Skip Navigation


JAC Advance Access originally published online on September 6, 2002
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
50/4/593    most recent
dkf147v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kumar, A.
Right arrow Articles by Worobec, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kumar, A.
Right arrow Articles by Worobec, E. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


Journal of Antimicrobial Chemotherapy (2002) 50, 593-596
© 2002 The British Society for Antimicrobial Chemotherapy

Fluoroquinolone resistance of Serratia marcescens: involvement of a proton gradient-dependent efflux pump

Ayush Kumar and Elizabeth A. Worobec*

Department of Microbiology, University of Manitoba, Winnipeg MB R3T 2N2, Canada

Received 15 November 2001; returned 7 March 2002; revised 16 May 2002; accepted 14 June 2002


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Objective: To determine the presence of a proton gradient-dependent efflux of fluoroquinolone drugs in Serratia marcescens.

Methods: Thirteen clinical isolates of S. marcescens were screened for resistance to four fluoroquinolones: ofloxacin, ciprofloxacin, norfloxacin and nalidixic acid by determining MICs. The presence of a proton gradient-dependent efflux mechanism was assessed using ethidium bromide accumulation assays. Drug accumulation studies for norfloxacin, ciprofloxacin and ofloxacin were performed to determine the drug specificity of efflux. Western transfer of cellular proteins, followed by immunodetection using anti-AcrA (Escherichia coli) antibodies were used to demonstrate the presence of a resistance–nodulation–cell division (RND) pump protein. PCR was used to identify a RND pump-encoding gene using primers for two conserved motifs within inner membrane components of RND proteins. A mutant strain of S. marcescens, UOC-67WL, was isolated by culturing the wild-type strain in the presence of ciprofloxacin in T-soy media and was subjected to the same studies as described above for the clinical isolates.

Results: Ethidium bromide accumulation assays confirmed the presence of a proton gradient-dependent efflux mechanism in S. marcescens. One clinical isolate, T-861, and the mutant strain, UOC-67WL, were found to efflux ciprofloxacin and ofloxacin. Western immunoblot results confirmed overexpression of an AcrA-like protein in T-861 and UOC-67WL. Sequencing of the PCR product showed the presence of a mexF-like gene, which is overexpressed in nfxC mutants of Pseudomonas aeruginosa.

Conclusion: This study reports the presence of a proton gradient-dependent efflux mechanism in S. marcescens.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Serratia marcescens, once considered to be an innocuous and non-pathogenic organism, is now an important cause of hospital-acquired infections. This organism is associated with respiratory tract infections, urinary tract infections, septicaemia, meningitis and wound infections.1 S. marcescens infections are difficult to treat because of high resistance to a wide variety of antibiotics including cephalosporins, aztreonam and imipenem. Recently, S. marcescens has also been shown to be resistant to fluoroquinolones.1 In various bacterial species fluoroquinolone resistance has been shown to be the result of mutations in DNA gyrase and/or overexpression of multidrug resistance efflux pumps.2 Multidrug resistance efflux pumps play a major role in the intrinsic and acquired resistance of various human pathogens, with determinants for multidrug efflux pumps being identified in genomes of most, if not all, bacterial species.3 One group has suggested previously the presence of an efflux mechanism in S. marcescens.4 The study reported here proves the presence of an efflux mechanism for fluoroquinolones in S. marcescens and identifies a resistance–nodulation–cell division (RND) pump-encoding gene in this organism that could be a possible candidate responsible for drug efflux.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bacterial strains

Thirteen clinical isolates of S. marcescens (T-849, T-850, T-851, T-852, T-853, T-854, T-855, T-856, T-857, T-858, T-859, T-860 and T-861) were obtained from the Department of Medical Microbiology, Health Sciences Centre, Winnipeg, Manitoba. UOC-67 (S. marcescens strain ATCC 13880) was used as the wild-type strain. UOC-67WL is a mutant strain derived from UOC-67.

Antibiotic susceptibility testing

Susceptibilities of S. marcescens strains to norfloxacin, nalidixic acid, ofloxacin (Sigma-Aldrich, Canada) and ciprofloxacin (a gift from Bayer Inc., Canada), were tested using the two-fold dilution method with an inoculum of 10 cfu.5 Results were reported as MIC, the concentration of antibiotic that inhibited visible growth determined by absence of turbidity in the broth after 18 h of incubation at 37°C.

