Journal of Antimicrobial Chemotherapy (2001) 48, 915-918
© 2001 The British Society for Antimicrobial Chemotherapy
Brief report |
Evaluation of PCR primers to screen for Streptococcus pneumoniae isolates and ß-lactam resistance, and to detect common macrolide resistance determinants
a Department of Pathology (Clinical Microbiology), Hershey Medical Center, 500 University Drive, Hershey, PA 17033, USA; b Pharmaceutical Research Center, Meiji Seika Kaisha, Ltd, Kohoku-ku, Yokohama 222-8567, Japan; c Department of Pathology (Clinical Microbiology), Case Western Reserve University, Cleveland, OH 44106, USA; d Institute of Microbial Chemistry, Shinagawa-ku, Tokyo, 141-0021, Japan
| Abstract |
|---|
|
|
|---|
Pneumococcal isolates (n = 148) from various countries (mostly from the USA) were tested by a primer set for PCR. Thirty-eight (86.4%) of the 44 penicillin G-susceptible isolates (MIC
0.06 mg/L) had unaltered pbps, while six isolates (13.6%) had either one or two alterations in pbps. Of 47 penicillin G-resistant strains (MIC
2 mg/L), 41 isolates (87.2%) had all three pbps altered, six isolates (12.8%) had altered pbp1a + 2x. Various combinations of altered pbp were seen in penicillin G-intermediate isolates. Prevalence of macrolide resistance genes mef(A) and erm(B) in isolates was clearly reflected by their MICs. All isolates were positive for lytA. The primers were useful for screening for Streptococcus pneumoniae and ß-lactam resistance, and for detection of common macrolide resistance determinants. | Introduction |
|---|
|
|
|---|
A primer set for PCR, which was designed by one of the authors (K.U.), detects the following: unaltered pbp genes based on the pbp sequences of the penicillin G-susceptible Streptococcus pneumoniae R6 strain for PBP1A, 2X, 2B;13 macrolide-resistant genes mef(A) and erm(B);4,5 autolysin gene (lytA)6 as screening of S. pneumoniae. It is marketed in Japan only for research use. PCR results using the primers correctly reflected antimicrobial susceptibilities of S. pneumoniae clinically isolated in Japan.7 Since those studies were published, however, primers for pbp1a, pbp2x and pbp2b were changed to those used in the current study. We therefore evaluated the efficacy of the new primers for pneumococci isolated in countries other than Japan.
| Materials and methods |
|---|
|
|
|---|
Bacteria
We tested 148 clinical isolates of S. pneumoniae screened by optochin susceptibility and bile solubility collected during the past 5 years from the following countries: Bulgaria (n = 3), Canada (n = 9), Greece (n = 16), Poland (n = 1), Romania (n = 6), Slovenia (n = 8), South Africa (n = 2), Spain (n = 4) and the USA (n = 99).
Susceptibility testing
Agar dilution MICs of penicillin G (Sigma, St Louis, MO, USA), ceftriaxone (Sigma), erythromycin (Abbott Laboratories, Chicago, IL, USA), azithromycin (Pfizer, Groton, CT, USA) and clindamycin (Pharmacia & Upjohn, Kalamazoo, MI, USA) were determined.8 Each compound was obtained from its manufacturer. Standard quality control strains, including S. pneumoniae ATCC 49619, were included in each run. NCCLS susceptibility breakpoints9 were used to interpret MICs.
PCR primers
The sequences of the primers used for PCR are as follows: lytA: 5'-681CAACCGTACAGAATGAAGCGG701-3', 5'-999TTATTCGTGCAATACTCGTGCG978-3'; pbp1a: 5'-2256AAACAAGGTCGGACTCAACC2275-3', 5'-2450AT ATACATTGGTTTATAGTAAGTT2427-3'; pbp2x: 5'-1255CCAGGTTCCACTATGAAAGTG1275-3', 5'-1451ATC CCAACGTTACTTGAGTGT1431-3'; pbp2b: 5'-1566CCTA TATGGTCCAAACAGCCT1586-3', 5'-1693GGTCAATTC CTGTCGCAGTA1712-3'; mef(A): 5'-180CTGTATGGAG CTACCTGTCTGG199-3', 5'-581CCCAGCTTAGGTATACGTAC562-3'; erm(B): 5'-721CGTACCTTGGATATT CACCG740-3', 5'-944GTAAACAGTTGACGATATTCT CG922-3'.
