JAC Advance Access originally published online on September 20, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Antimicrobial Chemotherapy (2002) 50, 513-516
© 2002 The British Society for Antimicrobial Chemotherapy
Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance
Department of Microbiological R & D, Statens Serum Institut, Artillerivej 5, 2300 Copenhagen, Denmark
Received 25 January 2002; returned 23 April 2002; revised 6 June 2002; accepted 2 July 2002
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResults and discussionReferences |
|---|
Antibiotic resistance of urinary tract pathogens has increased worldwide. Our aim was to provide information regarding resistance patterns of Escherichia coli in urinary tract infections (UTIs) and E. coli bacteraemia in Denmark. The overall resistance ranged from: ampicillin 20–47%, mecillinam 0–7%, trimethoprim 10–28%, sulfamethizole 22–47% and nitrofurantoin 0–3%. In strains with sulfamethizole MICs > 2048 mg/L, 97% carried sulI, sulII or both genes, with sulII being the most common. Among the sulI gene-positive strains, 96% were intI 1 gene positive.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionReferences |
|---|
The choice of empirical treatment for uncomplicated urinary tract infections (UTIs) is debated, because 20–50% of Escherichia coli are now resistant to some of the first-line antibiotics. The present study was designed: (i) to determine the current resistance pattern among E. coli UTIs in general practice, hospitalized patients and E. coli bacteraemia originating from community-acquired UTIs; (ii) to look at co-resistance; and (iii) to determine the distribution of sul genes in Danish isolates. In Denmark the recommended first-line treatment for uncomplicated UTI is sulfamethizole.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionReferences |
|---|
Bacterial strains
Group I. Forty-four general practitioners in Roskilde County each received 20 Uricult Trio dipslides (Orion Diagnostica, Espoo, Finland), from February to April 1997, on which to perform consecutive urinary culturing on all patients with symptoms of UTI. The UTI was defined as uncomplicated if all of the following criteria were fulfilled: (i) female gender; (ii) age 14–60 years; (iii) symptoms: dysuria, frequency, suprapubic pain, absence of loin pain, absence of fever; (iv) not pregnant; (v) no known deformity in the urinary tract; and (vi) less than three UTIs in the past year. All other UTIs were classified as complicated.1 All dipslides, including those with 
105 cfu/mL, were sent to Statens Serum Institute, Department of Microbiological R & D.
Group II. The Department of Clinical Biochemistry at the county hospital in Roskilde (RAS) performed (from April to June 1999) all urinalyses at the hospital and forwarded cultivated consecutive strains from hospital-acquired UTIs (defined as UTI starting >3 days after admission).
Group III. A selection of E. coli bacteraemia strains from RAS tested at the Department of Clinical Microbiology (DCM) at Statens Serum Institute (1997–1999) was carried out according to the following criteria: probable focus in the urinary tract and infection acquired in the community (bacteraemia <3 days after hospitalization).
Identification
Group I: dipslides were inspected visually, according to the manufacturer’s manual, and the cfu/mL was determined on CLED agar, MacConkey agar and E. coli agar (ß-glucuronidase). Only dipslides with 
103 cfu/mL were processed further, and were cultured on differential media. Identification for groups II and III relied on the identification originally performed at RAS and DCM, respectively.
Antibiotics
Mecillinam (Leo Pharmaceuticals, Ballerup, Denmark), ampicillin (Sigma Chemical Co.), sulfamethizole (Sigma), trimethoprim (Sigma) and nitrofurantoin (Sigma) were obtained from their respective manufacturers.