Fluoroquinolone accumulation

Accumulation of ciprofloxacin, ofloxacin and norfloxacin was measured for clinical isolates showing an MIC of >=4 mg/L of each of these antibiotics, following the method of Mortimer & Piddock.2 The fluorescence of antibiotics was measured as follows: ciprofloxacin at excitation and emission wavelengths of 279 and 447 nm; norfloxacin at 281 and 440 nm; and ofloxacin at 292 and 496 nm, respectively. Carbonyl cyanide m-chlorophenylhydrazone (CCCP) was added to a final concentration of 100 µM after 5 min. Accumulation assays for nalidixic acid were not performed, as emission and excitation wavelengths for the drug could not be determined.

The concentrations of antibiotics were calculated using a standard curve for the respective antibiotic (concentration ranging from 100 to 1000 ng) in 0.1 M glycine hydrochloride pH 3.0. The results were expressed as nanograms of antibiotic incorporated per milligram (dry weight) of bacteria.

Selection of S. marcescens mutant strain UOC-67WL

Wild-type S. marcescens, strain UOC-67, was grown on T-soy agar plates and replated after every overnight incubation on plates supplemented with increasing concentrations of ciprofloxacin. One colony capable of growing at 21 mg/L ciprofloxacin was selected and named UOC-67WL. This strain was subjected to the studies described above for clinical isolates.

Whole-cell lysis, urea-SDS–PAGE and western immunoblot

A 1.5 mL overnight bacterial culture grown in T-soy broth was pelleted by centrifugation at 5600g, and lysed with 100 µL of cell lysis buffer [2% (w/v) SDS, 4% (v/v) dithiothreitol (DTT), 10% glycerol, 1 M Tris pH 6.8]. Protein samples (150 µg) were analysed on a 13% SDS–PAGE gel supplemented with 4 M urea (a modification of the method of Uemura & Mizushima6).

Western immunoblot7 of the protein resolved on SDS–PAGE urea gels was performed using antibodies (diluted 1:4000) raised against the AcrA protein of Escherichia coli (a gift from H. Nikaido, University of California, Berkeley, CA, USA).

Genomic DNA preparation, PCR and DNA sequencing

Genomic DNA of S. marcescens UOC-67 was prepared as described by Ausubel et al.8

Two primers, ACRB1236 (GTGGATGACGCCATCGTTGTG) and ACRB2954 (GGTCATCAGGATCGGACGTAA) (Gibco BRL), were used to amplify a ~1.7 kb region from the genome of S. marcescens UOC-67. Sequences of primers were derived from two signature sequences of RND proteins as described by Tseng et al.3

DNA sequencing was carried out at the automated sequencing facility of the National Research Council/Plant Biotechnology Institute, Saskatoon, Saskatchewan, Canada. The BLAST 2.0 algorithm of the National Center for Biotechnology Information (NCBI) was used to analyse DNA sequences.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Antibiotic susceptibility testing

Strains demonstrating an MIC of >=4 mg/L of an antibiotic were considered resistant to that particular antibiotic and used for further studies. Strains found to be resistant to ciprofloxacin, norfloxacin and ofloxacin were T-860, T-861 and UOC-67WL. T-856 showed resistance to norfloxacin but not to ciprofloxacin or ofloxacin. All strains, except T-857, T-858 and T-859, were found to be resistant to nalidixic acid.

