Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Petinaki, E.
Right arrow Articles by Spiliopoulou, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petinaki, E.
Right arrow Articles by Spiliopoulou, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of Antimicrobial Chemotherapy (2001) 47, 297-304
© 2001 The British Society for Antimicrobial Chemotherapy

Detection of mecA, mecR1 and mecI genes among clinical isolates of methicillin-resistant staphylococci by combined polymerase chain reactions

E. Petinaki, A. Arvaniti, G. Dimitracopoulos and I. Spiliopoulou,*

Department of Microbiology, School of Medicine, University of Patras, 26500 Rion, Patras, Greece


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The distribution of the mec genes mecA, mecR1 and mecI that regulate the expression of methicillin resistance was investigated by PCR in 145 staphylococci of hospital origin. Determination of alterations and deletions in parts of the genes was achieved using 11 sets of primers in combined reactions. Methicillin-resistant Staphylococcus epidermidis strains appeared relatively stable, with 57.9% of isolates containing the whole regulatory region. Alterations within the mecA gene were detected more often in other coagulase-negative staphylococci, which also had a higher percentage with deletions of regulatory genes. Among methicillin-resistant S. aureus, a genetically heterogeneous population was identified, with several alterations and deletions of mec genes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Resistance of staphylococci to methicillin and all ß-lactam antibiotics is associated with the low affinity of a penicillin-binding protein, PBP2a, which is not present in susceptible staphylococci.15 This protein is encoded by the mecA gene, which is located in the mec region and which is DNA of foreign origin.6

The expression of the mecA gene and the resulting production of PBP2a is regulated by proteins encoded by the penicillinase-associated blaR1blaI inducer–repressor system and the corresponding genomic mecR1mecI elements.79 Hiramatsu et al.10 identified in Staphylococcus aureus N315 the mecR1mecI regulator element, which is located upstream of the mecA gene and is divergently transcribed from mecA. The mecI gene codes for a repressor protein and the mecR1 gene for a ß-lactam-sensing transmembrane signalling protein. Methicillin and oxacillin are, however, not good inducers for this system, often resulting in slow induction of methicillin resistance. Phenotypically susceptible strains, known as pre-methicillin-resistant S. aureus (pre-MRSA) and pre-methicillin-resistant coagulase-negative staphylococci (pre-MRCNS), have been discovered, which do not express methicillin resistance, as mecA is fully repressed by mecI.11,12 The induction of mecA transcription is very slow and might be due to mutations of mecI.12

The distribution of mec regulator genes among methicillin-resistant Staphylococcus strains from various countries has already been studied by hybridization and sequencing, which showed that the loss or inactivation of the mecI gene leads to derepression of mecA gene transcription.1214 In vitro amplification of DNA by PCR is a rapid and sensitive method for the detection of specific DNA sequences and requires fewer cells than DNA hybridization protocols.15,16 The method has already been applied for the identification of mecA-positive strains directly in clinical specimens or in DNA extracts.15,17

In this study, we have determined the distribution of mecA, mecR1 and mecI genes by PCR, among 145 Staphylococcus clinical isolates expressing resistance to methicillin (MIC >= 4 mg/L), isolated from clinical specimens from in-patients. Using several combined pairs of primers in seven reactions, we have detected some alterations and deletions of the genes described above. These alterations have been correlated with the MIC for all isolates and with the staphylococcal species. The location of deletions or alterations of mec elements might explain the expression of resistance to methicillin.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bacterial strains

One-hundred and forty-five Staphylococcus isolates from clinical specimens of in-patients at the University Hospital of Patras were included in this study. The Clinical Microbiology Laboratory identified 49 isolates as S. aureus, 76 as Staphylococcus epidermidis, eight as Staphylococcus hominis, eight as Staphylococcus haemolyticus, three as Staphylococcus lugdunensis and one as Staphylococcus xylosus, by Gram's stain, catalase and coagulase production, and by the use of API Staph. System (bioMérieux, La Balme les Grottes, France).

The control strains BB225 (methicillin-sensitive S. aureus), BB270 (MRSA, mecA positive) and BB830 [methicillin-resistant S. epidermidis (MRSE), mecA/mecR1/mecI positive], kindly provided by Professor B. Berger-Bächi, were used for the establishment of PCR conditions.

