance was very high (>256 mg/L). Hydrolytic activities of cellular extracts pre-incubated with and without BRL42715 are shown in Table 1. The addition of EDTA and BRL42715 to cellular extracts inhibited the hydrolysis of meropenem by 93% and 1.4%, respectively. These data indicate that isolate 48-1997A possesses a broad-spectrum metallo-ß-lactamase displaying penicillinase, cephalosporinase and carbapenemase activities.
|
IEF counterstained with nitrocefin was used to determine the pI value of strain 48-1997A enzymes. This index strain possessed two enzymes: a serine enzyme (pI, 6.9) inhibited by BRL42715; and a second enzyme (pI, 7.5) that is sensitive to EDTA and resistant to BRL42715 inhibition.
Screening for known mobile metallo-ß-lactamase genes
To determine whether this strain was an imp or vim derivative, primers based on conserved regions (aligning the sequences of vim 13 and imp 19) of these genes were used in a low stringent PCR screen (annealing at 40°C). Positive controls were P. aeruginosa containing imp or vim. Screening with primers based on imp and vim conserved regions was negative, whereas the imp and vim controls were positive, implying that the metallo-ß-lactamases gene from P. aeruginosa 48-1997A was not a close derivative of imp or vim.
Cloning of the metallo-ß-lactamase gene spm-1 from P. aeruginosa 48-1997A
The gene encoding the metallo-ß-lactamase was isolated from a genomic library of P. aeruginosa strain 48-1997A constructed in the plasmid vector pK18 and transformed into the E. coli host DH5
by screening on nutrient agar plates containing ceftazidime (6 mg/L) and kanamycin (25 mg/L). Twelve colonies were isolated, and subsequent analysis determined ceftazidime MICs in excess of 128 mg/L. In the presence of EDTA (10 mM), the ceftazidime MICs dropped to <4 mg/L. Restriction analysis of the plasmids contained in each colony gave insert sizes ranging from 2 to 7 kb. One clone, 24-S, containing an insert of 2.2 kb, was further analysed by sequencing. The gene encoding the enzyme mediating ceftazidime resistance was designated spm-1 (Sao Paulo metallo-ß-lactamase).
Biochemical analysis of recombinant SPM-1
Cellular extracts from E. coli 24-S (expressing SPM-1) are shown in Table 1. These values, when compared with the crude cell extracts from strain 48-1997A [in the presence of BRL42715 (5 µM)], show almost identical ratios of hydrolysis for the different ß-lactams, indicating that the enzyme expressed from the cloned gene is responsible for the activity seen in strain 48-1997A when pre-incubated with BRL42715 (inhibiting serine ß-lactamase activity). The pI value of SPM-1 expressed in E. coli was 7.5 (data not shown), confirming the IEF analysis from the crude cell extracts on P. aeruginosa 48-1997A.
Sequence analysis of spm-1 and its genetic context
The DNA insert carried by 24-S possessed a GC content of 47%, indicating that it is of non-Pseudomonas origin, which in comparison is
66% (http://www.sanger.ac.uk/Projects/P_fluorescens/). 24-S contained an open reading frame (ORF) encoding a putative protein of 264 amino acids displaying homology with previously cloned metallo-ß-lactamases: namely, IMP-type proteins. The sequence of spm-1 has been deposited in the EMBL database with the accession number AJ492820. The N-terminus of the predicted protein shows typical features of bacterial signal peptides: namely, a hydrophobic portion of
13 amino acids, preceded by five highly charged molecules that target protein secretion to the periplasm. Sequencing of the N-terminus of the mature protein identified the cleavage site of the signal peptide between serines 18 and 19. The predicted molecular weight of the protein was 27 515 Da, which is significantly higher than that of IMP (25 041 Da) or VIM (25 322 Da).8,18 The theoretical pI value of SPM-1 (not including the leader sequence) is calculated to be 8.91, which is significantly different from the actual value of 7.5 measured by IEF. This phenomenon has been reported for other ß-lactamases.17
Upstream of spm-1 there is a small ORF, designated ORF2, which is homologous to the LysR family of proteins (69% identity to the LysR protein from Salmonella enterica serovar Typhimurium) (Figure 1). The spacing between the ORFs is 150 bp. ORF2 is predicted to be transcribed in the opposite direction from that of spm-1; however, the protein appears to be truncated and therefore non-functional. Downstream of spm-1 there is the start of an ORF, designated ORF3. ORF3 is predicted to be transcribed in the same direction as spm-1, the product of which shows close homology with the GroEL-type proteins from Xanthomonas campestris and S. enterica with 73% and 65% identity, respectively.19 Within the cloned insert, no sequence showing any degree of homology with integrons was found. The insert carried by 24-S was confirmed by PCR to be that of strain 48-1997A.
