Journal of Antimicrobial Chemotherapy (2001) 47, 581-587
© 2001 The British Society for Antimicrobial Chemotherapy
The activity of 14-hydroxy clarithromycin, alone and in combination with clarithromycin, against penicillin- and erythromycin-resistant Streptococcus pneumoniae
The Infectious Diseases Research Laboratory at The University of Toledo, College of Pharmacy, 2801 W. Bancroft Street, Toledo, OH 43606, USA
| Abstract |
|---|
|
|
|---|
There are no data regarding the activity of clarithromycin's active metabolite, 14-hydroxy clarithromycin, against penicillin-intermediate, penicillin-resistant or erythromycin-resistant Streptococcus pneumoniae. Agar dilution MICs were determined for clarithromycin, 14-hydroxy clarithromycin (henceforth called metabolite), azithromycin, erythromycin and clarithromycin/metabolite (2:1 and 1:1 ratio) against 24 penicillin-intermediate and 14 penicillin-resistant strains, including 13 erythromycin-resistant clinical strains and one ATCC strain of S. pneumoniae. The interaction between clarithromycin and its metabolite was determined using an agar chequerboard assay against all isolates, and timekill tests were performed against five penicillin-intermediate (macrolide-susceptible) and five penicillin-resistant (two macrolide-resistant) strains of S. pneumoniae using all antibiotics alone at simulated peak serum concentrations, and clarithromycin/metabolite in a 2:1 ratio (physiological). MICs were as follows: clarithromycin, 0.008>64 mg/L; metabolite, 0.015>64 mg/L; erythromycin, 0.015>64 mg/L; azithromycin, 0.125>64 mg/L; clarithromycin/metabolite (1:1 and 2:1 combinations), 0.001>64 mg/L. The MIC of the clarithromycin/metabolite combination was one or more tube dilution lower than the MIC of clarithromycin in 28 of the isolates tested. In chequerboard testing, 13 strains (seven erythromycin susceptible and six erythromycin resistant) demonstrated synergy, 18 additivity and seven indifference. In timekill testing, bacterial eradication below detection limits occurred with clarithromycin and metabolite in seven of 10 organisms. The combination of parent and metabolite was more rapidly bactericidal than clarithromycin alone in six of the seven isolates (P = 0.026). The metabolite has potent activity against S. pneumoniae and enhances the activity of the parent compound against this organism. The metabolite's activity must be considered in evaluating clarithromycin in vitro to avoid underestimation of clarithromycin's activity against the pneumococcus.
| Introduction |
|---|
|
|
|---|
Macrolide resistance in Streptococcus pneumoniae is increasing.1 Macrolide resistance can be mediated by ribosomal modification or active drug efflux.2,3 The former mechanism involves the erm(AM) gene and the latter involves the mef(E) gene.2,4 Ribosomal modification is associated with high-level resistance to macrolides, lincosamides and streptogramins (MLSB-type resistance pattern), often producing MICs of >64128 mg/L.2,5 Efflux is associated with low-level resistance to 14- and 15-membered ring macrolides only (M-type resistance pattern).3,5 Both resistance mechanisms are acquired determinants.5 It is difficult to predict macrolide susceptibility solely by penicillin resistance.
Clarithromycin is extensively metabolized in the liver by oxidative and hydrolytic mechanisms.6 An active metabolite, 14-hydroxy clarithromycin (henceforth called metabolite, accounts for approximately 20% of the parent drug's metabolism.6 Neither parent nor metabolite is extensively bound to plasma proteins.6 The active metabolite provides the majority of the compound's antibacterial effects against Haemophilus influenzae.7 Although few data are available, it appears that the metabolite is also active against penicillin-susceptible, erythromycin-susceptible S. pneumoniae.711 Its activity against penicillin-intermediate, penicillin-resistant or erythromycin-resistant S. pneumoniae is not known.