Antibiotic susceptibility testing and ß-lactamase production

Resistance to methicillin was detected by the Kirby–Bauer disc diffusion method on Mueller–Hinton agar, using 1 µg oxacillin discs (Difco Laboratories, Detroit, MI, USA), according to NCCLS standards.18 MICs of methicillin (Sigma, St Louis, MO, USA) were determined by agar dilution method in Mueller–Hinton agar, supplemented with 4% NaCl, after 24 h incubation at 35°C using 105 cfu/well. The resistance breakpoint to methicillin was >=4 mg/L.19 The production of ß-lactamase was tested with nitrocefin discs (Difco) according to the manufacturer's instructions.19

Preparation of chromosomal DNA

Cells from an overnight culture in Luria–Bertani broth [5 g/L NaCl, 5 g/L yeast extract, 10 g/L tryptone (Difco)] collected by centrifugation, were suspended in 3 mL buffer (0.1 M Tris–HCl pH 7.5, 0.1 M EDTA pH 8, 0.15 M NaCl) with 1 mg lysozyme (Sigma) and 0.2 mg lysostaphin (Sigma). After incubation of the resulting mixture at 37°C for 30 min, 0.3 mL of 5% SDS in 50% ethanol (Merck, Darmstadt, Germany) was added, followed by phenol: chloroform:isoamylalcohol (25:24:1) extraction. The DNA was precipitated by the addition of two volumes 100% ethanol and was suspended in 2 mL TE buffer (10 mM Tris–HCl pH 8, 1 mM EDTA pH 8) with 1 µL RNase H (103 U/mL, Boehringer, Mannheim, Germany). The samples were incubated overnight at room temperature, measured for the DNA quantity at 260 nm (Gene Quant II, RNA/DNA calculator, Pharmacia Biotech, CE, Cambridge, England) and kept at 4°C.20

Oligonucleotides

Two of the primers used for the detection of the mecA gene (named P2 and P3) have already been published21 and one more sense primer was designed by us (P1).22 The primer sequences were: P1, 5'-(911)GGTCCCATTAACTCTGAAG(929)-3'; P2, 5'-(1427)ATCGATGGTAAAGGTTGGC(1445)-3'; and P3, 5'-(1956)AGTTCTGCAGTACCGGATTTGC(1935)-3' (Genset, Paris, France), according to the sequence numbers as described by Matsuhashi et al.6 The two sense primers (P1, P2) and one antisense (P3) have been applied in two reactions, and gave rise to PCR products of 1046 and of 530 bp, respectively.

For the detection of the regulatory genes mecR1mecI, five pairs of eight primers were used in combination, as follows: for the detection of the 5' end of the mecR1 gene designated as membrane spanning (MS), we used the primers: sense SA18, 5'-(130)ATCCTCCTTATATAAGACTAC(150)-3'; antisense SA19, 5'-(277)CATATCGTGAGCAATGAACTG(257)-3' (FigureGo).



View larger version (10K):
[in this window]
[in a new window]
 
Figure.. Schematic representation of the genomic organization of the mec region. The arrows indicate the positions of the primers used. The sizes of the PCR products are included. PB, penicillin-binding domain; MS, membrane spanning part of mecR1.

 
S. aureus isolates were also tested for the presence of the MS part of the gene by the use of a second pair of primers: sense SA13, 5'-(357)GTCTCCACGTTAATTCCATT(376)-3'; and antisense SA14, 5'-(666)GTCGTTCATTAAGATATGACG(646)-3', because some strains carried alterations at the sites 130–150 and 257–277, corresponding to the first pair. For the detection of the 3' end of the mecR1 gene, the penicillin binding (PB) domain, we used the sense primer SA15 combined with the antisense primer SA17, with the sequences: SA15, 5'-(1208)CAAGCACCGTTACTATCTGC(1227)-3'; and SA17, 5'-(1954)CGCTCAGAAATTTGTTGTGC(1935)-3'.