Fluoroquinolone accumulation

UOC-67WL plus two clinical isolates, T-860 and T-861, were tested for their ability to accumulate ciprofloxacin. T-860 accumulated the drug with time, with no increase in the rate of accumulation upon addition of CCCP. In contrast, T-861 and UOC-67WL showed an increase of up to four-fold in the accumulation of ciprofloxacin after addition of CCCP. Rates of accumulation of ciprofloxacin by T-861 and UOC-67WL were found to be almost identical, whilst T-860 and wild-type, UOC-67, accumulated ciprofloxacin at a similar rate (Figure 1a). Neither the clinical isolates (T-856, T-860 and T-861) nor UOC-67 or UOC-67WL demonstrated any increase in the accumulation of norfloxacin upon addition of CCCP (Figure 1b).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Fluoroquinolone accumulation by various strains of S. marcescens. T-856, T-860 and T-861 are clinical isolates, UOC-67 is the wild-type and UOC-67WL is the mutant derived from UOC-67. Strains were tested for accumulation of specific antibiotics based on MIC. (a) Accumulation of ciprofloxacin (Cp) was measured for UOC-67, T-860, T-861 and UOC-67WL. (b) Accumulation of norfloxacin (Nf) was measured for UOC-67, T-856, T-860, T-861 and UOC-67WL. (c) Accumulation of ofloxacin (Of) was measured for UOC-67, T-860, T-861 and UOC-67WL. CCCP was added 5 min after addition of the antibiotic (shown by the arrow). Results are expressed as nanograms of antibiotic accumulated per milligram (dry weight) of cells. Data presented are representative of that obtained from three independent assays performed on three independent cultures.

 
With respect to ofloxacin, T-861 and UOC-67WL but not T-860 accumulated increased amounts of this antibiotic upon addition of CCCP (Figure 1c).

SDS–PAGE and western immunoblot

The western immunoblot from the SDS–PAGE urea gel of the whole-cell lysate of UOC-67 (wild-type), and T-861 and UOC-67WL (the two strains capable of accumulating ciprofloxacin and ofloxacin) showed a positive reaction with anti-AcrA antibodies (Figure 2). Two protein bands were visualized, with the intensity of the lower band greatest for T-861 and lowest for UOC-67, suggesting the presence of two different yet related RND pump proteins.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 2. Immunoblot analysis of AcrA-like protein(s) from T-861 (1), UOC-67WL (2) and UOC-67 (3). Protein (150 µg) from the whole-cell lysate of each strain was loaded on an SDS–PAGE gel and immunodetection was performed using anti-AcrA antibody (1:4000). The lower protein band is overexpressed in T-861 and UOC-67WL.

 
PCR and DNA sequencing

PCR of the genomic DNA of S. marcescens UOC-67, using primers ACRB1236 and ACRB2954, yielded a product of ~1.7 kb. Partial sequence (800 bp) of this PCR product, revealed high homology to the mexF gene of Pseudomonas aeruginosa.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Clinical isolates with an MIC of >=4 mg/L of a given antibiotic were considered resistant to that particular antibiotic and were tested for the accumulation of that antibiotic. The resistant isolates T-856 and T-860 did not show accumulation of the relevant drug(s) upon addition of CCCP, a compound that disrupts the proton gradient across the membrane and thus inhibits proton gradient-dependent pumps. Furthermore, the accumulation patterns for these two isolates were found to be very similar to that of the wild-type strain UOC-67, suggesting that their resistance is probably due to some other mechanism, such as mutation(s) in DNA gyrase. T-861 and the mutant strain UOC-67WL, however, demonstrated increased accumulation of ciprofloxacin and ofloxacin, but not of norfloxacin (Figure 1) upon addition of CCCP, as compared with wild-type strain UOC-67. The interesting aspect is that the mutant strain UOC-67WL was derived by culturing the wild-type strain UOC-67 in the presence of ciprofloxacin exclusively, without exposure to other antibiotics. The observation that UOC-67WL accumulates both ciprofloxacin and ofloxacin suggests that there is either one pump recognizing both ciprofloxacin and ofloxacin, or that there are different pumps for each drug being expressed under a similar type of regulation. Considering that the chemical structures of ciprofloxacin and ofloxacin are less similar than those of ciprofloxacin and norfloxacin, the latter explanation seems more plausible. Resistance to norfloxacin may be attributed to some other mechanism of resistance, such as mutation(s) in DNA gyrase and proton gradient-independent efflux of the antibiotic.

To classify the type of pump effluxing fluoroquinolones, western immunoblot experiments were performed. Results demonstrated the presence of at least two AcrA-like proteins in S. marcescens. The AcrAB pump of E. coli belongs to the RND family,3 with the AcrA protein being the periplasmic component of the pump. Western immunoblot experiments showed overexpression of at least one protein in T-861 and UOC-67WL (Figure 2), with the molecular weight of these proteins corresponding to ~50 kDa. The presence of two bands in the immunoblot is not surprising considering that seven different RND proteins have been found in E. coli.9 In addition, a portion of the gene encoding the inner membrane component of the RND protein was identified in S. marcescens UOC-67, with the DNA sequence analysis revealing similarity to the mexF gene of P. aeruginosa. Efforts are underway to knock out this gene in S. marcescens to get a clear picture of the role of the gene product in the efflux-mediated resistance and to determine whether more than one product of the same size was obtained as a result of PCR.