The objective of this work was to characterize more fully the potency of the metabolite against penicillin- and erythromycin-resistant S. pneumoniae, and to investigate whether this metabolite has a role in the parent compound's activity against these organisms in vitro. We investigated the in vitro activity of the metabolite alone and in combination with clarithromycin against several clinical strains of penicillin-intermediate, penicillin-resistant and erythromycin-resistant S. pneumoniae. Interaction was tested by investigating combination MICs, agar dilution chequerboards and timekill assays.
| Materials and methods |
|---|
|
|
|---|
The pneumococci tested included 38 clinical isolates and one ATCC control strain (S. pneumoniae 49619). These consisted of 24 penicillin-intermediate (MIC 0.11.0 mg/L) and 14 penicillin-resistant S. pneumoniae (MIC
2.0 mg/L). Twenty five of these isolates were erythromycin susceptible (MIC
0.25 mg/L) and 13 erythromycin resistant (MIC
1 mg/L). MICs of erythromycin, azithromycin and penicillin were also determined, and erythromycin and azithromycin were included in chequerboard and timekill testing for comparison. Clarithromycin and metabolite were obtained from Abbott Laboratories (Abbott Park, IL, USA). Erythromycin, azithromycin and penicillin V potassium were obtained from the United States Pharmacopoeia (Rockville, MD, USA). Agar dilution MICs were determined according to the standards of the NCCLS with incubation in 5% CO2. Final antibiotic concentrations tested were 0.00164 mg/L. S. pneumoniae ATCC 49619 and S. aureus ATCC 29213 were included for quality control. All procedures were performed in duplicate. MICs were determined for each agent individually and for clarithromycin and metabolite in a 2:1 and 1:1 ratio.
Isolates that were not susceptible to erythromycin (MIC
1 mg/L) were screened for the presence of known MLSB resistance genes by polymerase chain reaction (PCR) amplification with the following gene-specific primers: erm(AM): upper primer (5' position 974), TCAACCAAATAAT AAAACAA, lower (3' position 1311), AATCCTTCTT CAACAATCAG; mef(E): upper (5' position 206), ATGCAGACCAAAAGCCACCAT, lower (3' position 439), GCCATAGACAAGACCATCGC.12 Crude lysates of the strains were prepared and stored at 4°C until tested. One microlitre of lysate was used in a 25 µL amplification reaction (PCR Supermix; Gibco-BRL, Bethesda, MD, USA). The presence of the erm(AM) and mef(E) genes was identified in 13 organisms.
Agar chequerboard testing was performed using the 25 erythromycin-susceptible and 13 erythromycin-resistant isolates by combining the parent compound and metabolite, each at concentrations of 0.00164 mg/L.13 Interaction between the two compounds was determined by calculating the fractional inhibitory concentration (FIC) index.13 FIC indices were interpreted as follows:
0.5, synergy; >0.51, additive; >14, indifference; and >4, antagonism.14
Standardized timekill assays were performed in a CO2 environment using 10 representative pneumococcal strains (two erythromycin resistant). The macrolides were each tested alone at simulated physiological peak serum concentrations: clarithromycin, 2.6 mg/L; metabolite, 0.8 mg/L; azithromycin, 0.4 mg/L; and erythromycin, 2.0 mg/L.1517 Clarithromycin and metabolite were also tested in combination. All work was performed in duplicate. There was excellent correlation between duplicate colony counts, so results presented are mean values.
| Results |
|---|
|
|
|---|
Metabolite alone was as potent as the parent compound against S. pneumoniae (Tables I and II
|
|
For 13 erythromycin-resistant strains, the MIC90s of all the macrolides were >64 mg/L, but MIC90s for organisms expressing the mef(E) gene (erythromycin, 8 mg/L; azithromycin, 32 mg/L; clarithromycin, 4 mg/L; metabolite, 8 mg/L; clarithromycin/metabolite 1:1, 4 mg/L; and clarithromycin/ metabolite 2:1, 4 mg/L) were lower than MICs for those expressing the erm(AM) gene (>64 mg/L for all).
The clarithromycin/metabolite combination in a 2:1 ratio was more potent than clarithromycin (having a lower MIC) for 25 strains of pneumococcus tested (19 with a decrease of one tube dilution and six with a decrease of two or more tube dilutions). The combination in a 1:1 ratio was more potent than clarithromycin alone (having a lower MIC) for 28 strains of pneumococcus tested (17 with a decrease of one tube dilution and 11 with a decrease of two tube dilutions). In five of the 13 erythromycin-resistant isolates the clarithromycin MIC was reduced by one or more tube dilutions by combination with the metabolite (Table II
).