The mecI gene was detected by the application of three primers in two reactions, in order to identify further alterations. The primers used in the first reaction were: sense SA9, 5'-(1923)AATGGCGAAAAAGCACAACA(1942)-3'; and antisense SA10, 5'-(2403)GACTTGATTGTTTCCTCTGTT(2383)-3'. In the second reaction SA15 was used as sense with the antisense SA10 (FigureGo). The primers SA9, SA10, SA13, SA14, SA17, SA18 and SA19 were those published by Suzuki et al.14

PCR conditions

The DNA extract (600 ng) was amplified by PCR in a final volume of 50 µL, containing 0.25 mM of each dNTP, 40 pmol of each primer, 0.5 IU Taq DNA polymerase (Promega Corporation, Madison, WI, USA) and buffer provided by the manufacturer. The denaturation was performed for 1 min at 95°C, the annealing was for 1 min at 58°C for the detection of mecA gene and for the other reactions at 55°C, and the primer extension for 2 min at 72°C, with a total of 30 cycles. A sample of 10 µL from each reaction was analysed by gel electrophoresis in a 0.8% agarose gel with ethidium bromide.20 As molecular weight marker, {phi}X174 digested by HaeIII was used.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Determination of methicillin MIC and ß-lactamase production

The isolates were classified into two groups on the basis of their MIC levels. The first group included 31 S. aureus, 51 S. epidermidis and 11 other CNS for which methicillin MICs ranged from 4 to 128 mg/L. Higher methicillin MICs (>128 mg/L) were found in 18 S. aureus, 25 S. epidermidis and nine other CNS. The majority of isolates in both groups were ß-lactamase producers with 39 S. aureus (79.6%), 64 S. epidermidis (84.2%) and 19 other CNS (95%) giving positive results with the nitrocefin test.

Detection of the mecA gene among S. aureus strains

Forty-nine S. aureus strains were identified as mecA positive, yielding PCR products with at least one pair of primers. Of these mecA-positive strains, 43 (87.8%) did not have alterations at the primer-binding sites, since the combinations P1–P3 and P2–P3 gave rise to DNA products of 1046 and 530 bp, respectively, as expected. Four strains (8.2%) showed alterations at the site of the primer P2, giving rise to positive reactions only with the P1–P3 pair. Finally, two strains (4%) presented alterations at the site of the primer P1 (positive PCR deriving only from the pair P2–P3) (Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. . Detection of the mecA gene among clinical strains of staphylococci by the application of sense primers P1, P2 and antisense P3 in two PCRs (P1–P3 and P2–P3)
 
Detection of the mecA gene among S. epidermidis strains

With the mecA-positive S. epidermidis strains, 72 of 76 (94.7%) did not show any alterations of the specific regions with complementarity to the primers used. The specific DNA bands were detected in both reactions and were the same size as those seen with S. aureus. Three strains (4%) showed alterations at the annealing site of primer P2, while one strain (1.3%) showed alterations at the annealing site of primer P1 (Table IGo).

Detection of the mecA gene among the other CNS

From the 20 isolates in our collection, 14 (70%) carried intact the specific region of the mecA gene: positive reactions occurred with both pairs of primers and the DNA bands detected were of the same size as those of S. aureus. Five isolates (25%), comprising three S. hominis and two S. lugdunensis, carried the gene with alterations at the binding site of primer P2, while the isolate of S. xylosus showed alterations at the binding site of primer P1 (Table IGo).

Detection of mecR1–mecI genes among S. aureus strains

For the detection of the regulator genes mecR1mecI eight primers were used, which were combined in five pairs (see FigureGo). All the strains were examined for the presence of the regulator region. From the 49 mecA-positive strains, 13 (26.5%) carried intact mecR1mecI genes, at least with regard to the regions complementary to the primers used. The PCRs were positive with all primers and the DNA bands showed the expected sizes relative to the control strain. Seven isolates (14.3%) carried the whole mec regulator region with an alteration at the binding site of the primer SA15 and a positive result when using the pair SA9–SA10. Three isolates (6.1%) also carried the region which presented an alteration at the site complementary to the primer SA9, with a positive result when the pair SA15–SA10 was used and one strain (2.1%) revealed an alteration at the annealing site of primer SA17. From the remaining isolates, 11 (22.4%) carried only the mecR1 gene (deletion of the mecI gene and a positive result with the pair SA15–SA17), seven (14.3%) carried only the MS part of the mecR1 gene (positive PCR results when we used at least one of the pairs SA13–SA14 and SA18–SA19), and seven (14.3%) did not carry the mec regulator region at all (Table IIGo). The PCR products were the same size as that of the control strain.