|
Alignment and homology with other class B enzymes
The protein sequence of SPM-1 contains the metallo-ß-lactamase zinc-binding motif HFHLD, as well as other residues that have been implicated in binding two zinc ions (Figure 2). The mature protein of SPM-1 showed the highest identities to the following metallo-ß-lactamases: 35.5% to IMP-1, 32.2% to ImiS, 32.1% to CphA, 30% to BCII and 27% to CcrA.2024 When aligned with the other class B ß-lactamases, SPM-1, similarly to the Aeromonas metallo-ß-lactamases and L1 from Stenotrophomonas maltophilia, has a loop that is not present in the other class B enzymes (Figure 2).21,26 In SPM-1 this loop comprises 23 amino acids, whereas in the Aeromonas spp. class B enzymes and L1 it is 17 and 10 amino acids, respectively. Although the highest identity is seen with IMP-1, SPM-1 shares more identity with the C-terminus of IMP-1 than with the N-terminus. From the N-terminus to the start of (but not including) the loop, SPM-1 exhibits 31% identity to IMP-1, whereas, from (but not including) the loop to the C-terminus, SPM-1 exhibits 47% identity to IMP-1.4 As judged by the sequence homology alone, SPM-1 should be classified with the group 3a ß-lactamases.
|
The phylogenetic tree (Figure 3) shows SPM-1 aligning with the IMP-type class B enzymes rather than with the others. However, the clustal weighting clearly shows that SPM-1 is different and only distantly related to the IMP-type enzymes. Although the next highest identity was seen with the Aeromonas spp. class B enzymes ImiS and CphA,21,22 the phylogenetics indicate that SPM-1 is distantly related to these enzymes.
|
| Discussion |
|---|
|
|
|---|
E. coli carrying recombinant clones of spm-1 could be selected for on media containing ceftazidime at high concentrations. However, like vim and imp, spm-1 when expressed in E. coli does not confer resistance to the carbapenems (imipenem and meropenem MICs of 1 and 0.25 mg/L, respectively) or aztreonam (1 mg/L) but does confer resistance to the penicillins and all cephalosporins.
Given the low GC content (47%) of the insert carrying spm-1, there is little doubt that the gene has been imported into Pseudomonas, despite the fact that attempts to mate it across into either an E. coli or Pseudomonas recipient failed (data not shown). However, we have determined that spm-1 is present on a large plasmid and that this can be used to transform both E. coli and P. aeruginosa to ceftazidime resistance. Both vim- and imp-type genes have been shown to be associated with class 1 type integrons. However, immediately upstream or downstream of spm-1 there were no sequences homologous with transmissible elements. One hundred and fifty base pairs upstream of spm-1 there is a gene encoding a LysR-type protein. The gene context of spm-1 is similar to the qac/LysR locus associated with the ß-lactamase PSE-1 on a multidrug-resistance island found in S. enterica serovar Typhimurium DT104 (Figure 1).19
Sequence analysis of SPM-1 shows it to be most similar to IMP-1 but that it contains a loop of 23 residues that explains the higher molecular mass. Interestingly, SPM-1 shows more homology for IMP-1 towards the C-terminus of the protein than to the N-terminus, and this demarcation seems to occur immediately before and after the loop. Although it is mere speculation, it is interesting to raise the possibility that SPM-1 could be a hybrid protein of two ancestral class B type enzymes, one being more IMP-1-like than the other. The alignment of SPM-1 with the other class B enzymes clearly shows that SPM-1 contains the classic HXHXD motif as well as key histidine (positions 165 and 221) and cysteine (position 184) residues that are capable of coordinating two zinc molecules per molecule of enzyme.