Synergy was demonstrated against 13 strains and additive effects against 18 strains of S. pneumoniae. Against erythromycin-resistant organisms, three of eight erm(AM)-producing strains demonstrated synergy, as compared with three of five mef(E)-producing strains. Against erythromycin-susceptible isolates, seven of 25 strains demonstrated synergy, 16 additive effects and two indifference.
Representative timekill curves for macrolide-resistant isolates are shown in Figures 1 and 2![]()
. For the macrolide-susceptible isolates (data not shown), clarithromycin and its 14-hydroxy metabolite alone and in combination were bactericidal and produced colony counts below the lower limit of detection at 24 h. Against the macrolide-resistant [mef(E)], penicillin-resistant isolate (Figure 1
), clarithromycin and the combination of parent and metabolite reduced the colony count by approximately 2 log cfu/mL at 24 h, whereas growth in the presence of all other agents resembled that of the control. For the macrolide-resistant [erm(AM)], penicillin-intermediate S. pneumoniae (Figure 2
), an initial decrease in colony counts was observed over the first 12 h in the presence of clarithromycin, its metabolite, the combination and erythromycin, but in all tubes there was regrowth above baseline at 24 h.
|
|
Clarithromycin and its metabolite completely eradicated seven of the 10 organisms (seven of the eight erythromycin-susceptible strains and neither of the two erythromycin-resistant ones). The time required for bactericidal activity to be manifested was determined for these seven isolates. The combination of parent and metabolite was more rapidly bactericidal than clarithromycin alone in six of the seven isolates (P = 0.026). Metabolite was more rapidly bactericidal than clarithromycin in five of the seven isolates, but the cumulative difference did not reach statistical significance (P = 0.222).
| Discussion |
|---|
|
|
|---|
We speculated that clarithromycin's active metabolite, 14-hydroxy clarithromycin, may have significant activity against penicillin- and erythromycin-intermediate and -resistant pneumococci, and contribute to the parent drug's clinical effectiveness. There are no reports of in vitro activity of the metabolite against these pathogens. The few data describing the compound's activity against S. pneumoniae isolates suggest that its potency is equal to or greater than that of its parent compound.7,9 Clarithromycin and its metabolite have demonstrated synergy in combination against other bacteria, and this interaction may be responsible for the seemingly few clinical failures of this drug against S. pneumoniae strains that are not susceptible to penicillin.8,18,19
In MIC testing, the MIC of clarithromycin was reduced in >70% of the isolates when clarithromycin was combined with metabolite in a serum physiological ratio. Jones et al.18 demonstrated similar findings for the combination against Legionella spp. The results of agar chequerboard studies confirmed this interaction, as 31 of 38 isolates demonstrated synergy or additive effects. To investigate the pharmacodynamic nature of the interaction, we performed timekill assays against a variety of penicillin-intermediate, -resistant and macrolide-resistant isolates. Simulated serum concentrations were chosen for testing to simulate bacteraemia in vivo. We chose a 2:1 ratio of parent to metabolite to allow comparison of our results with those of other investigators.7,18 Chu et al.15 demonstrated that in healthy young and elderly volunteers the ratio of parent to metabolite Cmax and Cmin serum concentrations after five doses of clarithromycin (500 mg bd) ranged from 2.46:1 to 3.65:1 and from 1.92:1 to 2.28:1, respectively. One would expect that higher concentrations of these agents, as might be present in epithelial lining fluid, would produce similar or greater activity against pneumococcal strains. In all but the high-level macrolide-resistant isolate tested [I-B, erm(AM)], the clarithromycin/metabolite combination was more potent than the parent compound. In seven of the 10 timekill assays, bactericidal activity was demonstrated for all of the macrolides. Thus, macrolides may not be effective against all pneumococcal isolates, but in vitro MICs may not be an accurate predictor of pharmacodynamic effect.