The oligonucleotide primers for detection of three pbp genes were designed to amplify parts of the pbp1a, 2x and 2b genes only in susceptible strains. These parts were positioned in blocks of highly diverged sequences identified in the mosaic pbp genes of penicillin non-susceptible S. pneumoniae. Primer mixture A contained the primers for detecting lytA and pbp1a genes, primer mixture B contained the primers for detecting pbp2x and 2b genes, and primer mixture C contained the primers for detectin mef(A) and erm(B). Each primer mixture (100 µL), which contained 0.1 µM of each primer and 8 mM dNTPs, is available commercially in Japan (Wakunaga Pharmaceutical, Co., Ltd, Hiroshima, Japan). Before testing, 50 µL of 10x PCR buffer (50 mM KCl, 10 mM TrisHCl pH 8.4, 1.5 mM MgCl2), 20 U of Tth DNA polymerase (Toyobo, Co., Ltd, Osaka, Japan) and 348 µL of dH2O, were added to each primer mixture. Then, it was divided into 30 µL aliquots and stored at -30°C.
PCR condition
A single colony of S. pneumoniae grown on a blood agar plate was suspended in 30 µL of lysis solution. The composition of the lysis solution has been reported previously.7 The tubes with the lysis solution were set into a thermal cycler (GeneAmp 9700; PE Applied Biosystems, Foster City, CA, USA) and incubated at 60°C for 10 min and 94°C for 5 min. These lysates were then used as template DNA for PCR.
Next, 2 µL of the bacterial lysate was added to each of three tubes containing primer mixtures A, B and C. A positive and negative control was included in each run. PCR was performed with the thermal cycler for 30 cycles at 94°C for 15 s, 30 cycles at 53°C for 15 s and 30 cycles 72°C for 15 s. Following amplification, 10 µL of each of the three PCR products was electrophoresed on a 3% agarose gel (Agarose LE; Promega Co., Madison, WI, USA) for 40 min at 100 V.
For interpretation of PCR results, the three bands were seen on the agarose gel if the isolate did not have altered (abnormal) pbps, while one or more of these bands were not detected for strains with alterations in the pbps. Bands appeared on the gel if the isolate has the erm(B) and/or mef(A) gene. The positions of DNA fragments amplified from a positive control in this primer mix and three isolates tested are shown in the Figure
.
|
| Results |
|---|
|
|
|---|
The MIC50s/MIC90s for the 148 pneumococcal isolates were: penicillin G 0.5/4, ceftriaxone 0.25/1, erythromycin 0.06/>64, azithromycin 0.12/>64 and clindamycin 0.06/ >64 mg/L. The percentage distribution of isolates susceptible/intermediate/resistant to each compound was: penicillin G 29.7/37.8/32.4 (44 S, 56 I, 48 R), ceftriaxone 68.9/21.6/9.5, erythromycin 56.8/2.0/41.2, azithromycin 56.8/4.0/39.2 and clindamycin 68.9/0/31.1.
PCR results and the MIC distribution of penicillin G and ceftriaxone are shown in the Table
. Thirty-eight (86.4%, 95% CI 72.794.8) of the 44 penicillin G-susceptible isolates (MIC
0.06 mg/L) had unaltered pbps, while six isolates (13.6%, 95% CI 5.227.4) had either one or two alterations in pbps. Twenty-four of the 58 (41.4%, 95% CI 28.655.1) penicillin G-intermediate isolates had alterations in all three pbps, 17 isolates (32.1%, 95% CI 20.346.0) had two pbps altered and 20 isolates (34.5%, 95% CI 22.548.1) had one pbp altered. Of 47 penicillin G-resistant isolates (MIC
2 mg/L), 41 isolates (87.3%, 95% CI 74.395.2) had all three pbps altered, six isolates (12.8%, 95% CI 4.825.7) had altered pbp1a + 2x.
