Journal of Antimicrobial Chemotherapy (2002) 49, 359-366
© 2002 The British Society for Antimicrobial Chemotherapy
Azidodeoxythymidine and didehydrodeoxythymidine as inhibitors and substrates of the human herpesvirus 8 thymidine kinase
Department of Virology, Royal Free and University College Medical School, University College London, Royal Free Campus, Rowland Hill Street, Hampstead, London NW3 2PF, UK
| Abstract |
|---|
|
|
|---|
Human herpesvirus 8 (HHV-8), the aetiological agent of Kaposi's sarcoma (KS), encodes many core genes that have been maintained during evolution of the Herpesviridae. Among these is a thymidine kinase (TK) homologue (ORF21), which has 12% homology to the related TK encoded by herpes simplex virus. We show that the HHV-8 TK is a functional deoxythymidine (dT) kinase, with Michaelis constants (Km) for dT and ATP of 18.5 and 6.6 µM, respectively. Using homology modelling coupled with site-directed mutagenesis, we identify Gly265, Asp362 and Phe372 as key amino acid residues involved in the catalytic process. The HHV-8 TK is competitively inhibited by azidodeoxythymidine (zidovudine) and didehydrodeoxythymidine (stavudine) and can also accept these anti-retroviral compounds as substrates. These data have implications for our understanding of changes in AIDS-KS incidence following the clinical licensing of these compounds and in the development of new therapies for KS.
| Introduction |
|---|
|
|
|---|
Human herpesvirus 8 (HHV-8) is the most recently described member of the human Herpesviridae. Following its discovery in 1994,1 in Kaposi's sarcoma (KS) tissue from AIDS patients, HHV-8 DNA has now been detected in all forms of KS,2 as well as two other AIDS-related lymphoproliferative disorders, primary effusion lymphoma (PEL)3,4 and multicentric Castleman's disease (MCD).5,6 DNA sequence analysis of the HHV-8 genome revealed close homology to the
2-herpesviruses,7 with the products of many open reading frames (ORFs) potentially able to manipulate the cellular environment.8
The virus encodes both a thymidine kinase (TK) and a herpesvirus protein kinase (PK) homologue.7,9 In the
-Herpesvirinae, the viral TK performs the initial phosphorylation of nucleosides to their monophosphate before phosphorylation by cellular kinases to the triphosphate, as eventual substrates for DNA synthesis. The herpes simplex virus (HSV) TK can monophosphorylate a broad range of substrates, including the anti-herpesvirus drugs aciclovir (ACV) and ganciclovir (GCV).10,11 However, the TK encoded by HHV-8 has greater homology to the Epstein Barr virus (EBV) TK,7 which appears to be inefficient at catalysing the phosphorylation of ACV and GCV, although it can phosphorylate thymidine analogues such as azidodeoxythymidine (zidovudine; AZT).1214 Using transfected 293 cells, the HHV-8 TK has been shown to phosphorylate GCV inefficiently,15 whereas in vitro studies have shown that HHV-8 is susceptible to GCV and cidofovir but relatively insusceptible to ACV.16 Retrospective studies of HIV-infected patient groups at risk of KS indicate that the incidence of KS was lower in patients receiving GCV or foscarnet, but not ACV.17,18
At the beginning of the AIDS epidemic, KS was one of the most common AIDS-defining illnesses. However, over the ensuing years the frequency of KS has decreased in parallel with the introduction of specific anti-HIV drugs, either as monotherapy or, more recently, as multiple combination therapy.1921 Since the EBV TK is able to phosphorylate AZT,12,14 we wished to determine whether the HHV-8 TK could phosphorylate thymidine analogues used in the treatment of HIV infection and whether these compounds could serve as inhibitors of the HHV-8 TK.