View this table:
[in this window]
[in a new window]
 
Table II. . Detection of alterations at the specific annealing sites of primers and deletions of mecR1mecI regulator genes, detected by PCRs
 
Detection of the mecR1–mecI genes among S. epidermidis strains

The distribution of the regulator genes in these strains was studied by the application of the same reactions. Forty-four of the 76 mecA-positive S. epidermidis isolates (57.9%) carried the whole regulator region without alterations in the binding sites for the primers used. Three isolates (3.9%) revealed alterations at the annealing site of primer SA15, six isolates (7.9%) at the site of primer SA9 and four isolates (5.3%) at the annealing site of primer SA17. Deletion of the mecI gene was detected in only one isolate (1.3%), while deletion of the PB domain of the mecR1 gene was detected in 16 isolates (21.1%). Two of the 76 isolates (2.6%) lacked the regulator gene (Table IIGo). All the DNA bands detected were of the same size as those of S. aureus.

Detection of the mecR1–mecI genes among the other CNS

Two of the 20 mecA-positive CNS carried the whole regulator region without alterations. Eight isolates (40%) showed a deletion of the PB domain of the mecR1 gene and 10 isolates (50%) lacked the regulator genes (mecR1/mecI negative) (Table IIGo). The PCR products were the same size as those produced with S. aureus.

Correlation of MIC levels with the presence of regulator genes

Twenty-five S. aureus isolates were found to be negative for the presence of mecI, 23 of them (46.9%) with lower MIC values (Table IIIGo). From the mecI-positive isolates, four of eight with lower MICs and seven of 16 with MICs > 128 mg/L, carried alterations at the PB domain of mecR1. Most of the S. epidermidis isolates were positive for the presence of mecI but 17 (22.4%) mecI-negative isolates had low MICs. Eight of the 34 isolates with low methicillin MICs and five of the 23 showing high methicillin MICs had alterations at the PB site of mecR1. Among the other CNS, only two isolates were found to carry the mecI gene and had low methicillin MICs, while none of these isolates had any alterations detected with the primers used.


View this table:
[in this window]
[in a new window]
 
Table III. . Detection of regulator genes mecR1/mecI among different staphylococcal species in relation to the methicillin MIC of the strains
 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The mecA gene is highly conserved among staphylococcal species.2327 Selection of primers for the amplification of the mecA gene is significant for the accuracy of test results. The A+T content of mecA is high (c. 70%) and in order to minimize non-specific amplification of unrelated DNA regions, three primers were chosen to contain c. 50% G+C and were combined in two reactions in order to identify altered mecA DNA.16,26,27 The majority (89%) of this strain collection carried intact the mecA gene with the MRSE possessing mecA sequences that were more conserved (94.7%).

A minority (2.8%) of the isolates showed alterations at the annealing site of primer P1, including two MRSA. At the complementary region of primer P2, which includes the ClaI restriction site, more strains showed alterations, including four MRSA, three MRSE and five MRCNS other than S. epidermidis (25%). S. hominis and S. lugdunensis, which expressed this alteration, have c. 35% DNA relatedness.28 After digestion of their chromosomal DNA by ClaI and hybridization with mecA probe, all these strains showed two hybridization bands (data not shown). The MIC of methicillin for these isolates ranged from 8 to 500 mg/L. These findings lead us to conclude that the alterations in those sites are restricted without affecting the ClaI restriction sequence or the enzymic activity of PBP2a.

It has been reported that considerable variation in the presence of the other genes involved in the expression of methicillin resistance exists.12,14 The regulatory elements mecR1 and mecI have been detected in 60–95% of MRSA.14,29 Clinical isolates before 1970 had deletions of the PB domain of mecR1, while more recent isolates tend to have mecI polymorphism and mecA promoter mutations.14,24,30 Intact and fully functional mec regulator genes appear to strongly repress PBP2a production.31,32 In contrast, mecA-positive strains with deletions of the PB site of mecR1 and of the downstream mecI, express PBP2a constitutively, provided that the strain does not contain inducible ß-lactamase and the regulatory elements blaR1blaI, which coregulate the enzyme production.7,27

Previous studies have detected mecR1 and mecI among different species of MRCNS.14,29 Evidence that mutations in mecI play a role in derepression of mecA in CNS has not as yet been discovered.12

