Journal of Antimicrobial Chemotherapy (2002) 49, 675-678
© 2002 The British Society for Antimicrobial Chemotherapy
Brief report |
Production of the RdxA protein in metronidazole-susceptible and -resistant isolates of Helicobacter pylori cultured from treated mice
a Department of Medical Microbiology, Royal Free and University College Medical School, Rowland Hill Street, London, UK; b Unité de Pathogénie Bactérienne des Muqueuses, Institut Pasteur, 28 Rue du Dr Roux, Paris, France; c Institute of Infections and Immunity, University of Nottingham, Nottingham NG7 2UH, UK
| Abstract |
|---|
|
|
|---|
The objective of this study was to use immunoblotting with RdxA antisera to examine the production of the RdxA protein in mouse-derived metronidazole-susceptible and -resistant isolates of Helicobacter pylori. A 24 kDa immunoreactive band corresponding to RdxA was observed in all 15 metronidazole-susceptible and five of 50 metronidazole-resistant isolates. The rdxA gene of these five isolates contained missense mutations and transformation experiments confirmed that these mutations were associated with inactivation of the rdxA gene. No RdxA protein was produced in the other 45 metronidazole-resistant strains, including one in which the nucleotide sequence of the rdxA gene was unchanged. These results demonstrate a high correlation between production of the RdxA protein and susceptibility of H. pylori to metronidazole. Testing for the absence of the RdxA protein identifies the majority of strains that will respond poorly to metronidazole-containing eradication regimens.
| Introduction |
|---|
|
|
|---|
Up to 70% of clinical strains of Helicobacter pylori isolated in western Europe are resistant to the 5-nitroimidazoles and this prevalence is far higher in developing countries.1 The majority of resistance is associated with mutational inactivation of the rdxA gene, which encodes an oxygen-insensitive NADPH nitroreductase.2 Inactivation of other reductase-encoding genes, including frxA and fdxB are also associated with resistance and seem to be implicated in the transition to high-level resistance.35 Because resistance is associated with multiple changes within rdxA and possibly other reductase-encoding genes, it has not been possible to develop genotype-based assays capable of detecting metronidazole resistance in this important gastric pathogen. We have recently used immunoblot analysis with specific anti-RdxA antibody to demonstrate that there is a high correlation between production of the RdxA protein and susceptibility of H. pylori to metronidazole.6
| Materials and methods |
|---|
|
|
|---|
Bacterial strains, growth conditions and susceptibility testing
Metronidazole-susceptible and -resistant derivatives of SS1 (Table
) were cultured from the stomachs of mice that had been experimentally infected with the metronidazole-susceptible SS1 strain and then treated orally with metronidazole.7 H. pylori strains were routinely cultured on 10% horse blood medium supplemented with appropriate antibiotics as previously described.6 Susceptibility to metronidazole was assessed by agar dilution determination of the MIC.7 The MIC was defined as the lowest concentration of antibiotic inhibiting growth when the plates were read after 72 h incubation under microaerobic conditions at 37°C. Isolates were considered resistant to metronidazole if the MIC was
8 mg/L.
|
DNA sequencing
Genomic DNA from individual H. pylori strains was extracted using the QIAamp Tissue Kit (Qiagen, Crawley, UK) according to the manufacturer's instructions. DNA sequencing of the rdxA gene was carried out using two pairs of oligonucleotide primers, rdxA-1 (CGTTAGGGATTTTATTGTATGCTAC) and rdxA-2 (CCCCACAGCGATATAGCATTGCTC), and rdxA-3 (GTTAGAGTGATCCCCTCTTTTGCTC) and rdxA-4 (CACCCCTAAAAGAGCGATTAAAACC). These were used to amplify two overlapping PCR products that contained the entire rdxA gene, and the nucleotide sequences of these products were determined on both strands using the four oligonucleotide primers described above.
Protein analysis by SDSPAGE and immunoblotting
Immunoblotting with polyclonal rabbit antisera against RdxA was carried out as previously described.6 Briefly, cell extracts prepared from 2 day cultures were analysed on slab gels, comprising a 4.5% acrylamide stacking gel and a 17.5% resolving gel. Proteins were transferred to nitrocellulose membranes and reacted with RdxA antisera that had been diluted 1:100 in 50% Escherichia coli TG1 extract, 5% milk powder and 0.2% Tween in phosphate-buffered saline and incubated for 4 h at room temperature to remove non-specific antibodies to E. coli. Immunoreactants were detected with anti-rabbit peroxidase-linked immunoglobulin (Amersham, Little Chalfont, UK) diluted 1:10 000 and reaction products were visualized on autoradiographic film by chemiluminescence using the ECL Western blotting detection system (Amersham).