| Materials and methods |
|---|
|
|
|---|
Cloning of the HHV-8 TK
Cellular DNA was extracted, using the standard methods, from lung tissue shown to have KS by histopathology. Importantly, the male patient from whom the tissue was obtained had not received any anti-herpesvirus therapy before the diagnosis of KS but was receiving monotherapy (AZT) for HIV infection. The 1.8 kb HHV-8 TK fragment was amplified by PCR using the 5'-phosphorylated primers HHV8TK1: AGATCTGCTCAGGGATTTCTTAACCTCG, HHV8TK2: GAATTCAAGGGCCGCCAAGAAGGCTAGAC and the proof-reading enzyme BIO-X-ACT polymerase (Bioline), with the following conditions: 94°C for 2 min, then 25 cycles of 94°C for 10 s, 65°C for 30 s and 68°C for 5 min. The amplicon was cloned into the EcoRI site of the expression vector pThioHisB (Invitrogen), downstream of a thioredoxin fusion, to produce the clone pThio8TK. Clones in the correct orientation were selected by digestion with PstI. DNA sequence analysis confirmed the presence of the entire HHV-8 TK ORF. Clones harbouring the insert were then used to transform SY211, TK-deficient Escherichia coli cells, for the expression studies. In addition, the vector pThioHisB was also transformed into SY211 cells to act as a negative control for expression and enzyme kinetic assays.
Expression of HHV-8 TK
Optimal expression of HHV-8 TK was determined by time-course experiments. Protein expression was maximal following a 20 h induction period at room temperature. The conditions for expression were as follows.
Five millilitres of LuriaBertani (LB) media, including 100 mg/L ampicillin, was inoculated with a single colony and incubated overnight at 37°C in a shaking incubator. Two millilitres of the overnight culture were then used to inoculate 50 mL fresh LB (containing ampicillin) and grown at 37°C to an OD550 of 0.5 (mid-log phase). This is referred to as time t = 0. A 1 mL sample was taken and the cells pelleted in a microcentrifuge at 13 000 rpm. The supernatant was decanted and the pellet frozen at -20°C until required. Expression was induced by adding IPTG to a final concentration of 1 mM and incubating the culture at room temperature, with shaking. One millilitre samples were taken regularly over a 24 h period and pelleted and stored as above. Optimal expression was determined by SDSPAGE and western blot analysis using an Anti-Thio mouse monoclonal antibody (Invitrogen, Paisley, UK). Optimal expression consisted of 20 h induction at room temperature, as above, except that volumes were scaled up for enzymic analysis. Pellets were frozen and stored at -70°C until required.
Pellets were quickly thawed at 37°C and resuspended in 1/20 culture volumes of lysis buffer (20 mM TrisHCl, pH 8, 2.5 mM EDTA, 5 mM imidazole) and then stored on ice. Cell suspensions were sonicated with three 10 s bursts, then frozen in a methanol/dry-ice bath and thawed quickly at 37°C. After repeating the freeze/thaw sonication cycle three times, the lysates were centrifuged at 6900 rpm for 15 min at 4°C. The supernatants (soluble fraction) were decanted and pellets (insoluble fraction) resuspended in the same volume of lysis buffer.
Creation of HHV-8 TK mutants
The sequence of HHV-8 TK (aa223580) was aligned, using the program ALIGN, with that of HSV-1 TK (aa34376), whose structure has recently been elucidated by X-ray crystallography [Brookhaven database entry, pdb 1KIM (complexed with deoxythymidine, dT), pdb 1KI2 (complexed with GCV)]. The amino acid residues Gly61, Asp162 and Tyr172 of HSV-1 TK appear to be important for ATP binding, Mg2+ coordination and dT binding, respectively. Homologous, or closely related, amino acid residues of HHV-8 TK were identified as Gly265, Asp362 and Phe372 and mutated using the Promega (Southampton, UK) GeneEditor in vitro site-directed mutagenesis kit, according to the manufacturer's instructions, to create the mutants 8TK
ATP, 8TK
Mg and 8TK
dT. The three mutagenic primers used were: TK1.ATP, GGGGTAATGGGTGTGGCCAAATCAACGCTGGTC; TK2.MG, CACTGGTGCGTCTTTGCCAGGCATCTCCTCTCC and TK3.DT, TCCCCAGCAGTGGTGTGCCCTCTCATGCACCTG (bold lettering refers to incorporated mutation). DNA sequence analyses of the mutants in the nucleotide region encompassing amino acids 223580 showed that only the desired mutation had been introduced into the sequence.