In this study, we tried to locate alterations or deletions of regulator genes among methicillin-resistant clinical isolates from a large teaching hospital and to correlate these findings with methicillin MIC and species, using a combination of several PCR primers. Deletion of mecI alone was identified in 11 (22.4%) MRSA and only one MRSE, while seven more MRSA and 16 MRSE were found with deletion of mecI and of the PB domain of mecR1, carrying only the MS part of the gene. Loss of both regulator elements was detected in seven MRSA, two MRSE and 10 of 20 MRCNS. It is interesting that the MRSE strains seem to be stable, while the majority of the other MRCNS (18 of 20) have deletions of mecI together with the PB domain of mecR1 or of both regulator genes. None of the MRCNS isolates was found to carry the PB domain with alterations, as far as we can ascertain from the primers used. The absence of regulator genes has been discussed for methicillin-resistant S. haemolyticus isolates.12,14

It has already been reported that the old epidemic MRSA carried only the mecA gene, but investigators considered that it was more likely that these strains lost their regulator genes by a deletional event after they had acquired the original mec component.14

According to the results presented, we postulate that MRSE seem to be the source of mec determinants in the hospital environment and that the other staphylococcal species have lost or altered parts of the genes after acquisition of mec elements. Allelic variation of chromosomal enzyme loci, as well as hybridization and sequence analysis, of strains isolated in different or in the same geographical areas, support the hypothesis of continuous horizontal gene transfer among staphylococci.12,14,33

Correlation of the deletions and alterations identified with the methicillin MICs revealed that 23 (46.9%) MRSA, even though mecI negative, had MICs <= 128 mg/L. This fact might be partially explained by the possibility that these strains carry an inducible ß-lactamase element, since 16 of them were ß-lactamase producers and that mecA repression is due to the function of blaI.1,7 For the remaining seven isolates, which were ß-lactamase negative, another mechanism must be responsible for the regulation of resistance.34,35 The presence of the regulatory genes with or without alterations at the PB domain of mecR1 among 16 MRSA with high MICs (>128 mg/L) leads us to the conclusion that either the alterations at the PB domain are not essential for ß-lactam binding at the protein, or that other mechanisms are also involved in the expression of high-level resistance.12,14,34,36

Among the MRSE group, 26 strains (34.2%) that carried intact the regulator genes and eight strains (10.5%) with alterations at the PB domain of mecR1, had lower MICs (<=128 mg/L) indicating a slow induction of mecA.35 Of the 17 mecI-negative isolates with low MIC, 16 were ß-lactamase producers, leading us to the hypothesis that blaR1blaI could be responsible for the regulation of mecA.

These results can classify the MRSE strains, as pre-MRCNS, that are phenotypically susceptible (MIC 4–8 mg/L), mecA positive and are more common than pre-MRSA.11 Among the MRCNS other than S. epidermidis, the two strains that carry intact the regulatory elements had low MICs, as expected, while eight of the nine mecI- negative isolates expressing low MICs were ß-lactamase positive. The remaining MRCNS (nine isolates) with high MICs lacked regulator genes (Table IIIGo).

In summary, this study has revealed the presence of pre-MRSE isolates that might be the reservoir of mec-related resistance determinants. The population of mecA-positive S. aureus strains seems to have emerged after acquisition of mec elements followed by genetic alterations. Evidence was also found that mecR1 and mecI may be deleted often among the other staphylococcal species, and not only in S. haemolyticus. The expression of methicillin resistance is not only the result of interaction between mecA, mecR1 and mecI, but is a more complex mechanism that involves several regulatory elements.


    Acknowledgments
 
The authors wish to thank Professor Brigitte Berger-Bächi for her manuscript review and comments. This work was supported by a grant from the Greek Ministry of Health, no. A2{gamma}/837 awarded to Dr Iris Spiliopoulou. A part of these results has been presented at the Eighth International Symposium on Staphylococci and Staphylococcal Infections, 23–26 June, 1996, Aix-Les-Bains, France.


    Notes
 
* Corresponding author. Tel: +30-61-993-978; Fax: +30-61-994-922; E-mail: spiliopl{at}med.upatras.gr Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1 . Chambers, H. F. (1997). Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clinical Microbiological Reviews 10, 781–91.

2 . Chambers, H. F. (1987). Coagulase-negative staphylococci resistant to beta-lactam antibiotics in vivo produce penicillin-binding protein 2a. Antimicrobial Agents and Chemotherapy 31, 919–24.

