Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Nagai, K.
Right arrow Articles by Appelbaum, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagai, K.
Right arrow Articles by Appelbaum, P. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of Antimicrobial Chemotherapy (2000) 46, 909-915
© 2000 The British Society for Antimicrobial Chemotherapy

In vitro development of resistance to ceftriaxone, cefprozil and azithromycin in Streptococcus pneumoniae

Kensuke Nagaia, Todd A. Daviesa, Bonifacio E. Dewassea, Glenn A. Pankucha, Michael R. Jacobsb and Peter C. Appelbauma,*

a Departments of Pathology (Clinical Microbiology), Hershey Medical Center, 500 University Drive, Hershey, PA 170331, USA; b Case Western Reserve University, Cleveland, OH 441062, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Approval of ceftriaxone for the treatment of otitis media has led to fear of selection of resistant mutants owing to widespread use. To test this, we examined the ability of sequential subcultures in sub-MICs of ceftriaxone, cefprozil and azithromycin to select resistant mutants in 12 pneumococci. Daily subculturing was performed 50 times or until mutants with raised ceftriaxone, cefprozil or azithromycin MICs were selected. Of eight ceftriaxone-susceptible parents, ceftriaxone did not select for any resistant mutants, while cefprozil selected for four mutants (MICs 2–4 mg/L after 21–50 subcultures). Among four ceftriaxone-resistant parents, subculturing in ceftriaxone selected for one stable mutant with raised ceftriaxone MIC (>16 mg/L after 21 subcultures) and subculturing in cefprozil selected for one mutant with raised cefprozil MIC (64 mg/L after 44 subcultures). Mutations were observed in pbp2x and pbp1a. Among six azithromycin-susceptible parents, subculturing in azithromycin selected for five resistant mutants (MIC 0.5–32 mg/L after 10–42 passages) and among six azithromycin-resistant strains, subculturing selected for mutants with raised azithromycin MICs in all six strains (MIC 16–32 mg/L after 4–18 passages). All azithromycin-resistant mutants derived from azithromycinsusceptible parents had mutations in domain V of 23S rRNA while all azithromycin-resistant parents and derived mutants had mefE. Single-step mutation rates among the 12 strains at the MIC ranged from 1.5 x 10–6 to <6.2 x 10–10 for ceftriaxone, >1.3 x 10–5 to 8.9 x 10–8 for cefprozil and >1.1 x 10–6 to 6.7 x 10–10 for azithromycin. Multi-step and single-step testing showed that ceftriaxone selected for resistant mutants less often than cefprozil and azithromycin.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The worldwide incidence of infections caused by pneumococci resistant to penicillin and other antimicrobials has increased at an alarming rate during the past two decades and, in particular, during the past 5 years.13 There is an urgent need for antimicrobial agents that can be used for infections such a pneumonia, bronchitis, sinusitis and otitis media caused by penicillin-resistant pneumococci.

Ceftriaxone (one intramuscular dose) has recently been approved for the treatment of acute otitis media in the USA and is currently in use in Europe using three intramuscular doses over 3 days.4 Ceftriaxone, a third-generation cephalosporin, has broad-spectrum antibacterial activity including the three major causative agents of acute otitis media (Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis). Ceftriaxone has good time-dependent bacterial killing because of its long half-life in serum and middle ear fluid.5 The use of ceftriaxone has been shown in several studies to be as effective as 10 days of treatment with oral antibiotics such as amoxycillin ± clavulanate, cefaclor and trimethoprim–sulphamethoxazole for the treatment of acute otitis media in children.69 There is a concern that overuse or misuse of this drug could lead to an increase in resistance.