The erm gene probably encodes high-level macrolide resistance; our work confirms that of others in this regard.20 In timekill testing against an erm(AM)-expressing strain, erythromycin, and clarithromycin and metabolite either alone or in combination reduced colony counts over the first 12 h of the assay. Clarithromycin alone and in combination with the metabolite produced an approximately 2 log cfu/mL reduction in the macrolide-resistant strain encoded by the mef(E) gene. Erythromycin and azithromycin appeared to have little activity against this strain. This efflux mechanism produces low- to moderate-level macrolide resistance, and organisms expressing this gene may not be uniformly affected by the macrolides.
We have demonstrated that 14-hydroxy clarithromycin has activity against S. pneumoniae in vitro and that it contributes to the activity of clarithromycin in MIC and timekill studies. Further work on the activity of this combination against mef(E)- and erm(AM)-expressing macrolide-resistant pneumococci is warranted. This work supports the argument that the activity of active metabolites must be taken into consideration in determining the antimicrobial activity of parent drugs.
| Acknowledgments |
|---|
The authors gratefully acknowledge the technical assistance of Dr Robert Flamm and Jill Beyer. This work was supported by a grant from Abbott Laboratories. The results were presented, in part, at the Thirty-eighth Interscience Conference on Antimicrobial Agents and Chemotherapy, 1998, San Diego, CA, and the Twenty-first International Congress of Chemotherapy, 1999, Birmingham, UK.
| Notes |
|---|
* Corresponding author. Tel: +1-419-530-1964; Fax: +1-419-530-1950; E-mail: smartin2{at}pop3.utoledo.edu
| References |
|---|
|
|
|---|
1 . Campbell, G. D. & Silberman, R. (1998). Drug-resistant Streptococcus pneumoniae. Clinical Infectious Diseases 26, 118895.[Web of Science][Medline]
2
.
Leclerq, R & Courvalin, P. (1991). Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modification. Antimicrobial Agents and Chemotherapy 35, 126772.
3 . Sutcliffe, J., Tait-Kamradt, A. & Wondrack, L. (1996). Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrobial Agents and Chemotherapy 40, 181724.[Abstract]
4 . Tait-Kamradt, A., Clancy, A., Cronan, M., Dib-Hajj, F., Wondrack, L., Yuan, W. et al. (1997). mefE is necessary for erythromycinresistant M phenotype in Streptococcus pneumoniae. Antimicrobial Agents and Chemotherapy 41, 22515.[Abstract]
5
.
Oster, P., Zanchi, A., Cresti, S., Lattanzi, M., Montagnani, F., Cellesi, C. et al. (1999). Patterns of macrolide resistance determinants among community-acquired Streptococcus pneumoniae isolates over a 5-year period of decreased macrolide susceptibility rates. Antimicrobial Agents and Chemotherapy 43, 25102.
6 . Langtry, H. D. & Brogden, R. N. (1997). Clarithromycin. A review of its efficacy in the treatment of respiratory tract infections in immunocompetent patients. Drugs 53, 9731004.[Web of Science][Medline]
7
.
Hardy, D. J., Hensey, D. M., Beyer, J. M., Vojtko, C., McDonald, E. J. & Fernandes, P. B. (1988). Comparative in vitro activities of new 14-, 15-, and 16-membered macrolides. Antimicrobial Agents and Chemotherapy 32, 17109.
8
.
Bedos, J.-P., Azoulay-Dupuis, E., Vallee, E., Veber, B. & Pocidalo, J.-J. (1992). Individual efficacy of clarithromycin (A-56268) and its major human metabolite, 14-hydroxy clarithromycin (A-62671), in experimental pneumococcal pneumonia in the mouse. Journal of Antimicrobial Chemotherapy 29, 67785.
9
.
Logan, M. N., Ashby, J. P., Andrews, J. M. & Wise, R. (1991). The in-vitro and disc susceptibility testing of clarithromycin and its 14-hydroxy metabolite. Journal of Antimicrobial Chemotherapy 27, 16170.
10
.