Natural transformation
Metronidazole-susceptible H. pylori strain SS1 was transformed using a specific PCR fragment generated from resistant strains using the oligonucleotide primers rdxA-1 and rdxA-4. Bacteria were inoculated as 1 cm patches and grown for 5 h before addition of 30 ng of the PCR fragment. After further incubation for 18 h, the bacteria from each individual patch were harvested and plated directly on to a single plate containing metronidazole 0.5 µg/mL. After 4 days incubation, single colonies were obtained, and the MIC of metronidazole for three independent transformants from each transformation was determined.
| Results |
|---|
|
|
|---|
Immunoblotting of metronidazole-susceptible and -resistant isolates of H. pylori with anti-RdxA antibody
Immunoblotting with RdxA antisera was carried out on whole bacterial cell lysates of 15 metronidazole-susceptible and 50 metronidazole-resistant isolates. The metronidazole-resistant strains included 10 in which the rdxA gene had previously been sequenced: in nine the rdxA gene contained one or more mutations (SS1-17 to SS1-25), and in one the gene sequence was identical to that of the parental SS1 strain (SS1-16).8 In all of the 15 metronidazole-susceptible strains a 24 kDa immunoreactive band corresponding to the RdxA protein was observed. The 24 kDa protein was also produced by five of the 50 metronidazole-resistant H. pylori isolates: SS1-17, SS1-18, SS1-19, SS1-52 and SS1-56 (Figure). In three of these isolates, which were isolated from the stomachs of different mice, the mutations in the rdxA gene had been identified in a previous study: SS1-17 contained Y47H and P51L amino acid substitutions; SS1-18 and SS1-19 contained P51L amino acid substitutions (Table
).8 The nucleotide sequence of the rdxA gene of the other two isolates, SS1-52 (isolated from the same mouse as SS1-19) and SS1-56 (isolated from the same mouse as SS1-17), was determined and found to contain the missense point mutation (C to T at position 153) that resulted in the P51L amino acid substitution. In the remaining 45 metronidazole-resistant strains, including strain SS1-16, which had an intact rdxA gene, no equivalent immunoreactive band corresponding to the RdxA protein was observed.
Further analysis of metronidazole-resistant H. pylori isolates that produced the RdxA protein
In order to determine whether the mutations within the rdxA gene of the metronidazole-resistant H. pylori isolates that produced the RdxA protein were associated with inactivation of rdxA, the rdxA gene of SS1-17, SS1-18, SS1-19, SS1-52 and SS1-56 was amplified and transformed into the metronidazole-susceptible, parental SS1 strain (MIC 0.0625 mg/L). PCR fragments amplified from SS1 and SS1 rdxA mutant (MIC 1.0 mg/L) were used as controls. The MIC of metronidazole for colonies isolated after transformation with the rdxA allele of the SS1 isogenic deletion mutant in rdxA (SS1 rdxA-) and strains SS1-17, SS1-18, SS1-19, SS1-52 and SS1-56 was 0.52.0 mg/L. No colonies were isolated on plates containing metronidazole 0.5 mg/L after transformation with the rdxA allele of strain SS1.
| Discussion |
|---|
|
|
|---|
We have recently reported a high correlation between production of the RdxA protein and susceptibility of H. pylori to metronidazole in clinical strains isolated from different geographical regions.6 In order to examine the factors that determine production of RdxA, we used a series of well-characterized metronidazole-resistant isolates cultured from mice that were experimentally infected with the metronidazole-susceptible H. pylori strain SS1 and then treated orally with metronidazole.7 We found that the RdxA protein is produced in all mouse-derived as well as clinical metronidazole-susceptible strains so far tested. As in our previous study, the RdxA protein was not produced by the majority (90%) of resistant strains. Sequence analysis of the rdxA gene of the five metronidazole-resistant strains that did produce the 24 kDa RdxA protein revealed that four contained missense mutations resulting in a P51L amino acid substitution, and the fifth contained two mutations giving a Y47H as well as the P51L substitution. The finding that four isolates contained the same P51L amino acid substitution is not explained by clonal expansion of a single mutant, since these strains were isolated from the stomachs of three different mice. Transformation of metronidazole-susceptible H. pylori SS1 (MIC 0.0625 mg/L) with the rdxA allele of these isolates generated transformants with MICs similar to that of an SS1 isogenic deletion mutant in rdxA (MIC 1.0 mg/L),4,9 indicating that the rdxA gene was inactivated in these strains. This confirmed that these mutant alleles were associated with inactivation of rdxA, and indicates that these strains produced a full-sized, but functionally inactive RdxA enzyme.
The rdxA gene of many metronidazole-resistant H. pylori strains contain frameshift mutations that result in the creation of a translational stop codon in the region immediately downstream of the mutation, and such strains would be predicted to produce a truncated RdxA protein.2,8,10 However, this study confirmed that production of the RdxA protein is completely abrogated in the majority of resistant strains, including five (SS1-21 to SS1-25) that contained such frameshift mutations. The finding that the RdxA protein was not produced by strain SS1-16 was particularly interesting, since this strain is one of a handful of metronidazole-resistant strains that have been reported to contain an intact rdxA gene.8 This implies that this isolate contained a mutation within the promoter region of the rdxA gene and is the first good evidence that mutations within this region are associated with the resistant phenotype.