In a previous study10 designed to determine if the recent dramatic increase in incidence of drug-resistant pneumococci may be due in part to abuse of oral drugs such as macrolides and cephalosporins, we found that sequential subcultures in subinhibitory concentrations of azithromycin (used to represent the macrolide group), cefuroxime and cefaclor led to increased pneumococcal MICs. In this study we compare ceftriaxone with two other drugs, azithromycin and cefprozil, commonly used for the treatment of otitis media. Specifically, we repeatedly exposed 12 strains of S. pneumoniae to subinhibitory concentrations of ceftriaxone, cefprozil and azithromycin to determine if resistance developed. Gene sequencing of pbp2x and pbp1a and penicillin-binding protein (PBP)-labelling were performed on some strains to determine the mechanism of resistance to the cephalosporins and gene sequencing of 23S rRNA and L4 ribosomal protein was carried out to determine the mechanism of resistance to azithromycin.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bacteria and antimicrobial agents

Twelve clinical strains of S. pneumoniae isolated within the past 5 years were randomly selected. Organisms were identified by optochin susceptibility and classified by serotyping. Six were susceptible to ceftriaxone (MIC <= 0.5 mg/L) and azithromycin (MIC <= 0.5 mg/L); two were susceptible to ceftriaxone and resistant to azithromycin (MIC >= 2 mg/L); and four were resistant to ceftriaxone (MIC >= 2 mg/L) and azithromycin. The six azithromycin-resistant strains had mefE. Strains were stored at –70°C in double strength skimmed milk (Difco Laboratories, Detroit, MI, USA) before testing. Antimicrobials were obtained as follows: ceftriaxone (Roche Pharmaceuticals, Nutley, NJ, USA) cefprozil (Bristol-Myers Squibb, Princeton, NJ, USA), azithromycin (Hoechst Marion Roussel, Romainville, France).

MIC determination

MICs were determined by standardized microdilution methodology in Mueller–Hinton broth (Difco Laboratories) supplemented with 5% lysed horse blood.11

Breakpoints for the following compounds were those approved by the NCCLS12 with susceptibility breakpoints as follows: ceftriaxone <=0.5 mg/L, cefprozil <=2 mg/L and azithromycin <=0.5 mg/L.

Serial passages

Serial passaging was performed as described previously by Pankuch et al.10 For strains initially susceptible to the selecting drug, passaging was stopped when the strains became resistant to the selecting drug, except for cefprozil which was stopped when the MIC reached the upper limits of the susceptibility breakpoint (2 mg/L). Jacobs et al.3 have shown that a more realistic susceptibility breakpoint for ceprozil based on pharmacokinetic/pharmacodynamic parameters is 1 mg/L. For the strains that were initially resistant to the selecting drug, passaging was stopped when the MIC increased four-fold, irrespective of the number of subcultures. Strains were then subcultured in antibiotic-free medium for 10 serial passages and MICs of all drugs were retested to determine whether the phenotype was stable.

Single-step mutational frequency

Frequency of spontaneous single-step mutation was determined by spreading c. 1 x 1010 cfu/ml in 100 ml aliquots on brain–heart infusion agar (Difco) plates supplemented with 10% lysed horse blood containing 1 x, 2 x, 4 x, 8 x and 16 x MIC of each drug. Plates were incubated aerobically for 48–72 h and the numbers of mutants counted. Frequency rate was determined by dividing the number of mutants by the total number of cells spread on to the plate. Resistant mutants were confirmed by rechecking the MIC to the selecting drug.

Time–kill studies

Time–kill studies were performed on some parent and mutant strains as described previously.13

Serotyping

Serotyping of parent and passaged strains was performed by the standard Quellung method using sera from Statens Seruminstitut (Copenhagen, Denmark).

Pulsed-field gel electrophoresis

To determine whether resistant isolates obtained at the end of serial passages were derived from those tested at the beginning of the study, the parent strains and the strains with increased MICs obtained after the last passage were tested by pulsed-field gel electrophoresis (PFGE) using a CHEF DR III apparatus (Bio-Rad, Hercules, CA, USA) as described previously.10

PCR of macrolide resistance determinants

Template DNA for polymerase chain reaction (PCR) was prepared using the Prep-A-Gene kit (Bio-Rad) as recommended by the manufacturer. Strains were checked for the presence of ermB and mefE by amplification by the PCR using primers and cycling conditions described by Sutcliffe et al.14 Ribosomal mutations (23S rRNA and L4) were determined as described previously by Tait-Kamradt et al.15