Bergman, K. L., Olsen, K. M., Peddicord, T. E., Fey, P. D. & Rupp, M. E. (1999). Antimicrobial activities and postantibiotic effects of clarithromycin, 14-hydroxy clarithromycin, and azithromycin in epithelial cell lining fluid against clinical isolates of Haemophilus influenzae and Streptococcus pneumoniae. Antimicrobial Agents and Chemotherapy 43, 12913.
11 . Gu, J.-W., Scully, B. E. & Neu, H. C. (1991). Bactericidal activity of clarithromycin and its 14-hydroxy metabolite against Haemophilus influenzae and streptococcal pathogens. Journal of Clinical Pharmacology 31, 114650.[Abstract]
12 . Shortridge, V. D., Flamm, R. K., Ramer, N., Beyer, J. & Tanaka, S. K. (1996). Novel mechanism of macrolide resistance in Streptococcus pneumoniae. Diagnostic Microbiology and Infectious Diseases 26, 738.[Web of Science][Medline]
13 . Eliopoulos, G. M. & Moellering, R. C. (1996). Antimicrobial combinations. In Antibiotics in Laboratory Medicine, 4th edn, (Lorian,V., Ed.), pp. 33096. Williams & Wilkins, New York.
14 . Anonymous. (1995). Instructions to authors. Antimicrobial Agents and Chemotherapy 39, ixiv.
15 . Chu, S., Wilson, D. S., Deaton, M. S., Mackenthun, A. V., Eason, C. N. & Cavanaugh, J. H. (1993). Single- and multiple-dose pharmacokinetics of clarithromycin, a new macrolide antimicrobial. Journal of Clinical Pharmacology 33, 71926.[Abstract]
16
.
Foulds, G., Shepard, R. M. & Johnson, R. B. (1990). The pharmacokinetics of azithromycin in human serum and tissues. Journal of Antimicrobial Chemotherapy 25, Suppl. A, 7382.
17 . Gerding, D. N., Hughes, C. E., Bamberger, D. M., Foxworth, J. & Larson, T. A. (1996). Extravascular antimicrobial distribution and the respective blood concentrations in humans. In Antibiotics in Laboratory Medicine, 4th edn, (Lorian, V., Ed.), pp. 83599. Williams & Wilkins, Baltimore, MD.
18 . Jones, R. N., Erwin, M. E. & Barrett, M. S. (1990). In vitro activity of clarithromycin (TE-031, A-67268) and 14OH-clarithromycin alone and in combination against Legionella species. European Journal of Clinical Microbiology and Infectious Diseases 9, 8468.[Web of Science][Medline]
19 . Martin, S., Pendland, S., Chen, C., Schreckenberger, P. & Danziger, L. (1997). In vitro activity of clarithromycin alone and in combination with ciprofloxacin or levofloxacin against Legionella spp: enhanced effect by the addition of the metabolite 14-hydroxy clarithromycin. Diagnostic Microbiology and Infectious Diseases 29, 16771.[Web of Science][Medline]
20
.
Johnston, N. J., de Azavedo, J. C., Kellner, J. D. & Low, D. E. (1998). Prevalence and characteristics of the mechanisms of macrolide, lincosamide, and streptogramin resistance in isolates of Streptococcus pneumoniae. Antimicrobial Agents and Chemotherapy 42, 24256.
Received 13 July 2000; returned 25 September 2000; revised 4 December 2000; accepted 24 January 2001
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
K. Abduljalil, M. Kinzig, J. Bulitta, S. Horkovics-Kovats, F. Sorgel, M. Rodamer, and U. Fuhr Modeling the Autoinhibition of Clarithromycin Metabolism during Repeated Oral Administration Antimicrob. Agents Chemother., July 1, 2009; 53(7): 2892 - 2901. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Traunmuller, M. Zeitlinger, P. Zeleny, M. Muller, and C. Joukhadar Pharmacokinetics of Single- and Multiple-Dose Oral Clarithromycin in Soft Tissues Determined by Microdialysis Antimicrob. Agents Chemother., September 1, 2007; 51(9): 3185 - 3189. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

, Control;
, clarithromycin;
, metabolite; x, clarithromycin/metabolite;
, erythromycin;
, azithromycin.