3 . Chambers, H. F. (1999). Penicillin-binding protein-mediated resistance in pneumococci and staphylococci. Journal of Infectious Diseases 179, Suppl. 2, S353–9.

4 . Hartman, B. J. & Tomasz, A. (1984). Low affinity penicillinbinding protein associated with beta-lactam resistance in Staphylococcus aureus. Journal of Bacteriology 158, 513–6.[Abstract/Free Full Text]

5 . Pierre, J., Williamson, R., Bornet, M. & Gutmann, L. (1990). Presence of an additional penicillin-binding protein in methicillin-resistant Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, and Staphylococcus simulans with a low affinity for methicillin, cephalothin, and cefamandole. Antimicrobial Agents and Chemotherapy 34, 1691–4.[Abstract/Free Full Text]

6 . Matsuhashi, M., Song, M. D., Ishino, F., Wachi, M., Doi, M., Inoue, M. et al. (1986). Molecular cloning of the gene of a penicillin-binding protein supposed to cause high resistance to beta-lactam antibiotics in Staphylococcus aureus. Journal of Bacteriology 167, 975–80.[Abstract/Free Full Text]

7 . Hackbarth, C. J. & Chambers, H. F. (1993). blaI and blaR1 regulate beta-lactamase and PBP2a production in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 37, 1144–9.[Abstract/Free Full Text]

8 . Tesch, W., Ryffel, C., Strässle, A., Kayser, F. H. & Berger-Bächi, B. (1990). Evidence of a novel staphylococcal mec-encoded element (mecR) controlling expression of penicillin-binding protein 2'. Antimicrobial Agents and Chemotherapy 34, 1703–6.[Abstract/Free Full Text]

9 . Sharma, V. K., Hackbarth, C. J., Dickinson, T. M. & Archer, G. L. (1998). Interaction of native and mutant MecI repressors with sequences that regulate mecA, the gene encoding penicillin binding protein 2a in methicillin-resistant staphylococci. Journal of Bacteriology 180, 2160–6.[Abstract/Free Full Text]

10 . Hiramatsu, K., Asada, K., Suzuki, E., Okonogi, K. & Yokota, T. (1992). Molecular cloning and nucleotide sequence determination of the regulator region of mecA gene in methicillin-resistant Staphylococcus aureus. FEBS Letters 298, 133–6.[Web of Science][Medline]

11 . Hiramatsu, K. (1995). Molecular evolution of MRSA. Microbiology and Immunology 39, 531–43.[Web of Science][Medline]

12 . Weller, T. M. A. (1999). The distribution of mecA, mecR1 and mecI and sequence analysis of mecI and the mec promoter region in staphylococci expressing resistance to methicillin. Journal of Antimicrobial Chemotherapy 43, 15–22.[Abstract/Free Full Text]

13 . Shimaoka, M., Yoh, M., Segawa, A., Takarada, Y., Yamamoto, K. & Honda, T. (1994). Development of enzyme-labeled oligonucleotide probe for detection of mecA gene in methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology 32, 1866–9.[Abstract/Free Full Text]

14 . Suzuki, E., Kuwahara-Arai, K., Richardson, J. F. & Hiramatsu, K. (1993). Distribution of mec regulator genes in methicillin-resistant Staphylococcus clinical strains. Antimicrobial Agents and Chemotherapy 37, 1219–26.[Abstract/Free Full Text]

15 . Tokue, Y., Shoji, S., Satoh, K., Watanabe, A. & Motomiya, M. (1992). Comparison of a polymerase chain reaction assay and a conventional microbiologic method for detection of methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 36, 6–9.[Abstract/Free Full Text]

16 . Unal, S., Hoskins, J., Flokowitsch, J. E., Wu, C. Y., Preston, D. A. & Skatrud, P. L. (1992). Detection of methicillin-resistant staphylococci by using the polymerase chain reaction. Journal of Clinical Microbiology 30, 1685–91.[Abstract/Free Full Text]

17 . Ubukata, K., Nakagami, S., Nitta, A., Yamane, A., Kawakami, S., Sugiura, M. et al. (1992). Rapid detection of the mecA gene in methicillin-resistant staphylococci by enzymatic detection of polymerase chain reaction products. Journal of Clinical Microbiology 30, 1728–33.[Abstract/Free Full Text]

18 . National Committee for Clinical Laboratory Standards. (1999). Performance Standards for Antimicrobial Disk Susceptibility Tests—Sixth Edition. Approved Standard M2-A6. NCCLS, Wayne, PA.