TK assay
Kinase reactions were carried out in a buffer containing 160 mM TrisHCl (pH 7.5), 7.5 mM NaF, 1.6 mM DTT, 5 µM ATP, 5 µM MgCl2, 1% BSA and 5 µM [3H-methyl]dT (5.05 Ci/mmol specific activity) to a total volume of 75 µL plus 10 µL of expressed protein. Samples were incubated at 37°C and aliquots (50 µL) taken every 30 min over a 3 h period and spotted on to positively charged DE81 chromatography discs (Whatman, Kent, UK) to separate the monophosphate from the unphosphorylated dT. The discs were washed twice in 10 mM formic acid, followed by 95% ethanol, allowed to dry at room temperature and placed in vials containing 5 mL scintillant (0.4% PPO, 0.01% POPOP in toluene). Radioactivity was measured using an LKB Wallac 1217 rackbeta liquid scintillation counter. For enzyme kinetic analysis, reactions were carried out as described above but with increasing concentrations of [3H-methyl]dT (220 µM), and ATP, together with MgCl2 (520 µM), at 37°C for 3 h. For phosphorylation of nucleoside analogues, the [3H-methyl]dT was replaced by [3H-methyl]AZT (15 Ci/mmol specific activity), didehydrodeoxythymidine (d4T, 34.3 Ci/mmol specific activity) or GCV (13.5 Ci/mmol specific activity) (Moravek, CA, USA). In all cases, the results are presented as mean values of the experiments carried out in triplicate.
Nucleoside analogue inhibition
Inhibition assays were carried out as described above, first with 5 µM [3H-methyl]dT and increasing concentrations of unlabelled nucleoside analogue (0104 µM), and secondly over a range of both dT and nucleoside analogue concentrations (010 µM).
| Results |
|---|
|
|
|---|
Expression of recombinant HHV-8 TK
The HHV-8 TK homologue was amplified by PCR from DNA extracted from lung tissue of an AIDS-KS patient who had had no previous exposure to anti-herpetic drugs. The gene was cloned into the E. coli expression vector pThioHisB (Invitrogen), downstream and in-frame with the thioredoxin gene, and transformed into TK-deficient E. coli cells.14 Optimal expression of HHV-8 TK was observed at 20 h after IPTG induction and, following sonication, HHV-8 TK was present in both the pellet and soluble fractions (Figure 1
). The soluble fraction was used in all further enzymic studies.
|
Enzyme kinetics of dT phosphorylation by the HHV-8 TK
The kinetics of dT phosphorylation and determination of Michaelis constants (Km) for the reaction were carried out using [3H-methyl]dT as the substrate. The enzyme catalysed the dT phosphorylation in an ATP-dependent fashion that obeyed classical enzyme kinetics (Figure 2a and b
). The Km values for both dT and ATP, calculated from double reciprocal plots of 1/v and 1/[s], were 18.5 ± 5.9 and 6.6 ± 1.7 µM, respectively (Figure 2c and d
).
|
Identification of catalytic residues of the HHV-8 TK
Using multiple sequence alignment and homology modelling of the core region of the HHV-8 TK (amino acid residues 223580) on the three-dimensional structure of the HSV-1 TK complexed with dT and GCV,22 we identified three residues in the HHV-8 TK sequence likely to be important for binding ATP (Gly265), Mg2+ (Asp362) and dT (Phe372), as shown in Figure 3
. Following site-directed mutagenesis of these residues, each mutant was expressed to the same level as the wild-type HHV-8 TK and could be solubilized accordingly (data not shown). Enzyme kinetic analysis (Figure 4
) of the mutants showed that each was severely compromised functionally, with the 8TK
dT and 8TK
Mg mutants showing no dT phosphorylation and the 8TK
ATP showing very low levels of phosphorylation (0.4% of wild-type levels).