|
The MICs of ceftriaxone for 63 of the 73 isolates that had pbp1a + 2x or all three pbps altered ranged between 0.5 and 8 mg/L (86.3%, 95% CI 76.393.2). Thirty-one (49.2%, 95% CI 36.462.1) of the 63 isolates with pbp1a + 2x or all three pbps altered were ceftriaxone intermediate (MIC 1 mg/L), and 14 of the 63 (22.2%, 95% CI 12.734.5) isolates were ceftriaxone resistant (MIC
2 mg/L). Of 102 ceftriaxone-susceptible isolates (MIC range 0.0160.5 mg/L), alterations in either pbp1a or 2x were found in 59 isolates (57.8%, 95% CI 47.767.6). All 84 pneumococcal isolates that were susceptible to erythromycin, azithromycin and clindamycin, were negative for both mef(A) and erm(B). MIC90s (MIC ranges) (mg/L) for these isolates were: 0.06 (<0.0080.12), erythromycin; 0.12 (0.0160.25), azithromycin; 0.06 (0.0160.12), clindamycin. mef(A) was found in 18 isolates with MIC90s (MIC ranges) (mg/L) of 8 (0.58), erythromycin; 8 (116), azithromycin; 0.12 (0.030.12), clindamycin. All 18 strains with mef(A) were susceptible to clindamycin.
erm(B) was found in 43 isolates for which the MIC90s were >64 mg/L of erythromycin (MIC range 2>64 mg/L), azithromycin (MIC range 8>64 mg/L) and clindamycin (MIC range 2>64 mg/L). Three isolates had both mef(A) and erm(B), and MICs for these isolates were >64 mg/L of erythromycin, azithromycin and clindamycin.
All 148 isolates were optochin sensitive, bile soluble and were positive for lytA by PCR. Positive and negative controls were detected correctly in each run.
| Discussion |
|---|
|
|
|---|
The primers tested in this study detect lytA gene, pbp1a, 2b and 2x gene alterations, and erm(B) and mef(A) macrolide resistance genes. Furthermore, the results can be obtained within 3 h of testing one pneumococcal colony growing on a plate.
Optochin susceptibility and bile solubility have been recommended for screening for S. pneumoniae; however, the lytA gene seemed to have good reliability for screening of pneumococci in this study. The specificity of the lytA gene for S. pneumoniae had already been tested when the primers were developed. Streptococcus oralis, Streptococcus mitis, Streptococcus salivarius, Staphylococcus aureus and Staphylococcus epidermidis were all lytA negative; only S. pneumoniae proved lytA positive (K. Ubukata, unpublished data).
Determination of the pbp genotype seemed to be useful in estimating the degree of penicillin G resistance in our study. Six penicillin G-susceptible isolates (MIC range 0.030.06 mg/L) had one or two altered pbp(s) by PCR. Similar patterns have been seen in a previous study.7 Antibiotic treatment of the latter strains, especially in meningitis, should be chosen carefully because these strains may not be detected by conventional oxacillin screening, but may also have altered pbps.
MICs of ceftriaxone for isolates with alteration of pbp1a + 2x or all three pbps were higher (
0.5 mg/L) and those patterns of altered pbps might be useful in estimating isolates with higher MICs of this agent. However, 10 isolates for which ceftriaxone MICs were 0.060.25 mg/L also had these alterations. DNA sequencing of pbp1a, 2x and 2b for six of the latter isolates (penicillin G MICs 0.250.5 mg/L) showed that there was no mutation in the 370SerThrMetLys373 motif, which is the area of conserved amino acids in pbp1a. The primers for pbp1a were located c. 240 bp away from the SerThrMetLys region, and those isolates that had altered pbp2x + 2b had point mutations in the region of the pbp1a primers. These results indicate that the results of pbp1a PCR for those six isolates were false positive and re-design of pbp1a primers is necessary to detect isolates in those categories more accurately.
Macrolide resistance mechanisms, erm(B) and mef(A), were accurately detected and correlated with MICs of erythromycin, azithromycin and clindamycin. The PCR results in this study matched our previous results (P. C. Appelbaum, unpublished data), which had been been determined already using other primers described by Sutcliffe et al.10
In summary, the primers that we tested may be helpful for rapid screening of pneumococcal isolates from patients with severe systemic infection such as meningitis or life-threatening pneumonia, where rapid MIC results are necessary. It was also thought to be useful for detection of common macrolide resistance. However, more appropriate primers are required to detect and distinguish ß-lactam resistance accurately.
| Notes |
|---|
* Corresponding author. Tel: +1-717-531-4140; Fax: +1-717-531-7953; E-mail: knagai{at}psu.edu
| References |
|---|
|
|
|---|
1 . Dowson, C. G., Hutchinson, A. & Spratt, B. G. (1989). Nucleotide sequence of the penicillin-binding protein 2B gene of Streptococcus pneumoniae strain R6. Nucleic Acids Research 17, 7518.