MIC determination
MICs were obtained by the agar dilution method according to the NCCLS,2 using Mueller–Hinton II agar (Becton Dickinson). The breakpoints used for Enterobacteriaceae were as defined by the NCCLS.3
PCR
All E. coli isolates were tested for the presence of sulphonamide resistance genes (sulI, sulII) and integron 1 gene (intI 1). The oligonucleotides were synthesized at TAG Copenhagen A/S, and their sequences were (5'
3'): 16S-F, GCGGACGGGTGAGTAATGT; 16S-B, TCATCCTCTCAGACCAGCTA (200 bp); Sul 1-F, CGGCGTGGGCTACCTGAACG; Sul 1-B, GCCGATCGCGTGAAGTTCCG (433 bp); Sul 2-F, GCGCTCAAGGCAGATGGCATT; Sul 2-B, GCGTTTGATACCGGCACCCGT (293 bp); Int-F, GCCACTGCGCCGTTACCACC; Int-B, GGCCGAGCAGATCCTGCACG (898 bp) (GenBank accession numbers AF071413, M36657, AF071413, AE000452). The PCR mixture contained: 5 µL of template DNA, 5 µL of 10x PCR buffer (Perkin Elmer); 10 µL of dNTP mix (Pharmacia Biotech, Sweden); 4 µL of MgCl2 (25 mM; Perkin Elmer); 0.25 µL of AmpliTaq DNA polymerase (50 µM; Perkin Elmer); 2.5 µL of each primer 16S-F, 16S-B (40 µM), Sul 1-F, Sul 1-B, Sul 2-F, Sul 2-B, Int-F and Int-B (2 µM); 15.75 µL of distilled water (Gibco-BRL). Amplification (GeneAmp PCR System 2400; Perkin Elmer) was carried out by heating for 5 min at 94°C, followed by 30 cycles of 94°C for 15 s, 69°C for 30 s and 72°C for 60 s, followed by one cycle at 72°C for 7 min. Gel electrophoresis was carried out on 2% w/v agarose gel (1% NuSieve GTG agarose and 1% SeaKem GTG agarose) (FMC BioProducts, Rockland, ME, USA). D-15 DNA Marker (Novex, San Diego, CA, USA) was used as a marker and E. coli NCTC 50001, E. coli NCTC 50020 and a susceptible strain from our own collection were used as controls in each PCR run.
Statistical methods
Fisher’s exact test was used, with P < 0.05 considered as significant.
|
Results and discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionReferences |
|---|
Group I: of 188 samples (94%
105 cfu/mL) 37% were from uncomplicated UTIs (81% E. coli) and 63% were isolated from complicated UTIs (68% E. coli). Group II: we received 137 identified strains from RAS (55% E. coli). Group III: we found 74 E. coli isolates that fulfilled the criteria. Table 1 shows the distribution of resistance in E. coli. Resistance to ampicillin, mecillinam and sulfamethizole was significantly higher in the hospital than in the community E. coli in total. Trimethoprim and nitrofurantoin resistance were not significantly different in the three strain collections. Trimethoprim and sulfamethizole resistance among the complicated UTIs were significantly higher compared with the uncomplicated UTIs. Compared with a Danish study in general practice published in 1980,4 our data show a significant increase in the ampicillin and trimethoprim resistance, a moderate increase in the sulphonamide resistance and a decrease or status quo in the mecillinam and nitrofurantoin resistance in general practice in Denmark. Data from others with respect to uncomplicated UTIs,5 and in general practice in total,6 support our findings. The high incidence of resistance among hospital UTIs and bacteraemia resembles that from a British survey.7
|
For strains resistant to either ampicillin, sulphonamide or trimethoprim, resistance to another antibiotic (i.e. co-resistance) was seen in 45–86%. In contrast, in strains susceptible to these antibiotics, co-resistance was seen in only 5–26% (P < 0.05).
All 292 E. coli were tested for sul and int genes by the multiplex PCR assay (Figure 1). Strains with MICs ranging from 8 to 512 mg/L (n = 184) did not possess any sul genes. One E. coli with an MIC of 512 mg/L was sulI and sulII posi-tive. Among the 107 E. coli with MICs > 2048 mg/L, the distribution of sul genes was as follows: 54 sulII positive, 30 sulI positive, 20 sulI and sulII positive; three strains lacked any of these genes. Of the 51 sulI-positive isolates, 49 carried the integron-associated integrase gene IntI 1. The genetics of clinical sulphonamide-resistant E. coli has been published recently,8 and the distribution among strains with MICs 512 mg/L resembles what we have found.
|
Resistance genes conferring ampicillin, trimethoprim and sulphonamide resistance are linked on R-plasmids that can transfer resistance between bacteria.9 In E. coli, the sulphonamide resistance conferred by sulI (on integron 1) and sulII genes has been shown to transfer between E. coli in in vitro and in vivo experiments.8,10
The common opinion in Denmark that sulphonamides and ampicillin are safe to use for empirical treatment of UTIs has to be re-evaluated in light of the resistance level and the risk of selecting for resistant bacterial populations.