The data indicate that spm-1 is a novel metallo-ß-lactamase gene that is significantly different from the IMP or VIM groups of enzymes. Although we could not identify any transmissible element adjacent to spm-1, the gene is likely to be mobile. Crude enzyme kinetics indicate that SPM-1 can hydrolyse all classes of ß-lactam antibiotics. Rather like IMP and VIM, SPM-1 poses a significant threat to metallo-ß-lactam regimens that may be used to treat systemic infections, notwithstanding the fact that there is no clinically available metallo-ß-lactamase inhibitor.
| Acknowledgements |
|---|
We would like to thank J. Kirby, K. Gordon and P. Rhomberg for technical support in the screening process. We would also like to thank the Medical Research Council for supporting T. A. M. and the Biotechnology and Biological Sciences Research Council for supporting A. M. S. This work was sponsored partly by the British Society for Antimicrobial Chemotherapy. The SENTRY programme was funded by an educational/research grant from Bristol-Myers Squibb.
| Footnotes |
|---|
* Corresponding author. Tel: +44-117-928-7522; Fax +44-117-928-7896; E-mail: mark.toleman{at}bristol.ac.uk
| References |
|---|
|
|
|---|
1 . Kroop, H., Sundelf, J. G., Kahan, J. S., Kahan, F. M. & Birnbaum, J. (1985). MK0787 (N-formimidoyl thienamycin): evolution of in-vitro and in-vivo activities. Antimicrobial Agents and Chemotherapy 17, 9931000.
2 . Livermore, D. M. & Woodford, N. (2000). Carbapenemases: a problem in waiting? Current Opinions in Microbiology 3, 48995.
3 . Page, M. I. (2002). Understanding metallo-ß-lactamases. ASM News 68, 21721.
4 . Arakawa, Y., Murakami, M., Suzuki, K., Ito, H., Wacharotayankun, R., Ohsuka, S. et al. (1995). A novel integron-like element carrying the metallo-ß-lactamase gene blaIMP. Antimicrobial Agents and Chemotherapy 39, 16125.[Abstract]
5 . Senda, K., Arakawa, Y., Ichiyama, S., Nakashima, K., Ito, H., Ohsuka, S. et al. (1996). PCR detection of metallo-ß-lactamase gene (blaIMP) in gram-negative rods resistant to broad-spectrum ß-lactams. Journal of Clinical Microbiology 34, 290913.[Abstract]
6
.
Chu, Y. W., Afzal-Shah, M., Houang, E. T., Palepou, M. I., Lyon, D. J., Woodford, N. et al. (2001). IMP-4, a novel metallo-ß-lactamase from nosocomial Acinetobacter spp. collected in Hong Kong between 1994 and 1998. Antimicrobial Agents and Chemotherapy 45, 7104.
7 . Koh, T. H., Babini, G. S., Woodford, N., Sng, L. H., Hall, L. M. & Livermore, D. M. (1999). Carbapenem-hydrolysing IMP-1 ß-lactamase in Klebsiella pneumoniae from Singapore. Lancet 353, 2162.[Web of Science][Medline]
8
.
Lauretti, L., Riccio, M. L., Mazzariol, A., Cornaglia, G., Amicosante, G., Fontana, R. et al. (1999). Cloning and characterization of blaVIM, a new integron-borne metallo-ß-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrobial Agents and Chemotherapy 43, 158490.
9
.
Tsakris, A., Pournaras, S., Woodford, N., Palepou, M. F., Babini, G. S., Douboyas, J. et al. (2000). Outbreak of infections caused by Pseudomonas aeruginosa producing VIM-carbapenemase in Greece. Journal of Clinical Microbiology 38, 12902.
10
.
Poirel, L., Naas, T., Nicolas, D., Collet, L., Bellais, S., Cavallo, J. D. et al. (2000). Characterization of VIM-2, a carbapenem-hydrolyzing metallo-ß-lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrobial Agents and Chemotherapy 44, 8917.
11
.
Franceschini, N., Caravelli, B., Docquier, J. D., Galleni, M., Frere, J. M., Amicosante, G. et al. (2000). Purification and biochemical characterization of the VIM-1 metallo-ß-lactamase. Antimicrobial Agents and Chemotherapy 44, 30037.
12 . Hall, R. M., Brooks, D. E. & Stokes, H. W. (1991). Site specific insertion of genes into integrons: role of the 59bp element and determination of the recombination crossover point. Molecular Microbiology 5, 194159.[Web of Science][Medline]
13
.