|
|
Inhibition of the HHV-8 TK by nucleoside analogues
Using a fixed concentration of [3H-methyl]dT, the effects of increasing amounts of unlabelled nucleoside analogue concentration on dT phosphorylation were investigated. AZT was the most potent inhibitor of dT phosphorylation, with 50% inhibition occurring at a concentration of 13 µM, versus 70 and 100 µM for bromodeoxyuridine (BrdU) and d4T, respectively. In contrast, high concentrations (5 mM) of GCV produced only a minimal reduction (6%) in dT phosphorylation (Figure 5a
). LineweaverBurk plots for AZT, BrdU and d4T showed that these compounds acted as competitive inhibitors of dT phosphorylation by HHV-8 TK, with Ki values of 2.3, 25.2 and 37.3 µM, respectively (Figure 5bd
).
|
Phosphorylation of nucleoside analogues by HHV-8 TK
To determine whether AZT, d4T or GCV could be phosphorylated by HHV-8 TK, enzyme kinetics were carried out with the tritiated analogues replacing dT. In the case of AZT, efficient phosphorylation was observed (Figure 6a
) with a Km value of 2.1 µM, whereas d4T was a less efficient substrate (data not shown). No phosphorylation of GCV was detected (Figure 6b
), consistent with the inhibition data shown in Figure 5a
.
|
| Discussion |
|---|
|
|
|---|
The TKs of the
-Herpesvirinae have been exploited for many years as activators of anti-herpesvirus drugs.10,11 However, the HHV-8 TK is more closely related to the EBV TK, which has been shown in some studies to be functionally impotent in the phosphorylation of drugs such as GCV.1214 In order to characterize HHV-8 TK, we used a prokaryotic expression-based approach, which yielded high quantities of functional protein. Enzyme kinetic analysis showed that HHV-8 TK was an efficient dT kinase, with Km values for dT and ATP of 18.5 and 6.6 µM, respectively. EBV TK has a comparable Km value for dT (22 µM), whereas that for ATP is higher (25 µM).14 However, similar analysis by Gustafson et al.22 indicates that HHV-8 TK is less active than EBV TK, with a Km value for dT of 33.2 µM. Homology modelling of a truncated form of HHV-8 TK (amino acids 223580) on HSV-1 TK was used to identify conserved amino acids previously shown for HSV-1 TK to be involved in substrate recognition23 (HHV-8 TK residues Gly265, Asp362 and Phe372). Site-directed mutagenesis of these residues produced modified HHV-8 TK proteins that were either non-functional (the Mg2+- and dT-binding site mutants) or had significantly reduced enzymic activity (in the case of the ATP-binding mutant Asp362).
HHV-8 TK could be competitively inhibited by thymidine analogues such as BrdU, AZT and d4T but not by the guanosine analogues GCV or ACV (data not shown). These data are similar to competition assays using HHV-8 TK expressed as a glutathione S-transferase (GST) fusion protein22 and consistent with the inhibition of dT phosphorylation reported for EBV TK.12,14 In the present study, Ki values for AZT and d4T were 2.3 and 37.3 µM, respectively, indicating that AZT is a potent inhibitor of dT phosphorylation by HHV-8 TK. Both AZT and d4T have been used in monotherapeutic and multiple drug regimens for the treatment of HIV infection, and it is interesting to note that plasma concentrations that exceed the Ki value for HHV-8 TK can be achieved during AZT therapy.2426 Potentially, therefore, HHV-8 may be susceptible to inhibition by AZT and, to a lesser extent, d4T. Recent data using in vitro analysis of TPA-induced BCBL-1 cells have shown that AZT is a more potent inhibitor of HHV-8 lytic replication than either GCV or cidofovir (IC50 values of 0.91 µM for AZT versus 6.7 and 3.1 µM for GCV and cidofovir, respectively).27 An important issue to address is whether the enzymic studies carried out here have clinical relevance. In this context, two observations are of note. First, epidemiological data show that the incidence of KS amongst most male homosexuals has declined following the introduction of monotherapeutic and dual therapeutic interventions using AZT, despite an increase in the numbers of HIV-infected individuals.1921 Secondly, two studies have reported improved response rates of KS when AZT was added to standard interferon-
treatment,28,29 although such responses may be a reflection of improved control of HIV infection.