2 . Laible, G., Hakenbeck, R., Sicard, M. A., Joris, B. & Ghuysen, J.-M. (1989). Nucleotide sequences of the pbpX genes encoding the penicillin-binding proteins 2X from Streptococcus pneumoniae R6 and a cefotaxime-resistant mutant, C506. Molecular Microbiology 3, 133748.[Web of Science][Medline]
3
.
Martin, C., Briese, T. & Hakenbeck, R. (1992). Nucleotide sequences of genes encoding penicillin-binding proteins from Streptococcus pneumoniae and Streptococcus oralis with high homology to Escherichia coli penicillin-binding proteins 1a and 1b. Journal of Bacteriology 174, 451723.
4 . Tait-Kamradt, A., Clancy, J., Cronan, M., Dib-Haji, F., Wondrack, L., Yuan, W. et al. (1997). mefE is necessary for the erythromycin-resistant M phenotype in Streptococcus pneumoniae. Antimicrobial Agents and Chemotherapy 41, 22515.[Abstract]
5 . Trieu-Cuot, P., Poyart-Salmeron, C., Carlier, C. & Courvalin, P. (1990). Nucleotide sequence of the erythromycin resistance gene of the conjugative transposon Tn1545. Nucleic Acids Research 18, 3360.
6 . Garcia, P., Garcia, J. L., Garcia, E. & Lopez, R. (1986). Nucleotide sequence and expression of the pneumococcal autolysin gene from its own promotor in Escherichia coli. Gene 43, 26572.[Web of Science][Medline]
7 . Ubukata, K., Muraki, T., Igarashi, A., Asahi, Y. & Konno, M. (1997). Identification of penicillin and other beta-lactam resistance in Streptococcus pneumoniae by polymerase chain reaction. Journal of Infection and Chemotherapy 3, 1907.
8 . Nagai, K., Matsuo, Y., Tsumura, N., Sakata, Y. & Kato. H. (2000). Antimicrobial susceptibilities and serotypes of Streptococcus pneumoniae in southwestern Japan and correlation of penicillin-binding protein 2b and 2x mutations in susceptibilities of penicillin G and cefotaxime. Diagnostic Microbiology and Infectious Disease 37, 10713.[Web of Science][Medline]
9 . National Committee for Clinical Laboratory Standards. (2000). Method for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow AerobicallyFifth Edition: Approved Standard M7-A5. NCCLS, Wayne, PA.
10 . Sutcliffe, J., Grebe, T., Tait-Kamradt, A. & Wondrack, L. (1996). Detection of erythromycin-resistant determinants by PCR. Antimicrobial Agents and Chemotherapy 40, 25626.[Abstract]
Received 25 June 2001; returned 3 August 2001; revised 28 August 2001; accepted 4 September 2001
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
K. Y. Fukushima, K. Yanagihara, Y. Hirakata, K. Sugahara, Y. Morinaga, S. Kohno, and S. Kamihira Rapid Identification of Penicillin and Macrolide Resistance Genes and Simultaneous Quantification of Streptococcus pneumoniae in Purulent Sputum Samples by Use of a Novel Real-Time Multiplex PCR Assay J. Clin. Microbiol., July 1, 2008; 46(7): 2384 - 2388. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Szabo, O. Dobay, M. Erdos, A. Borbely, F. Rozgonyi, and L. Marodi Recurrent infection with genetically identical pneumococcal isolates in a patient with interleukin-1 receptor-associated kinase-4 deficiency J. Med. Microbiol., June 1, 2007; 56(6): 863 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Suzuki, M. Yuyama, S. Maeda, H. Ogawa, K. Mashiko, and Y. Kiyoura Genotypic identification of presumptive Streptococcus pneumoniae by PCR using four genes highly specific for S. pneumoniae J. Med. Microbiol., June 1, 2006; 55(6): 709 - 714. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Davignon, E. A. Walter, K. M. Mueller, C. P. Barrozo, D. A. Stenger, B. Lin, and on behalf of the Epidemic Outbreak Surveillance Co Use of Resequencing Oligonucleotide Microarrays for Identification of Streptococcus pyogenes and Associated Antibiotic Resistance Determinants J. Clin. Microbiol., November 1, 2005; 43(11): 5690 - 5695. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Chiba, R. Kobayashi, K. Hasegawa, M. Morozumi, E. Nakayama, T. Tajima, S. Iwata, K. Ubukata, and on behalf of the Acute Respiratory Diseases Study Antibiotic susceptibility according to genotype of penicillin-binding protein and macrolide resistance genes, and serotype of Streptococcus pneumoniae isolates from community-acquired pneumonia in children J. Antimicrob. Chemother., October 1, 2005; 56(4): 756 - 760. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Suzuki, M. Seki, Y. Nakano, Y. Kiyoura, M. Maeno, and Y. Yamashita Discrimination of Streptococcus pneumoniae from Viridans Group Streptococci by Genomic Subtractive Hybridization J. Clin. Microbiol., September 1, 2005; 43(9): 4528 - 4534. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. W. Klaassen and J. W. Mouton Molecular Detection of the Macrolide Efflux Gene: To Discriminate or Not To Discriminate between mef(A) and mef(E) Antimicrob. Agents Chemother., April 1, 2005; 49(4): 1271 - 1278. [Full Text] [PDF] |
||||
![]() |
M. Seki, Y. Yamashita, H. Torigoe, H. Tsuda, S. Sato, and M. Maeno Loop-Mediated Isothermal Amplification Method Targeting the lytA Gene for Detection of Streptococcus pneumoniae J. Clin. Microbiol., April 1, 2005; 43(4): 1581 - 1586. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kobayashi, M. Konomi, K. Hasegawa, M. Morozumi, K. Sunakawa, and K. Ubukata In Vitro Activity of Tebipenem, a New Oral Carbapenem Antibiotic, against Penicillin-Nonsusceptible Streptococcus pneumoniae Antimicrob. Agents Chemother., March 1, 2005; 49(3): 889 - 894. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Decousser, P. Pina, F. Viguier, F. Picot, P. Courvalin, and P. Allouch Invasive Streptococcus pneumoniae in France: Antimicrobial Resistance, Serotype, and Molecular Epidemiology Findings from a Monthly National Study in 2000 to 2002 Antimicrob. Agents Chemother., September 1, 2004; 48(9): 3636 - 3639. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sanbongi, T. Ida, M. Ishikawa, Y. Osaki, H. Kataoka, T. Suzuki, K. Kondo, F. Ohsawa, and M. Yonezawa Complete Sequences of Six Penicillin-Binding Protein Genes from 40 Streptococcus pneumoniae Clinical Isolates Collected in Japan Antimicrob. Agents Chemother., June 1, 2004; 48(6): 2244 - 2250. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ubukata, N. Chiba, K. Hasegawa, R. Kobayashi, S. Iwata, and K. Sunakawa Antibiotic Susceptibility in Relation to Penicillin-Binding Protein Genes and Serotype Distribution of Streptococcus pneumoniae Strains Responsible for Meningitis in Japan, 1999 to 2002 Antimicrob. Agents Chemother., May 1, 2004; 48(5): 1488 - 1494. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hasegawa, N. Chiba, R. Kobayashi, S. Y. Murayama, S. Iwata, K. Sunakawa, and K. Ubukata Rapidly Increasing Prevalence of {beta}-Lactamase-Nonproducing, Ampicillin-Resistant Haemophilus influenzae Type b in Patients with Meningitis Antimicrob. Agents Chemother., May 1, 2004; 48(5): 1509 - 1514. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Mudany, K. Kikuchi, K. Totsuka, and T. Uchiyama Evaluation of a new serotyping kit for Streptococcus pneumoniae J. Med. Microbiol., November 1, 2003; 52(11): 975 - 980. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Dobay, F. Rozgonyi, E. Hajdu, E. Nagy, M. Knausz, and S. G. B. Amyes Antibiotic susceptibility and serotypes of Streptococcus pneumoniae isolates from Hungary J. Antimicrob. Chemother., April 1, 2003; 51(4): 887 - 893. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hoshino, H. Watanabe, R. Sugita, N. Asoh, S. A. Ntabaguzi, K. Watanabe, K. Oishi, and T. Nagatake High Rate of Transmission of Penicillin-Resistant Streptococcus pneumoniae between Parents and Children J. Clin. Microbiol., November 1, 2002; 40(11): 4357 - 4359. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