Gibb, A. P., Tribuddharat, C., Moore, R. A., Louie, T. J., Krulicki, W., Livermore, D. M. et al. (2002). Nosocomial outbreak of carbapenem-resistant Pseudomonas aeruginosa with a new bla(IMP) allele, bla(IMP-7). Antimicrobial Agents and Chemotherapy 46, 2558.
14
.
Walsh, T. R., Bolmström, A., Qwärnström, A. & Gales, A. (2002). Evaluation of a new Etest to detect metallo-ß-lactamases in routine clinical testing. Journal of Clinical Microbiology 40, 27559.
15 . Pridmore, R. (1987). New and versatile cloning vectors with kanamycin resistance markers. Gene 56, 30912.[Web of Science][Medline]
16 . Walsh, T. R., MacGowan, A. P. & Bennett, P. M. (1997). Sequence analysis and kinetics of the cloned L2 serine ß-lactamase from Stenotrophomonas maltophilia. Antimicrobial Agents and Chemotherapy 41, 27381.
17
.
Walsh, T. R., Emery, D. C., MacGowan, A. P. & Bennett, P. M. (1996). Enzyme kinetics and biochemical analysis of ImiS, a metallo-ß-lactamase from Aeromonas sobria 163a. Journal of Antimicrobial Chemotherapy 37, 42331.
18
.
Laraki, N., Franceschini, N., Rossolini, G. M., Santucci, P., Meunier, C., de Pauw, E. et al. (1999). Biochemical characterization of the Pseudomonas aeruginosa 101/1477 metallo-ß-lactamase IMP-1 produced by Escherichia coli. Antimicrobial Agents and Chemotherapy 43, 9026.
19
.
Boyd, D., Peters, G. A., Cloeckaert, A., Boumedine, K. S., Chaslus-Dancla, E., Imberechts, H. et al. (2001). Complete nucleotide sequence of a 42-kilobase genomic island associated with the multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona. Journal of Bacteriology 183, 572532.
20
.
Osano, E., Arakawa, Y., Wacharotayankun, R., Ohta, M., Horii, T., Ito. H. et al. (1994). Molecular characterizetion of an enterobacterial metallo-ß-lactamase found in a clinical isolate of Serratia marcescens that shows imipenem resistance. Antimicrobial Agents and Chemotherapy 38, 718.
21
.
Walsh, T. R., Neville, W. A., Tolson, D., Payne, D. J., Bateson, J., MacGowan, A. P. et al. (1998). Nucleotide and amino acid sequences of the metallo-ß-lactamase, ImiS, from Aeromonas veronii bv. sobria. Antimicrobial Agents and Chemotherapy 42, 4369.
22
.
Massidda, O., Rossolini, G. M. and Satta, G. (1991). The Aeromonas hydrophila cphA gene: molecular heterogeneity among Class B metallo-ß-lactamases. Journal of Bacteriology 173, 46117.
23
.
Hussain, M., Carlino, A., Madonna, M. J. & Lampen, J. O. (1985). Cloning and sequencing of the metallothioprotein ß-lactamase II gene of Bacillus cereus 569/H in Escherichia coli. Journal of Bacteriology 164, 2239.
24
.
Thompson, J. S. & Malamy, M. H. (1990). Sequencing the gene for an imipenem-cefoxitin-hydrolyzing enzyme (CfiA) from Bacteroides fragilis TAL2480 reveals strong similarity between CfiA and Bacillus cereus ß-lactamase II. Journal of Bacteriology 172, 258493.
25 . Rossolini, G. M., Franceschini, N., Riccio, M. L., Mercuri, P. S., Perilli, M., Galleni, M. et al. (1998). Characterization and sequence of the Chryseobacterium (Flavobacterium) meningosepticum carbapenemase: a new molecular class B ß-lactamase showing a broad substrate profile. Biochemical Journal 332, 14552.