PCR and gene sequencing of pbp2x and pbp1a

A 1.2 kb segment of pbp1a was amplified by PCR using the primers and cycling conditions as described by Asahi et al.16 A 2 kb segment of pbp2x was amplified using primers based on those described previously by Laible et al.17 as follows: pbp2x for 5'-478CGTGGGACTATTTATGACCGAAATGG503-3' and pbp2x rev 5'-2533ATTCCAGCACTGATGGAAATAAACATATTA2503-3'. PCR products were purified from primers and excess nucleotides using QIAquick PCR purification kit (Qiagen, Valencia, CA, USA) as recommended by the manufacturer and sequenced directly using an Applied Biosystems model 373A DNA sequencer using the following additional primers:

pbp1a-2, 5'-2384GTGAAAAAATGGCTGCTGCT2403-3'; pbp1a-3, 5'-2403AGCAGCAGCCATCTTTTCAC2384-5'; pbp1a-4, 5'-2963GATGAGCTTGAACTTTCAGC2944-3'; pbp2x-1, 5'-958TATGAAAAGGATCGTCTGGG997-3'; pbp2x-2, 5'-991GGAACAGAACAGTTTCCCAAC1112-3'; pbp2x-3, 5'-1354ATGCCACGATTCGAGATTGGG1375-3'; pbp2x-4, 5'-1488CAGGTAGCATCTCCCAT1471-3';

and pbp2x-5, 5'-2105AGAGAGTCTTTCATAGCTGAAGC2083-3'. Genes were sequenced three times each (twice in the forward direction and once in the reverse direction) on products of independent PCRs.

Detection of PBPs and PBP assay

One millilitre of early log phase culture was spun down for 30 s at 10000g. Cells were resuspended in 0.1 M phosphate buffer and incubated for 15 min at 37°C in various concentrations of unlabelled cefprozil or ceftriaxone. Two microcuries of [3H]benzylpenicillin (Amersham Life Sciences, Piscataway, NJ, USA) was added and incubated for 15 min at 37°C. Cells were lysed by the addition of 0.1 M phosphate buffer with 0.1% Triton X-100. A 10-fold excess of unlabelled benzylpenicillin was added and incubated for 10 min at 37°C. Labelled PBPs were separated by SDS– PAGE using a 7.5% gel and were visualized by fluorography using preflashed Hyperfilm MP (Amersham Life Sciences).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Subculturing in subinhibitory concentrations of antibiotic

MIC results from subculturing in subinhibitory concentrations of antibiotics are summarized in Table IGo. Of the eight ceftriaxone-susceptible parents, ceftriaxone did not select for any resistant mutants, while cefprozil selected for four mutants (cefprozil MIC 2–4 mg/L after 21–50 subcultures). One of these mutants (strain 1) had the cefprozil MIC revert back to the baseline MIC of 0.125 mg/L from >2 mg/L after 10 serial subcultures in the absence of antibiotic. Among four ceftriaxone-resistant parents, subculturing in ceftriaxone selected for mutants in all cases with raised ceftriaxone MICs (>=16 mg/L after 21–27 subcultures). However, after subculturing for 10 passages on drug-free media the ceftriaxone MICs reverted back to its initial levels for three of the four mutants. Of the four ceftriaxone-resistant parents, subculturing in cefprozil selected for one mutant with raised cefprozil MIC (64 mg/L after 44 subcultures).


View this table:
[in this window]
[in a new window]
 
Table I.. Multi-step resistance selection results
 
Among six azithromycin-susceptible parents, subculturing in azithromycin selected for five resistant mutants (azithromycin MIC > 0.5–32 mg/L after 10–42 passages) and one for which the MIC changed from >2 mg/L to 0.5 mg/L after 10 serial subcultures in the absence of antibiotic. Among six azithromycin-resistant strains, subculturing in azithromycin selected for mutants with raised azithromycin MICs in all six strains (MIC 16–32 mg/L after 4–18 passages). However, for five of the six azithromycin-selected mutants, the azithromycin MICs reverted back to baseline (or within one doubling dilution) after 10 passages on antibiotic-free media.

Azithromycin-selected mutants did not have higher ceftriaxone and cefprozil MICs and vice versa. Cefprozil-selected mutants did not have raised ceftriaxone MICs while cefprozil MICs were typically two to four times higher in ceftriaxone-selected mutants.