19 . Low, D. E. (1997). Susceptibility testing for methicillin resistance. In The Staphylococci in Human Disease, (Crossley, K. B. & Archer, G. L., Eds), pp. 238–45. Churchill Livingstone Inc., New York.

20 . Maniatis, T., Fritsch, E. F. & Sambrook, J. E. (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

21 . Murakami, K., Minamide, W., Wada, K., Nakamura, E., Teraoka, H. & Watanabe, S. (1991). Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. Journal of Clinical Microbiology 29, 2240–4.[Abstract/Free Full Text]

22 . Spiliopoulou, I., Petinaki, E., Arvaniti, A., Roumelioti, E. & Dimitracopoulos, G. (1997). A study of mec genes among coagulase negative staphylococci by PCR. Acta Microbiologica Hellenica 42, 345–53.

23 . Suzuki, E., Hiramatsu, K. & Yokota, T. (1992). Survey of methicillin-resistant clinical strains of coagulase-negative staphylococci for mecA gene distribution. Antimicrobial Agents and Chemotherapy 36, 429–34.[Abstract/Free Full Text]

24 . Archer, G. L., Niemeyer, D. M., Thanassi, J. A. & Pucci, M. J. (1994). Dissemination among staphylococci of DNA sequences associated with methicillin resistance. Antimicrobial Agents and Chemotherapy 38, 447–54.[Abstract/Free Full Text]

25 . Beck, W. D., Berger-Bächi, B. & Kayser, F. H. (1986). Additional DNA in methicillin-resistant Staphylococcus aureus and molecular cloning of mec-specific DNA. Journal of Bacteriology 165, 373–8.[Abstract/Free Full Text]

26 . Ryffel, C., Tesch, W., Birch-Machin, I., Reynolds, P. E., Barberis-Maino, L., Kayser, F. H. et al. (1990). Sequence comparison of mecA genes isolated from methicillin-resistant Staphylococcus aureus and Staphylococcus epidermidis. Gene 94, 137–8.[Web of Science][Medline]

27 . Ubukata, K., Nonoguchi, R., Song, M. D., Matsuhashi, M. & Konno, M. (1990). Homology of mecA gene in methicillin-resistant Staphylococcus haemolyticus and Staphylococcus simulans to that of Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 34, 170–2.[Abstract/Free Full Text]

28 . Kloos, W. (1997). Modern concepts of species. In The Staphylococci in Human Disease, (Crossley, K. B. & Archer, G. L., Eds), pp. 114–7. Churchill Livingstone Inc., New York.

29 . Kobayashi, N., Taniguchi, K., Kojima, K., Urasawa, S., Uehara, N., Omizu, Y. et al. (1996). Genomic diversity of mec regulator genes in methicillin-resistant Staphylococcus aureus and Staphylococcus epidermidis. Epidemiology and Infection 117, 289–95.[Medline]

30 . Hürlimann-Dalel, R. L., Ryffel, C., Kayser, F. H. & Berger-Bächi, B. (1992). Survey of the methicillin-resistance associated genes mecA, mecR1mecI, and femAfemB in clinical isolates of methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 36, 2617–21.[Abstract/Free Full Text]

31 . Kuwahara-Arai, K., Kondo, N., Hori, S., Tateda-Suzuki, E. & Hiramatsu, K. (1996). Suppression of methicillin resistance in a mecA-containing pre-methicillin-resistant Staphylococcus aureus is caused by the mecI-mediated repression of PBP2' production. Antimicrobial Agents and Chemotherapy 40, 2680–5.[Abstract]

32 . Ryffel, C., Kayser, F. H. & Berger-Bächi, B. (1992). Correlation between regulation of mecA transcription and expression of methicillin resistance in staphylococci. Antimicrobial Agents and Chemotherapy 36, 25–31.[Abstract/Free Full Text]

33 . Musser, J. M. & Kapur, V. (1992). Clonal analysis of methicillin-resistant Staphylococcus aureus strains from intercontinental sources: association of the mec gene with divergent phylogenetic lineages implies dissemination by horizontal transfer and recombination. Journal of Clinical Microbiology 30, 2058–63.[Abstract/Free Full Text]

34 . Berger-Bächi, B., Strässle, A., Gustafson, J. E. & Kayser, F. H. (1992). Mapping and characterization of multiple chromosomal factors involved in methicillin resistance in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 36, 1367–73.[Abstract/Free Full Text]

35 . Berger-Bächi, B. (1997). Resistance not mediated by ß-lactamase (methicillin resistance). In The Staphylococci in Human Disease, (Crossley, K. B. & Archer, G. L., Eds), pp. 158–74. Churchill Livingstone Inc., New York.