In the majority of KS lesions, HHV-8 is in a controlled latent state and so would not express TK. However, the cells that express lytic cycle gene products may play an important paracrine role in the pathogenesis of HHV-8-associated disease. It could then be argued that an increase in cells newly infected with HHV-8 could also be considered as an increase in the pool of cells able to induce KS lesions. Therefore, by inhibiting HHV-8 replication, the action of AZT would be to inhibit expansion of such pools, and in so doing prevent new KS lesions being induced.
Our data also show that AZT and d4T were not only competitive inhibitors of the HHV-8 TK but were also substrates for the enzyme. In contrast, we could not detect any phosphorylation of GCV, despite multiple experiments with many different enzyme/substrate concentrations. These data are consistent with similar studies with heterologously expressed EBV TK,1214 but they contrast with some studies using mammalian cell transfection approaches.30 Recent data show that the HHV-8 PK homologue is more efficient than the HHV-8 TK at phosphorylation of GCV.15 Since the Km value for AZT was 2.1 µM, it is a 10-fold more efficient substrate for the HHV-8 TK than its natural substrate, dT. In vivo, this effect would serve to increase intracellular levels of AZT monophosphate and hence the levels of active triphosphate. However, build-up of AZT monophosphate is associated with cell toxicity, due to inhibition of cellular thymidylate kinase. Gustafson et al.22 report that HHV-8 TK has thymidylate kinase activity, in addition to TK activity, thus bypassing this inhibition by diphosphorylating AZT. Since the seropositivity of HHV-8 amongst HIV-positive individuals is relatively high (e.g. HHV-8 seroprevalence rates in male homosexuals are between 30 and 50%),31 the relevance of a virally encoded enzyme being able to activate AZT specifically should not be underestimated. Indeed, HHV-8 latency has been identified in cells of monocytic origin, which are also important sites for HIV replication.32
In conclusion, we have shown that established antiherpetic agents are extremely poor substrates for the HHV-8 TK, although agents currently used for the treatment of HIV infection both inhibit the HHV-8 TK and are phosphorylated by its action. Further studies are warranted to determine whether other anti-retroviral nucleoside analogues are substrates for the HHV-8 TK and to identify inhibitors of this enzyme for the therapy of KS.
| Acknowledgements |
|---|
|
|
|---|
We would like to thank Dr William Summers of Yale University for kindly providing the TK-deficient E. coli strain SY211. This work was supported by departmental funds.
| Notes |
|---|
* Corresponding author. Tel: +44-20-7830-2997; Fax: +44-20-7830-2854; E-mail: v.emery{at}rfc.ucl.ac.uk
| References |
|---|
|
|
|---|
1 . Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. et al. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266, 18659.
2
.
Chang, Y., Ziegler, J., Wabinga, H., Katangole-Mbidde, E., Boshoff, C., Schulz, T. F. et al. (1996). Kaposi's sarcoma-associated herpesvirus DNA sequences are present in African endemic and AIDS-associated Kaposi's sarcoma. Archives of Internal Medicine 156, 2024.
3
.
Cesarman, E., Chang, Y., Moore, P. S., Said, J. W. & Knowles, D. M. (1995). Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body cavity based lymphomas. New England Journal of Medicine 332, 118691.
4
.
Nador, R. G., Cesarman, E., Chadburn, A., Dawson, D. B., Ansari, M. Q., Said, J. et al. (1996). Primary effusion lymphoma: a distinct clinicopathologic entity associated with the Kaposi's sarcoma-associated herpesvirus. Blood 88, 64556.
5
.
Gessain, A., Sudaka, A., Briere, J., Frouchard, N., Nicola, M. A., Rio, B. et al. (1996). Kaposi's sarcoma-associated herpes-like virus (human herpesvirus type 8) DNA sequences in multicentric Castleman's disease: is there any relevant association in non-human immunodeficiency virus-infected patients? Blood 87, 4146.
6
.
Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals-Hatem, C., Babinet, P. et al. (1995). Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood 86, 127680.
7 . Moore, P. S., Gao, S.-J., Dominguez, G., Cesarman, E., Lungu, O., Knowles, D. M. et al. (1996). Primary characterization of a herpesvirus agent associated with Kaposi's sarcoma. Journal of Virology 70, 54958.[Abstract]
8 . Schulz, T. (1998). Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8). Journal of General Virology 79, 157391.[Web of Science][Medline]
9
.