Single-step mutational frequency

Single-step mutational frequency rates are summarized in Table IIGo. At 1 x MIC the ceftriaxone single-step mutational frequency rates were less than or very similar to (same log) the cefprozil and azithromycin single-step mutational frequency rates in 10 of the 12 strains and 11 of the 12 strains, respectively. At 2 x MIC the ceftriaxone single-step mutational frequency rates were less than or very similar to (same log) the cefprozil and azithromycin single-step mutational frequency rates in 10 of the 12 and nine of the 12 strains, respectively. At 4 x MIC the ceftriaxone single-step mutational frequency rates were less than or very similar to (same log) the cefprozil and azithromycin single-step mutational frequency rates in 11 of the 12 strains in both cases. In almost all cases at 8 x and 16 x MIC, the single-step mutational frequency rates were very similar.


View this table:
[in this window]
[in a new window]
 
Table II.. Single-step mutational frequency
 
Time–kill studies

Time–kill studies were performed on some parent strains and derived mutants from serial passaging in subinhibitory concentrations of the antibiotics. Specifically, three ceftriaxone mutants (derived from parent strains 2, 4 and 9), three cefprozil mutants (derived from parent strains 2, 4 and 6) and three azithromycin mutants (derived from parent strains 1, 2 and 6) were tested (data not shown). The time–kill kinetics between the parent and derived mutants were essentially the same showing >=99% killing at 2 x and 4 x MIC after 24 h (data not shown).

ß-Lactam resistance mechanisms

Penicillin-binding protein genes pbp1a and pbp2x from parent strains 1, 7, 9, 12 and their derived mutants were sequenced to determine if resistance to cefprozil or ceftriaxone was associated with point mutations in the genes. Mutations were found in PBP1a at S457 to P (see Table IGo). Mutations in PBP2x occurred at A464 to T, and Y524 to C.

PBP competition experiments with ceftriaxone or cefprozil were also performed on parent strain 9 and its derived ceftriaxone and cefprozil mutants. No significant differences were observed between parent and mutants in the binding of cefprozil or ceftriaxone to PBP1a or PBP2x.

Serotyping, PFGE and macrolide resistance determinants

The 12 pneumococcal strains used comprised serogroups/ types 1, 6, 9, 14, 19 and 23. All mutants had identical serogroups/types and PFGE patterns to the parent strains from which they were derived.

The six azithromycin-susceptible parent strains did not contain mefE or ermB nor did the mutants derived from them. The mutants were checked for ribosomal mutations, specifically for mutations in domain V of 23S rRNA and ribosomal protein L4. All four mutants had mutations in domain V of 23S rRNA with two strains having four copies of the 23S rRNA gene mutated at position C2613 to A, one strain having three copies mutated at C2613 to T and one strain having two copies mutated at position C2058 to G (see Table IGo). The six azithromycin-resistant parent strains contained mefE as did the mutants derived from them.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
This study has shown that the development of resistance to ceftriaxone and cefprozil after repeated exposure to subinhibitory concentrations only occurs after numerous subcultures (>20, range 21–44) even among penicillin-resistant strains. Similar results were seen among azithromycin-selected mutants derived from azithromycin-susceptible parents (21–42 subcultures except for one strain which only needed 10 subcultures). However, azithromycin mutants derived from parent strains containing mefE developed raised MICs very quickly (usually in <=10 subcultures). These results are in agreement with a previous study of ours, which showed that development of resistance (if it occurred at all) occurred more slowly with ß-lactams (especially amoxycillin ± clavulanate) than the macrolides.10

Resistance to extended-spectrum cephalosporins is mediated primarily by a reduced affinity in PBP2x and to a lesser extent PBP1a.18 Mutations in or around S337TMK, S395SN or K547SG of PBP2x have been observed in resistant laboratory mutants and clinical isolates.15 Mutations in PBP1a at or around ST371MK (particularly T371 to A or to S) have been observed in resistant laboratory mutants and clinical isolates.16 Comparison of some PBP1a and PBP2x sequences between parent strains and their derived cefprozil- and ceftriaxone-selected mutants showed that some contained mutations; however, not in or around the important motifs described above. Mutations could have occurred in other PBPs that were not sequenced. Some strains of S. pneumoniae resistant to cefotaxime have been described that contain mutations in PBP3.18