26 . Walsh, T. R., Hall, L., Assinder, S. J., Nichols, W. W., Cartwright, S. J., MacGowan, A. P. et al. (1994). Sequence analysis of the L1 metallo-ß-lactamase from Xanthomonas maltophilia. Biochimica et Biophysica Acta 1218, 199201. [Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Kouda, M. Ohara, M. Onodera, Y. Fujiue, M. Sasaki, T. Kohara, S. Kashiyama, S. Hayashida, T. Harino, T. Tsuji, et al. Increased prevalence and clonal dissemination of multidrug-resistant Pseudomonas aeruginosa with the blaIMP-1 gene cassette in Hiroshima J. Antimicrob. Chemother., July 1, 2009; 64(1): 46 - 51. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Maddocks and P. C. F. Oyston Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins Microbiology, December 1, 2008; 154(12): 3609 - 3623. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-i. Sekiguchi, K. Morita, T. Kitao, N. Watanabe, M. Okazaki, T. Miyoshi-Akiyama, M. Kanamori, and T. Kirikae KHM-1, a Novel Plasmid-Mediated Metallo-{beta}-Lactamase from a Citrobacter freundii Clinical Isolate Antimicrob. Agents Chemother., November 1, 2008; 52(11): 4194 - 4197. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Marchiaro, V. Ballerini, T. Spalding, G. Cera, M. A. Mussi, J. Moran-Barrio, A. J. Vila, A. M. Viale, and A. S. Limansky A convenient microbiological assay employing cell-free extracts for the rapid characterization of Gram-negative carbapenemase producers J. Antimicrob. Chemother., August 1, 2008; 62(2): 336 - 344. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Garza-Ramos, R. Morfin-Otero, H. S. Sader, R. N. Jones, E. Hernandez, E. Rodriguez-Noriega, A. Sanchez, B. Carrillo, S. Esparza-Ahumada, and J. Silva-Sanchez Metallo-{beta}-Lactamase Gene blaIMP-15 in a Class 1 Integron, In95, from Pseudomonas aeruginosa Clinical Isolates from a Hospital in Mexico Antimicrob. Agents Chemother., August 1, 2008; 52(8): 2943 - 2946. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Picao, S. S. Andrade, A. G. Nicoletti, E. H. Campana, G. C. Moraes, R. E. Mendes, and A. C. Gales Metallo-{beta}-Lactamase Detection: Comparative Evaluation of Double-Disk Synergy versus Combined Disk Tests for IMP-, GIM-, SIM-, SPM-, or VIM-Producing Isolates J. Clin. Microbiol., June 1, 2008; 46(6): 2028 - 2037. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Doi, A. C. R. Ghilardi, J. Adams, D. de Oliveira Garcia, and D. L. Paterson High Prevalence of Metallo-{beta}-Lactamase and 16S rRNA Methylase Coproduction among Imipenem-Resistant Pseudomonas aeruginosa Isolates in Brazil Antimicrob. Agents Chemother., September 1, 2007; 51(9): 3388 - 3390. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Queenan and K. Bush Carbapenemases: the Versatile {beta}-Lactamases Clin. Microbiol. Rev., July 1, 2007; 20(3): 440 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Toleman, H. Vinodh, U. Sekar, V. Kamat, and T. R. Walsh blaVIM-2-Harboring Integrons Isolated in India, Russia, and the United States Arise from an Ancestral Class 1 Integron Predating the Formation of the 3' Conserved Sequence Antimicrob. Agents Chemother., July 1, 2007; 51(7): 2636 - 2638. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Moran-Barrio, J. M. Gonzalez, M. N. Lisa, A. L. Costello, M. D. Peraro, P. Carloni, B. Bennett, D. L. Tierney, A. S. Limansky, A. M. Viale, et al. The Metallo-beta-lactamase GOB Is a Mono-Zn(II) Enzyme with a Novel Active Site J. Biol. Chem., June 22, 2007; 282(25): 18286 - 18293. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Andrade, R. C. Picao, E. H. Campana, A. G. Nicoletti, A. C. C. Pignatari, and A. C. Gales Influence of Disk Preparation on Detection of Metallo-{beta}-Lactamase-Producing Isolates by the Combined Disk Assay J. Clin. Microbiol., June 1, 2007; 45(6): 2058 - 2060. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Villegas, K. Lolans, A. Correa, J. N. Kattan, J. A. Lopez, J. P. Quinn, and and the Colombian Nosocomial Resistance Study Grou First Identification of Pseudomonas aeruginosa Isolates Producing a KPC-Type Carbapenem-Hydrolyzing {beta}-Lactamase Antimicrob. Agents Chemother., April 1, 2007; 51(4): 1553 - 1555. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Mendes, K. A. Kiyota, J. Monteiro, M. Castanheira, S. S. Andrade, A. C. Gales, A. C. C. Pignatari, and S. Tufik Rapid Detection and Identification of Metallo-{beta}-Lactamase-Encoding Genes by Multiplex Real-Time PCR Assay and Melt Curve Analysis J. Clin. Microbiol., February 1, 2007; 45(2): 544 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ktari, G. Arlet, B. Mnif, V. Gautier, F. Mahjoubi, M. Ben Jmeaa, M. Bouaziz, and A. Hammami Emergence of Multidrug-Resistant Klebsiella pneumoniae Isolates Producing VIM-4 Metallo-{beta}-Lactamase, CTX-M-15 Extended-Spectrum {beta}-Lactamase, and CMY-4 AmpC {beta}-Lactamase in a Tunisian University Hospital Antimicrob. Agents Chemother., December 1, 2006; 50(12): 4198 - 4201. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Toleman, P. M. Bennett, and T. R. Walsh ISCR Elements: Novel Gene-Capturing Systems of the 21st Century? Microbiol. Mol. Biol. Rev., June 1, 2006; 70(2): 296 - 316. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Jacoby {beta}-Lactamase Nomenclature. Antimicrob. Agents Chemother., April 1, 2006; 50(4): 1123 - 1129. [Full Text] [PDF] |
||||
![]() |
S. Pournaras, A. Markogiannakis, A. Ikonomidis, L. Kondyli, K. Bethimouti, A. N. Maniatis, N. J. Legakis, and A. Tsakris Outbreak of multiple clones of imipenem-resistant Acinetobacter baumannii isolates expressing OXA-58 carbapenemase in an intensive care unit J. Antimicrob. Chemother., March 1, 2006; 57(3): 557 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Villegas, K. Lolans, M. del Rosario Olivera, C. J. Suarez, A. Correa, A. M. Queenan, J. P. Quinn, and the Colombian Nosocomial Resistance Study Group First Detection of Metallo-{beta}-Lactamase VIM-2 in Pseudomonas aeruginosa Isolates from Colombia Antimicrob. Agents Chemother., January 1, 2006; 50(1): 226 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lee, J. H. Yum, D. Yong, H. M. Lee, H. D. Kim, J.-D. Docquier, G. M. Rossolini, and Y. Chong Novel Acquired Metallo-{beta}-Lactamase Gene, blaSIM-1, in a Class 1 Integron from Acinetobacter baumannii Clinical Isolates from Korea Antimicrob. Agents Chemother., November 1, 2005; 49(11): 4485 - 4491. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Marchiaro, M. A. Mussi, V. Ballerini, F. Pasteran, A. M. Viale, A. J. Vila, and A. S. Limansky Sensitive EDTA-Based Microbiological Assays for Detection of Metallo-{beta}-Lactamases in Nonfermentative Gram-Negative Bacteria J. Clin. Microbiol., November 1, 2005; 43(11): 5648 - 5652. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lolans, A. M. Queenan, K. Bush, A. Sahud, and J. P. Quinn First Nosocomial Outbreak of Pseudomonas aeruginosa Producing an Integron-Borne Metallo-{beta}-Lactamase (VIM-2) in the United States Antimicrob. Agents Chemother., August 1, 2005; 49(8): 3538 - 3540. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Pagani, C. Colinon, R. Migliavacca, M. Labonia, J.-D. Docquier, E. Nucleo, M. Spalla, M. Li Bergoli, and G. M. Rossolini Nosocomial Outbreak Caused by Multidrug-Resistant Pseudomonas aeruginosa Producing IMP-13 Metallo-{beta}-Lactamase J. Clin. Microbiol., August 1, 2005; 43(8): 3824 - 3828. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. D. Pitout, D. B. Gregson, L. Poirel, J.-A. McClure, P. Le, and D. L. Church Detection of Pseudomonas aeruginosa Producing Metallo-{beta}-Lactamases in a Large Centralized Laboratory J. Clin. Microbiol., July 1, 2005; 43(7): 3129 - 3135. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Walsh, M. A. Toleman, L. Poirel, and P. Nordmann Metallo-{beta}-Lactamases: the Quiet before the Storm? Clin. Microbiol. Rev., April 1, 2005; 18(2): 306 - 325. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Henrichfreise, I. Wiegand, K. J. Sherwood, and B. Wiedemann Detection of VIM-2 Metallo-{beta}-Lactamase in Pseudomonas aeruginosa from Germany Antimicrob. Agents Chemother., April 1, 2005; 49(4): 1668 - 1669. [Full Text] [PDF] |