|
Acknowledgements |
|---|
We thank Dr Jens Damsgaard, the general practitioners and the personnel at RAS.
|
Footnotes |
|---|
* Corresponding author. Tel: +45-32683575; Fax: +45-32683887; E-mail: mbp{at}ssi.dk
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResults and discussionReferences |
|---|
1 . Rubin, R. H., Shapiro, E. D., Andriole, V. T., Davis, R. J. & Stamm, W. E. (1992). Evaluation of new anti-infective drugs for the treatment of urinary tract infection. Infectious Diseases Society of America and the Food and Drug Administration. Clinical Infectious Diseases 15, Suppl. 1, S216–27.
2 . National Committee for Clinical Laboratory Standards. (2000). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically—Fifth Edition: Approved Standard M7-A5. NCCLS, Villanova, PA, USA.
3 . National Committee for Clinical Laboratory Standards. (2001). Performance Standards for Antimicrobial Susceptibility Testing: Approved Standard M100-S12. NCCLS, Wayne, PA, USA.
4 . Thamsborg, G. M., Balslev, I., Mabeck, C. E. & Vejlsgaard, R. (1980). Urinary tract infections in general practice. I. Clinical features and bacterial flora. Ugeskrift for Laeger 142, 1657–60.[Medline]
5
.
Kahlmeter, G. (2000). The ECO*SENS Project: a prospective, multinational, multicentre epidemiological survey of the prevalence and antimicrobial susceptibility of urinary tract pathogens—interim report. Journal of Antimicrobial Chemotherapy 46, Suppl. A, 15–22.
6 . Nissinen, A. & Huovinen, P. (2000). FiRe works—the Finnish Study Group for Antimicrobial Resistance (FiRe). Eurosurveillance 5, 133–5.
7
.
Grüneberg, R. N. (1994). Changes in urinary pathogens and their antibiotic sensitivities, 1971–1992. Journal of Antimicrobial Chemotherapy 33, Suppl. A, 1–8.
8 . Enne, V. I., Livermore, D. M., Stephens, P. & Hall, L. M. (2001). Persistence of sulphonamide resistance in Escherichia coli in the UK despite national prescribing restriction. Lancet 357, 1325–8.[Web of Science][Medline]
9
.
Amyes, S. G. (1989). The success of plasmid-encoded resistance genes in clinical bacteria. An examination of plasmid-mediated ampicillin and trimethoprim resistance genes and their resistance mechanisms. Journal of Medical Microbiology 28, 73–83.
10
.
Vorland, L. H., Carlson, K. & Aalen, O. (1985). Antibiotic resistance and small R plasmids among Escherichia coli isolates from outpatient urinary tract infections in northern Norway. Antimicrobial Agents and Chemotherapy 27, 107–13.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Trobos, H. Christensen, M. Sunde, S. Nordentoft, Y. Agerso, G. S. Simonsen, A. M. Hammerum, and J. E. Olsen Characterization of sulphonamide-resistant Escherichia coli using comparison of sul2 gene sequences and multilocus sequence typing Microbiology, March 1, 2009; 155(3): 831 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. K. Kozak, P. Boerlin, N. Janecko, R. J. Reid-Smith, and C. Jardine Antimicrobial Resistance in Escherichia coli Isolates from Swine and Wild Small Mammals in the Proximity of Swine Farms and in Natural Environments in Ontario, Canada Appl. Envir. Microbiol., February 1, 2009; 75(3): 559 - 566. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Trobos, C. H. Lester, J. E. Olsen, N. Frimodt-Moller, and A. M. Hammerum Natural transfer of sulphonamide and ampicillin resistance between Escherichia coli residing in the human intestine J. Antimicrob. Chemother., January 1, 2009; 63(1): 80 - 86. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Koljalg, K. Truusalu, I. Vainumae, J. Stsepetova, E. Sepp, and M. Mikelsaar Persistence of Escherichia coli Clones and Phenotypic and Genotypic Antibiotic Resistance in Recurrent Urinary Tract Infections in Childhood J. Clin. Microbiol., January 1, 2009; 47(1): 99 - 105. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Sharma, K. Munns, T. Alexander, T. Entz, P. Mirzaagha, L. J. Yanke, M. Mulvey, E. Topp, and T. McAllister Diversity and Distribution of Commensal Fecal Escherichia coli Bacteria in Beef Cattle Administered Selected Subtherapeutic Antimicrobials in a Feedlot Setting Appl. Envir. Microbiol., October 15, 2008; 74(20): 6178 - 6186. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Frank, V. Gautier, A. Talarmin, R. Bercion, and G. Arlet Characterization of sulphonamide resistance genes and class 1 integron gene cassettes in Enterobacteriaceae, Central African Republic (CAR) J. Antimicrob. Chemother., April 1, 2007; 59(4): 742 - 745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Agerso and A. Petersen The tetracycline resistance determinant Tet 39 and the sulphonamide resistance gene sulII are common among resistant Acinetobacter spp. isolated from integrated fish farms in Thailand J. Antimicrob. Chemother., January 1, 2007; 59(1): 23 - 27. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Mamlouk, I. Boutiba-Ben Boubaker, V. Gautier, S. Vimont, B. Picard, S. Ben Redjeb, and G. Arlet Emergence and Outbreaks of CTX-M {beta}-Lactamase-Producing Escherichia coli and Klebsiella pneumoniae Strains in a Tunisian Hospital J. Clin. Microbiol., November 1, 2006; 44(11): 4049 - 4056. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sunde and M. Norstrom The prevalence of, associations between and conjugal transfer of antibiotic resistance genes in Escherichia coli isolated from Norwegian meat and meat products J. Antimicrob. Chemother., October 1, 2006; 58(4): 741 - 747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Antunes, J. Machado, and L. Peixe Characterization of antimicrobial resistance and class 1 and 2 integrons in Salmonella enterica isolates from different sources in Portugal J. Antimicrob. Chemother., August 1, 2006; 58(2): 297 - 304. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. J. Schrag, J. L. Hadler, K. E. Arnold, P. Martell-Cleary, A. Reingold, and A. Schuchat Risk Factors for Invasive, Early-Onset Escherichia coli Infections in the Era of Widespread Intrapartum Antibiotic Use Pediatrics, August 1, 2006; 118(2): 570 - 576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Blahna, C. A. Zalewski, J. Reuer, G. Kahlmeter, B. Foxman, and C. F. Marrs The role of horizontal gene transfer in the spread of trimethoprim-sulfamethoxazole resistance among uropathogenic Escherichia coli in Europe and Canada J. Antimicrob. Chemother., April 1, 2006; 57(4): 666 - 672. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sunde Prevalence and characterization of class 1 and class 2 integrons in Escherichia coli isolated from meat and meat products of Norwegian origin J. Antimicrob. Chemother., December 1, 2005; 56(6): 1019 - 1024. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Sunde Class I Integron with a Group II Intron Detected in an Escherichia coli Strain from a Free-Range Reindeer Antimicrob. Agents Chemother., June 1, 2005; 49(6): 2512 - 2514. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. L. Ho, A. Y. M. Ho, K. H. Chow, R. C. W. Wong, R. S. Duan, W. L. Ho, G. C. Mak, K. W. Tsang, W. C. Yam, and K. Y. Yuen Occurrence and molecular analysis of extended-spectrum {beta}-lactamase-producing Proteus mirabilis in Hong Kong, 1999-2002 J. Antimicrob. Chemother., June 1, 2005; 55(6): 840 - 845. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Antunes, J. Machado, J. C. Sousa, and L. Peixe Dissemination of Sulfonamide Resistance Genes (sul1, sul2, and sul3) in Portuguese Salmonella enterica Strains and Relation with Integrons Antimicrob. Agents Chemother., February 1, 2005; 49(2): 836 - 839. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Grape, L. Sundstrom, and G. Kronvall Sulphonamide resistance gene sul3 found in Escherichia coli isolates from human sources J. Antimicrob. Chemother., December 1, 2003; 52(6): 1022 - 1024. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. B. Kerrn, N. Frimodt-Moller, and F. Espersen Effects of Sulfamethizole and Amdinocillin against Escherichia coli Strains (with Various Susceptibilities) in an Ascending Urinary Tract Infection Mouse Model Antimicrob. Agents Chemother., March 1, 2003; 47(3): 1002 - 1009. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||