Russo, J. J., Bohenzky, R. A., Chien, M.-C., Chen, J., Yan, M., Maddalena, D. et al. (1996). Nucleotide sequences of Kaposi's sarcoma-associated herpesvirus (HHV-8). Proceedings of the National Academy of Sciences, USA 93, 148628.
10
.
Cheng, Y.-C., Dutschman, G., Fox, J. J., Watanabe, K. A. & Machida, H. (1981). Differential activity of potential antiviral nucleoside analogs on herpes simplex virus-induced and human cellular thymidine kinases. Antimicrobial Agents and Chemotherapy 20, 4203.
11 . De Clercq, E. (1993). Antivirals for the treatment of herpesvirus infections. Journal of Antimicrobial Chemotherapy 32, 12132.
12
.
Gustafson, E. A., Chillemi, A. C., Sage, D. R. & Fingeroth, J. D. (1998). The EpsteinBarr virus thymidine kinase does not phosphorylate ganciclovir or acyclovir and demonstrates a narrow substrate specificity compared to the herpes simplex virus type 1 thymidine kinase. Antimicrobial Agents and Chemotherapy 42, 292331.
13
.
Littler, E. & Arrand, J. R. (1988). Characterization of the EpsteinBarr virus-encoded thymidine kinase expressed in heterologous eukaryotic and prokaryotic systems. Journal of Virology 62, 38925.
14
.
Tung, P. P. & Summers, W. C. (1994). Substrate specificity of EpsteinBarr virus thymidine kinase. Antimicrobial Agents and Chemotherapy 38, 21759.
15
.
Cannon, J. S., Hamzeh, F., Moore, S., Nicholas, J. & Ambinder, R. F. (1999). Human herpesvirus 8-encoded thymidine kinase and phosphotransferase homologues confer sensitivity to ganciclovir. Journal of Virology 73, 478693.
16 . Medveczky, M. M., Horvath, E., Lund, T. & Medveczky, P. G. (1997). In-vitro antiviral drug sensitivity of the Kaposi's sarcoma-associated herpesvirus. AIDS 11, 132732.[Web of Science][Medline]
17 . Glesby, M. J., Hoover, D., Weng, S., Graham, N., Phair, J., Detels, R. et al. (1996). Use of anti-herpes drugs and the risk of Kaposi's sarcoma: data from the multicenter AIDS cohort study. Journal of Infectious Diseases 173, 147780.[Web of Science][Medline]
18 . Mocroft, A., Youle, M., Gazzard, B., Morinek, J., Halai, R. & Phillips, A. (1996). Anti-herpesvirus treatment and risk of Kaposi's sarcoma in HIV infection. AIDS 10, 11015.[Web of Science][Medline]
19 . Dore, G. J., Li, Y., Grulich, A. E., Hoy, J. F., Mallal, S. A., Mijch, A. M. et al. (1996). Declining incidence and later occurrence of Kaposi's sarcoma among persons with AIDS in Australia: the Australian AIDS cohort. AIDS 10, 14016.[Web of Science][Medline]
20 . Hermans, P. (1998). Epidemiology, etiology and pathogenesis, clinical presentations and therapeutic approaches in Kaposi's sarcoma: 15-year lessons from AIDS.Biomedicine and Pharmacotherapy 52, 4406.
21 . Montaner, J. S., Le, T., Hogg, R., Ricketts, M., Sutherland, D., Strathdee, S. A. et al. (1994). The changing spectrum of AIDS index diseases in Canada. AIDS 8, 6936.[Web of Science][Medline]
22
.
Gustafson, E. A., Schinazi, R. F. & Fingeroth, J. D. (2000). Human herpesvirus 8 open reading frame 21 is a thymidine and thymidylate kinase of narrow substrate specificity that phosphorylates zidovudine but not ganciclovir. Journal of Virology 72, 68492.