The exact contribution of other genes to the acquisition of metronidazole resistance by H. pylori is currently unclear. However, regardless of whether other resistance mechanisms are present or not, our results demonstrate that the vast majority of resistant strains contain mutations within the rdxA gene or its promoter that prevent production of the RdxA protein or result in production of an abnormal polypeptide that is subsequently degraded. This is an important finding, since it indicates that testing for the absence of the RdxA protein would identify the majority of isolates that will respond poorly to metronidazole-containing eradication regimens and has implications for the development of assays capable of detecting metronidazole resistance in H. pylori. One major advantage of this approach is that it identifies all resistant strains carrying mutations that affect expression of the rdxA gene, including those not yet identified by nucleotide sequence analysis.
|
| Acknowledgements |
|---|
|
|
|---|
Peter J. Jenks is supported by an Advanced Fellowship for Medical, Dental and Veterinary Graduates from the Wellcome Trust, UK (Ref. 061599).
| Notes |
|---|
* Correspondence address. Institute of Infections and Immunity, Floor C, West Block, University Hospital, Queen's Medical Centre, Nottingham NG7 2UH, UK. Tel: +44-115-924-9924 ext. 42457; Fax: +44-115-970-9923; E-mail: Peter.Jenks{at}nottingham.ac.uk
| References |
|---|
|
|
|---|
1 . Dunn, B. E., Cohen, H. & Blaser, M. J. (1997). Helicobacter pylori. Clinical Microbiology Reviews 10, 72041.
2 . Goodwin, A., Kersulyte, D., Sisson, G., Veldhuyzen van Zanten, S. J., Berg, D. E. & Hoffman, P. S. (1998). Metronidazole resistance in Helicobacter pylori is due to null mutations in a gene (rdxA) that encodes an oxygen-insensitive NADPH nitroreductase. Molecular Microbiology 28, 38393.[Web of Science][Medline]
3
.
Jeong, J. Y., Mukhopadhyay, A. K., Dailidiene, D., Wang, Y., Velapatino, B., Gilman, R. H. et al. (2000). Sequential inactivation of rdxA (HP0954) and frxA (HP0642) nitroreductase genes causes moderate and high-level metronidazole resistance in Helicobacter pylori. Journal of Bacteriology 182, 508290.
4
.
Jeong, J. Y. & Berg, D. E. (2000). Mouse-colonizing Helicobacter pylori SS1 is unusually susceptible to metronidazole due to two complementary reductase activities. Antimicrobial Agents and Chemotherapy 44, 312732.
5
.
Kwon, D. H., El-Zaatari, F. A., Kato, M., Osato, M. S., Reddy, R., Yamaoka, Y. et al. (2000). Analysis of rdxA and involvement of additional genes encoding NAD(P)H flavin oxidoreductase (FrxA) and ferredoxin-like protein (FdxB) in metronidazole resistance of Helicobacter pylori. Antimicrobial Agents and Chemotherapy 44, 213342.
6
.
Latham, S. R., Owen, R. J., Elviss, N. C., Labigne, A. & Jenks, P. J. (2001). Differentiation of metronidazole-sensitive and -resistant Helicobacter pylori by immunoblotting with antisera to the RdxA protein. Journal of Clinical Microbiology 39, 30525.
7
.
Jenks, P. J., Labigne, A. & Ferrero, R. L. (1999). Exposure to metronidazole in vivo readily induces resistance in Helicobacter pylori and reduces the efficacy of eradication therapy in mice. Antimicrobial Agents and Chemotherapy 43, 77781.
8
.
Jenks, P. J., Ferrero, R. L. & Labigne, A. (1999). The role of the rdxA gene in the evolution of metronidazole resistance in Helicobacter pylori. Journal of Antimicrobial Chemotherapy 43, 7538.
9
.
Jenks, P. J., Ferrero, R. L., Tankovic, J., Thiberge, J. M. & Labigne, A. (2000). Evaluation of nitrofurantoin combination therapy of metronidazole-sensitive and -resistant Helicobacter pylori infections in mice. Antimicrobial Agents and Chemotherapy 44, 26239.
10
.
Tankovic, J., Lamarque, D., Delchier, J. C., Soussy, C. J., Labigne, A. & Jenks, P. J. (2000). Frequent association between alteration of the rdxA gene and metronidazole resistance in French and North African isolates of Helicobacter pylori. Antimicrobial Agents and Chemotherapy 44, 60813.
Received 13 August 2001; returned 6 December 2001; revised 2 January 2002; accepted 11 January 2002
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
F. Megraud and P. Lehours Helicobacter pylori Detection and Antimicrobial Susceptibility Testing Clin. Microbiol. Rev., April 1, 2007; 20(2): 280 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Megraud H pylori antibiotic resistance: prevalence, importance, and advances in testing Gut, September 1, 2004; 53(9): 1374 - 1384. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