This study points strongly towards proton-dependent efflux of fluoroquinolone drugs, possibly via RND pump(s), as a resistance mechanism in S. marcescens.


    Acknowledgements
 
We are grateful to Olga Lomovskaya, George Zhanel and Maggie Johnson for their valuable suggestions; Daryl Hoban for providing the clinical isolates of S. marcescens; and Françoise Vouriot for technical assistance. This work was supported by a Natural Sciences and Engineering Research Council of Canada operating grant (to E.A.W.) A.K. is a recipient of a Manitoba Health Research Council scholarship.


    Footnotes
 
* Corresponding author. Tel: +1-204-474-8473; Fax: +1-204-474-7603; E-mail: eworobe{at}ms.umanitoba.ca Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1 . Hejazi, A. & Falkiner, F. R. (1997). Serratia marcescens. Journal of Medical Microbiology 46, 903–12.[Abstract/Free Full Text]

2 . Mortimer, P. G. & Piddock, L. J. (1991). A comparison of methods used for measuring the accumulation of quinolones by Enterobacteriaceae, Pseudomonas aeruginosa and Staphylococcus aureus. Journal of Antimicrobial Chemotherapy 28, 639–53.[Abstract/Free Full Text]

3 . Tseng, T. T., Gratwick, K. S., Kollman, J., Park, D., Nies, D. H., Goffeau, A. et al. (1999). The RND permease superfamily: an ancient, ubiquitous and diverse family that includes human disease and development proteins. Journal of Molecular Microbiology and Biotechnology 1, 107–25.[Medline]

4 . Berlanga, M., Vazquez, J. L., Hernandez-Borrell, J., Montero, M. T. & Vinas, M. (2000). Evidence of an efflux pump in Serratia marcescens. Microbial Drug Resistance 6, 111–7.

5 . Anonymous. (1991). A guide to sensitivity testing. Report of the Working Party on Antibiotic Sensitivity Testing of the British Society for Antimicrobial Chemotherapy. Journal of Antimicrobial Chemotherapy 27, Suppl. D, 1–50.[Free Full Text]

6 . Uemura, J. & Mizushima, S. (1975). Isolation of outer membrane proteins of Escherichia coli and their characterization on polyacrylamide gel. Biochimica et Biophysica Acta 413, 163–76.[Medline]

7 . Burnette, W. N. (1981). ‘Western blotting’: electrophoretic transfer of proteins from sodium dodecyl sulfate–polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Analytical Biochemistry 112, 195–203.[Web of Science][Medline]

8 . Ausubel, F. M., Bent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. et al. (1989). Current Protocols in Molecular Biology. John Wiley and Sons, New York, USA.

9 . Nishino, K. & Yamaguchi, A. (2001). Analysis of a complete library of putative drug transporter genes in Escherichia coli. Journal of Bacteriology 183, 5803–12.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
A. Perez, D. Canle, C. Latasa, M. Poza, A. Beceiro, M. del Mar Tomas, A. Fernandez, S. Mallo, S. Perez, F. Molina, et al.
Cloning, Nucleotide Sequencing, and Analysis of the AcrAB-TolC Efflux Pump of Enterobacter cloacae and Determination of Its Involvement in Antibiotic Resistance in a Clinical Isolate
Antimicrob. Agents Chemother., September 1, 2007; 51(9): 3247 - 3253.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
K. Poole
Efflux-mediated antimicrobial resistance
J. Antimicrob. Chemother., July 1, 2005; 56(1): 20 - 51.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
A. Kumar and E. A. Worobec
Cloning, Sequencing, and Characterization of the SdeAB Multidrug Efflux Pump of Serratia marcescens
Antimicrob. Agents Chemother., April 1, 2005; 49(4): 1495 - 1501.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
50/4/593    most recent
dkf147v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kumar, A.
Right arrow Articles by Worobec, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kumar, A.
Right arrow Articles by Worobec, E. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?