23 . Brown, D. G., Visse, R., Sandhu, G., Davies, A., Rizkallah, P. J., Melitz, C. et al. (1995). Crystal structures of the thymidine kinase from herpes simplex virus type-I in complex with deoxythymidine and ganciclovir. Nature Structural Biology 2, 87681.[Web of Science][Medline]
24 . Borvak, J., Kasanicka, J. & Mayer, V. (1992). HPLC-monitoring of AZT in HIV-infected patient's plasma: a critical study. Acta Virologica 36, 42834.[Web of Science][Medline]
25
.
Morse, G. D., Portmore, A., Olson, J., Taylor, C., Plank, C. & Reichman, R. C. (1990). Multiple-dose pharmacokinetics of oral zidovudine in hemophilia patients with human immunodeficiency virus infection. Antimicrobial Agents and Chemotherapy 34, 3947.
26 . Wintergerst, U., Rolinski, B., Vocks-Hauck, M., Wahn, V., Debatin, K. M., Hotheis, G. et al. (1995). Pharmacokinetics of orally administered zidovudine in HIV-infected children and adults. Infection 23, 3448.[Web of Science][Medline]
27 . Fletcher, T., Halliday, S., Wargo, H. & Buckheit, R. W. (1999). Development of a moderate-throughput assay by using Taqman PCR technology to identify inhibitors of human herpesvirus 8 (HHV-8). In Programs and Abstracts of the Thirty-ninth Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, CA, 1999. Abstract 1333, p. 1524. American Society for Microbiology, Washington, DC.
28
.
Fischl, M. A., Finklestein, D. M., He, W., Powderly, W. G., Triozza, P. L. & Steigbigel, R. T. (1996). A phase II study of recombinant human interferon-
2a and zidovudine in patients with AIDS-related Kaposi's sarcoma. AIDS clinical trials group. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 11, 37984.[Web of Science][Medline]
29
.
Krown, S. E., Gold, J. W. M., Niedzwiecki, D., Bundow, D., Flomenberg, N., Gansbacher, B. et al. (1990). Interferon-
with zidovudine: safety, tolerance and clinical and virological effects in patients with Kaposi's sarcoma associated with the acquired immunodeficiency syndrome (AIDS). Annals of Internal Medicine 112, 81221.
30 . Moore, S. M., Cannon, J. S., Tanhehco, Y. C., Hamzeh, F. M. & Ambinder, R. F. (2001). Induction of EpsteinBarr virus kinases to sensitize tumor cells to nucleoside analogues. Antimicrobial Agents and Chemotherapy 43, 208291.
31 . Kedes, D. H., Operskalski, E., Busch, M., Kohn, R., Flood, J. & Ganem, D. (1996). The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nature Medicine 2, 91824.[Web of Science][Medline]
32 . Blasig, C., Zietz, C., Haar, B., Neipel, F., Esser, S., Brockmeyer, N. H. et al. (1997). Monocytes in Kaposi's sarcoma lesions are productively infected by human herpesvirus 8. Journal of Virology 71, 79638.[Abstract]
Received 28 November 2000; returned 12 March 2001; revised 24 September 2001; accepted 6 November 2001
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
M. B. Gill, J. L. Kutok, and J. D. Fingeroth Epstein-Barr Virus Thymidine Kinase Is a Centrosomal Resident Precisely Localized to the Periphery of Centrioles J. Virol., June 15, 2007; 81(12): 6523 - 6535. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Gill, J.-E. Murphy, and J. D. Fingeroth Functional Divergence of Kaposi's Sarcoma-Associated Herpesvirus and Related Gamma-2 Herpesvirus Thymidine Kinases: Novel Cytoplasmic Phosphoproteins That Alter Cellular Morphology and Disrupt Adhesion J. Virol., December 1, 2005; 79(23): 14647 - 14659. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gaspar, E. De Clercq, and J. Neyts Human Herpesvirus 8 Gene Encodes a Functional Thymidylate Synthase J. Virol., September 11, 2002; 76(20): 10530 - 10532. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


), but no increase for the control (, pThioHisB). (b) An increase in phosphorylation with increasing dT and ATP concentration (
, 20 µM;
, 15 µM; , 10 µM;
, control). (c and d) LineweaverBurk plots for dT and ATP. The Michaelis constants KdT and KATP are determined from the points at which the lines converge on the x-axis. Linear regression analysis was used to compute the line of best fit through the data points.