The mechanism of resistance in the azithromycin-selected mutants derived from azithromycin-susceptible parent strains (i.e. ermB and mefE negative) was similar to the mechanism of resistance described in a previous study in which mutations were observed in domain V of 23S rRNA or ribosomal protein L4.15 Mutations were observed only in domain V of 23S rRNA in this study. Additionally, we recently found similar mutations among some macrolide-resistant clinical pneumococcal strains from Central and Eastern Europe (L4 mutations) and the USA (23S rRNA mutations).19

In summary, in this study we attempted to ascertain the potential of ceftriaxone, cefprozil and azithromycin to select for resistance by exposure of S. pneumoniae to subinhibitory and superinhibitory concentrations of the drugs. Resistant mutants were selected after exposure to all three drugs with ceftriaxone selecting for the least number of mutants and having the overall lowest single-step mutation frequencies compared with cefprozil and azithromycin. These in vitro data indicate that ceftriaxone has a lower potential to select for resistance than cefprozil and azithromycin.


    Acknowledgments
 
This study was supported by a grant from Roche Pharmaceuticals, Nutley, NJ, USA.


    Notes
 
* Corresponding author. Tel: +1-717-531-5113; Fax: +1-717-531-7953; E-mail: pappelbaum{at}psu.edu Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1 . Appelbaum, P. C. (1992). Antimicrobial resistance in Streptococcus pneumoniae: an overview. Clinical Infectious Diseases 15, 77–83.[ISI][Medline]

2 . Block, S., Harrison, C. J., Hedrick, J. A., Tyler, R. D., Smith, R. A., Keegan, E. et al. (1995). Penicillin-resistant Streptococcus pneumoniae in acute otitis media: risk factors, susceptibility patterns and antimicrobial management. Pediatric Infectious Disease Journal 14, 751–9.[ISI][Medline]

3 . Jacobs, M. J., Bajaksouzian, S., Zilles, A., Lin, G., Pankuch, G. A. & Appelbaum, P. C. (1999). Susceptibilities of Streptococcus pneumoniae and Haemophilus influenzae to 10 oral antimicrobial agents based on pharmacodynamic parameters: 1997 U.S. Surveillance Study. Antimicrobial Agents and Chemotherapy 43, 1901–8[Abstract/Free Full Text]

4 . Gehanno, P., Nguyen, L., Barry, B., Derriennic, M., Pichon, F., Goehrs, J. M. et al. (1999). Eradication by ceftriaxone of Streptococcus pneumoniae isolates with increased resistance to penicillin in cases of acute otitis media. Antimicrobial Agents and Chemotherapy 43, 16–20.[Abstract/Free Full Text]

5 . Gudnason, T., Gudbrandsson, F., Barsanti, F. & Kristinsson, K. G. (1998). Penetration of ceftriaxone into the middle ear fluid of children. Pediatric Infectious Disease Journal 17, 258–60.[ISI][Medline]

6 . Green, S. M. & Rothrock, S. G. (1993). Single-dose intramuscular ceftriaxone for acute otitis media in children. Pediatrics 91, 23–30.[Abstract/Free Full Text]

7 . Chamberlain, J. M., Boenning, D. A., Waisman, Y., Ochsenschlager, D. W. & Klein, B. L. (1994). Single-dose ceftriaxone versus 10 days of cefaclor for otitis media. Clinical Pediatrics 33, 642–6.