||||
![]() |
K. Lee, D. Yong, J. H. Yum, Y. S. Lim, A. Bolmstrom, A. Qwarnstrom, A. Karlsson, and Y. Chong Evaluation of Etest MBL for Detection of blaIMP-1 and blaVIM-2 Allele-Positive Clinical Isolates of Pseudomonas spp. and Acinetobacter spp. J. Clin. Microbiol., February 1, 2005; 43(2): 942 - 944. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Riccio, L. Pallecchi, J.-D. Docquier, S. Cresti, M. R. Catania, L. Pagani, C. Lagatolla, G. Cornaglia, R. Fontana, and G. M. Rossolini Clonal Relatedness and Conserved Integron Structures in Epidemiologically Unrelated Pseudomonas aeruginosa Strains Producing the VIM-1 Metallo-{beta}-Lactamase from Different Italian Hospitals Antimicrob. Agents Chemother., January 1, 2005; 49(1): 104 - 110. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lincopan, J. A. McCulloch, C. Reinert, V. C. Cassettari, A. C. Gales, and E. M. Mamizuka First Isolation of Metallo-{beta}-Lactamase-Producing Multiresistant Klebsiella pneumoniae from a Patient in Brazil J. Clin. Microbiol., January 1, 2005; 43(1): 516 - 519. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Toleman, D. Biedenbach, D. M. C. Bennett, R. N. Jones, and T. R. Walsh Italian metallo-{beta}-lactamases: a national problem? Report from the SENTRY Antimicrobial Surveillance Programme J. Antimicrob. Chemother., January 1, 2005; 55(1): 61 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Castanheira, M. A. Toleman, R. N. Jones, F. J. Schmidt, and T. R. Walsh Molecular Characterization of a {beta}-Lactamase Gene, blaGIM-1, Encoding a New Subclass of Metallo-{beta}-Lactamase Antimicrob. Agents Chemother., December 1, 2004; 48(12): 4654 - 4661. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Mendes, M. A. Toleman, J. Ribeiro, H. S. Sader, R. N. Jones, and T. R. Walsh Integron Carrying a Novel Metallo-{beta}-Lactamase Gene, blaIMP-16, and a Fused Form of Aminoglycoside-Resistant Gene aac(6')-30/aac(6')-Ib': Report from the SENTRY Antimicrobial Surveillance Program Antimicrob. Agents Chemother., December 1, 2004; 48(12): 4693 - 4702. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Crespo, N. Woodford, A. Sinclair, M. E. Kaufmann, J Turton, J. Glover, J. D. Velez, C. R. Castaneda, M. Recalde, and D. M. Livermore Outbreak of Carbapenem-Resistant Pseudomonas aeruginosa Producing VIM-8, a Novel Metallo-{beta}-Lactamase, in a Tertiary Care Center in Cali, Colombia J. Clin. Microbiol., November 1, 2004; 42(11): 5094 - 5101. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nishio, M. Komatsu, N. Shibata, K. Shimakawa, N. Sueyoshi, T. Ura, K. Satoh, M. Toyokawa, T. Nakamura, Y. Wada, et al. Metallo-{beta}-Lactamase-Producing Gram-Negative Bacilli: Laboratory-Based Surveillance in Cooperation with 13 Clinical Laboratories in the Kinki Region of Japan J. Clin. Microbiol., November 1, 2004; 42(11): 5256 - 5263. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Garau, I. Garcia-Saez, C. Bebrone, C. Anne, P. Mercuri, M. Galleni, J.-M. Frere, and O. Dideberg Update of the Standard Numbering Scheme for Class B {beta}-Lactamases Antimicrob. Agents Chemother., July 1, 2004; 48(7): 2347 - 2349. [Full Text] [PDF] |
||||
![]() |