36 . De Lencastre, H., Sa Figueiredo, A. M., Urban, C., Rahal, J. & Tomasz, A. (1991). Multiple mechanisms of methicillin resistance and improved methods for detection in clinical isolates of Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 35, 632–9.[Abstract/Free Full Text]

Received 5 June 2000; returned 4 September 2000; revised 17 October 2000; accepted 20 November 2000


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Antimicrob ChemotherHome page
I. C. V. Palazzo, P. A. d'Azevedo, C. Secchi, A. C. C. Pignatari, and A. L. d. C. Darini
Staphylococcus hominis subsp. novobiosepticus strains causing nosocomial bloodstream infection in Brazil
J. Antimicrob. Chemother., December 1, 2008; 62(6): 1222 - 1226.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
C. von Eiff, D. Maas, G. Sander, A. W. Friedrich, G. Peters, and K. Becker
Microbiological evaluation of a new growth-based approach for rapid detection of methicillin-resistant Staphylococcus aureus
J. Antimicrob. Chemother., June 1, 2008; 61(6): 1277 - 1280.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
V. Chini, G. Dimitracopoulos, and I. Spiliopoulou
Occurrence of the Enterotoxin Gene Cluster and the Toxic Shock Syndrome Toxin 1 Gene among Clinical Isolates of Methicillin-Resistant Staphylococcus aureus Is Related to Clonal Type and agr Group.
J. Clin. Microbiol., May 1, 2006; 44(5): 1881 - 1883.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
S. K. Shukla, S. V. Ramaswamy, J. Conradt, M. E. Stemper, R. Reich, K. D. Reed, and E. A. Graviss
Novel Polymorphisms in mec Genes and a New mec Complex Type in Methicillin-Resistant Staphylococcus aureus Isolates Obtained in Rural Wisconsin
Antimicrob. Agents Chemother., August 1, 2004; 48(8): 3080 - 3085.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
M. Li, M. Guan, X. F. Jiang, F. Y. Yuan, M. Xu, W. Z. Zhang, and Y. Lu
Genetic polymorphism of the accessory gene regulator (agr) locus in Staphylococcus epidermidis and its association with pathogenicity
J. Med. Microbiol., June 1, 2004; 53(6): 545 - 549.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
I. Spiliopoulou, E. Petinaki, P. Papandreou, and G. Dimitracopoulos
erm(C) is the predominant genetic determinant for the expression of resistance to macrolides among methicillin-resistant Staphylococcus aureus clinical isolates in Greece
J. Antimicrob. Chemother., May 1, 2004; 53(5): 814 - 817.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
A. E. Rosato, B. N. Kreiswirth, W. A. Craig, W. Eisner, M. W. Climo, and G. L. Archer
mecA-blaZ Corepressors in Clinical Staphylococcus aureus Isolates
Antimicrob. Agents Chemother., April 1, 2003; 47(4): 1460 - 1463.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
J. Watson, R. Givney, M. Beard-Pegler, B. Rose, J. Merlino, A. Vickery, T. Gottlieb, R. Bradbury, and C. Harbour
Comparative Analysis of Multidrug-Resistant, Non-Multidrug-Resistant, and Archaic Methicillin-Resistant Staphylococcus aureus Isolates from Central Sydney, Australia
J. Clin. Microbiol., February 1, 2003; 41(2): 867 - 872.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
E. Dominguez, M. Zarazaga, and C. Torres
Antibiotic Resistance in Staphylococcus Isolates Obtained from Fecal Samples of Healthy Children
J. Clin. Microbiol., July 1, 2002; 40(7): 2638 - 2641.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Petinaki, E.
Right arrow Articles by Spiliopoulou, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petinaki, E.
Right arrow Articles by Spiliopoulou, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?