8 . Barnett, E. D., Teele, D. W., Klein, J. O., Cabral, H. J. & Kharasch, S. J. (1997). Comparison of ceftriaxone and trimethoprim– sulfamethoxazole for acute otitis media. Pediatrics 99, 23–8.[Abstract/Free Full Text]

9 . Cohen, R., Navel, M., Grunberg, J., Boucherat, M., Geslin, P., Derriennic, M., Pichon, F. et al. (1999). One dose ceftriaxone vs. ten days of amoxicillin/clavulanate therapy for acute otitis media: clinical efficacy and change in nasopharyngeal flora. Pediatric Infectious Disease Journal 18, 403–9.[ISI][Medline]

10 . Pankuch, G. A., Jueneman, S. A., Davies, T. A., Jacobs, M. R. & Appelbaum, P. C. (1998). In vitro selection of resistance to four ß-lactams and azithromycin in Streptococcus pneumoniae. Antimicrobial Agents and Chemotherapy 42, 2914–18.[Abstract/Free Full Text]

11 . National Committee for Clinical Laboratory Standards. (1998). Performance Standards for Antimicrobial Susceptibility Testing. M100-S8. NCCLS, Villanova, PA.

12 . National Committee for Clinical Laboratory Standards. (2000). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically. M7-A5. NCCLS, Villanova, PA.

13 . Pankuch, G. A., Lichtenberger, C., Jacobs, M. R. & Appelbaum, P. C. (1996). Antipneumococcal activities of RP 59500 (quinupristin–dalfopristin), penicillin G, erythromycin, and sparfloxacin determined by MIC and rapid time–kill methodologies. Antimicrobial Agents and Chemotherapy 40, 1653–6.[Abstract]

14 . Sutcliffe, J., Grebe, T., Tait-Kamradt, A. & Wondrack, L. (1996). Detection of erythromycin-resistant determinants by PCR. Antimicrobial Agents and Chemotherapy 40, 2562–6.[Abstract]

15 . Tait-Kamradt, A., Davies, T., Jacobs, M., Appelbaum, P. & Sutcliffe, J. (1999). Mutations in 23S rRNA and L4 ribosomal proteins account for resistance in pneumococcal strains selected in vitro by macrolide passage. In Abstracts of the Thirty-Ninth Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, CA, 1999. Abstract C-0842, p.116. American Society for Microbiology, Washington, DC.

16 . Asahi, Y. & Ubukata, K. (1998). Association of a Thr-371 substitution in a conserved amino acid motif of penicillin-binding protein 1A with penicillin resistance of Streptococcus pneumoniae. Antimicrobial Agents and Chemotherapy 42, 2267–73.[Abstract/Free Full Text]

17 . Laible, G., Spratt, B. G. & Hakenbeck, R. (1991). Interspecies recombinational events during the evolution of altered PBP2x genes in penicillin-resistant clinical strains of Streptococcus pneumoniae. Molecular Microbiology 5, 1993–2002.[ISI][Medline]

18 . Hakenbeck, R. (1999). ß-Lactam-resistant Streptococcus pneumoniae: epidemiology and evolutionary mechanism. Chemotherapy 45, 83–94.[ISI][Medline]

19 . Tait-Kamradt, A., Davies, T., Brennan, L., Depardieu, P., Courvalin, P., Duigan, J. et al. (1999). Two new mechanisms of resistance to macrolides in clinical isolates of Streptococcus pneumoniae. In Final Program, Abstracts and Exhibits Addendum of the Thirty-Ninth Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, CA, 1999. Abstract LB-8, p. 15. American Society for Microbiology, Washington, DC.

Received 11 April 2000; returned 27 June 2000; revised 18 July 2000; accepted 14 August 2000


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
K. Nagai, T. A. Davies, M. R. Jacobs, and P. C. Appelbaum
Effects of Amino Acid Alterations in Penicillin-Binding Proteins (PBPs) 1a, 2b, and 2x on PBP Affinities of Penicillin, Ampicillin, Amoxicillin, Cefditoren, Cefuroxime, Cefprozil, and Cefaclor in 18 Clinical Isolates of Penicillin-Susceptible, -Intermediate, and -Resistant Pneumococci
Antimicrob. Agents Chemother., May 1, 2002; 46(5): 1273 - 1280.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
A. J. de Neeling, B. P. Overbeek, A. M. Horrevorts, E. E. J. Ligtvoet, and W. G. Goettsch
Antibiotic use and resistance of Streptococcus pneumoniae in The Netherlands during the period 1994-1999
J. Antimicrob. Chemother., September 1, 2001; 48(3): 441 - 444.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Nagai, K.
Right arrow Articles by Appelbaum, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagai, K.
Right arrow Articles by Appelbaum, P. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?