G. Bahar, A. Mazzariol, R. Koncan, A. Mert, R. Fontana, G. M. Rossolini, and G. Cornaglia Detection of VIM-5 metallo-{beta}-lactamase in a Pseudomonas aeruginosa clinical isolate from Turkey J. Antimicrob. Chemother., July 1, 2004; 54(1): 282 - 283. [Full Text] [PDF] |
||||
![]() |
L. Poirel, M. Magalhaes, M. Lopes, and P. Nordmann Molecular Analysis of Metallo-{beta}-Lactamase Gene blaSPM-1-Surrounding Sequences from Disseminated Pseudomonas aeruginosa Isolates in Recife, Brazil Antimicrob. Agents Chemother., April 1, 2004; 48(4): 1406 - 1409. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Mendes, M. Castanheira, P. Garcia, M. Guzman, M. A. Toleman, T. R. Walsh, and R. N. Jones First Isolation of blaVIM-2 in Latin America: Report from the SENTRY Antimicrobial Surveillance Program Antimicrob. Agents Chemother., April 1, 2004; 48(4): 1433 - 1434. [Full Text] [PDF] |
||||
![]() |
J. Patzer, M. A. Toleman, L. M. Deshpande, W. Kaminska, D. Dzierzanowska, P. M. Bennett, R. N. Jones, and T. R. Walsh Pseudomonas aeruginosa strains harbouring an unusual blaVIM-4 gene cassette isolated from hospitalized children in Poland (1998-2001) J. Antimicrob. Chemother., March 1, 2004; 53(3): 451 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Luzzaro, J.-D. Docquier, C. Colinon, A. Endimiani, G. Lombardi, G. Amicosante, G. M. Rossolini, and A. Toniolo Emergence in Klebsiella pneumoniae and Enterobacter cloacae Clinical Isolates of the VIM-4 Metallo-{beta}-Lactamase Encoded by a Conjugative Plasmid Antimicrob. Agents Chemother., February 1, 2004; 48(2): 648 - 650. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Toleman, K. Rolston, R. N. Jones, and T. R. Walsh blaVIM-7, an Evolutionarily Distinct Metallo-{beta}-Lactamase Gene in a Pseudomonas aeruginosa Isolate from the United States Antimicrob. Agents Chemother., January 1, 2004; 48(1): 329 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shibata, Y. Doi, K. Yamane, T. Yagi, H. Kurokawa, K. Shibayama, H. Kato, K. Kai, and Y. Arakawa PCR Typing of Genetic Determinants for Metallo-{beta}-Lactamases and Integrases Carried by Gram-Negative Bacteria Isolated in Japan, with Focus on the Class 3 Integron J. Clin. Microbiol., December 1, 2003; 41(12): 5407 - 5413. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lee, Y. S. Lim, D. Yong, J. H. Yum, and Y. Chong Evaluation of the Hodge Test and the Imipenem-EDTA Double-Disk Synergy Test for Differentiating Metallo-{beta}-Lactamase-Producing Isolates of Pseudomonas spp. and Acinetobacter spp. J. Clin. Microbiol., October 1, 2003; 41(10): 4623 - 4629. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Toleman, D. Biedenbach, D. Bennett, R. N. Jones, and T. R. Walsh Genetic characterization of a novel metallo-{beta}-lactamase gene, blaIMP-13, harboured by a novel Tn5051-type transposon disseminating carbapenemase genes in Europe: report from the SENTRY worldwide antimicrobial surveillance programme J. Antimicrob. Chemother., October 1, 2003; 52(4): 583 - 590. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Toleman, K. Rolston, R. N. Jones, and T. R. Walsh Molecular and Biochemical Characterization of OXA-45, an Extended-Spectrum Class 2d' {beta}-Lactamase in Pseudomonas aeruginosa Antimicrob. Agents Chemother., September 1, 2003; 47(9): 2859 - 2863. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Saavedra, L. Peixe, J. C. Sousa, I. Henriques, A. Alves, and A. Correia Sfh-I, a Subclass B2 Metallo-{beta}-Lactamase from a Serratia fonticola Environmental Isolate Antimicrob. Agents Chemother., July 1, 2003; 47(7): 2330 - 2333. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Walsh, M. A. Toleman, W. Hryniewicz, P. M. Bennett, and R. N. Jones Evolution of an integron carrying blaVIM-2 in Eastern Europe: report from the SENTRY Antimicrobial Surveillance Program J. Antimicrob. Chemother., July 1, 2003; 52(1): 116 - 119. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








