Journal of Antimicrobial Chemotherapy (2000) 45, 783-788
© 2000 The British Society for Antimicrobial Chemotherapy
Analysis of the effects of –42 and –32 ampC promoter mutations in clinical isolates of Escherichia coli hyperproducing AmpC
a Laboratoire de Bactériologie–Virologie, Faculté de Pharmacie, 1 rue Gaston Veil, 44035 Nantes; b Laboratoire de Bactériologie, Virologie, Hygiène hospitalière, CHU, Nantes, France
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Escherichia coli usually produces only very small amounts of a constitutive AmpC ß-lactamase, but clinical strains overproducing this enzyme have been isolated. Three different ampC promoters of E. coli clinical strains were cloned upstream of the chloramphenicol acetyltransferase (CAT) gene in the pKK232-8 reporter plasmid and their relative strengths were compared by two different methods. The strength of the promoters from AmpC hyperproducers was 70- to 120-fold higher than those from a low-level AmpC producer. One of the strong promoters, which differs from strain K12 at bases –88, –82, –42, –18, –1 and +58, was mutated to abolish the –42 mutation. This change resulted in a 43-fold decrease in CAT concentration. In another promoter, with eight different mutations at positions –88, –82, –32, –18, –1, +5, +24 and +58, the –32T
A transversion, which created perfect homology with the –35 consensus sequence, was reverted; this led to a 13-fold decrease in CAT concentration. The –42 and –32 mutations play an important role in E. coli resistance to ß-lactams by increasing ampC transcription. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Escherichia coli AmpC cephalosporinase differs from other class C chromosomal ß-lactamases of Enterobacteriaceae in that its production is not inducible but constitutive.1 As a consequence, AmpC production depends mostly on the strength of the ampC promoter, although other factors—such as gene amplification or insertion of an IS2 sequence—can cause AmpC hyperproduction in vitro.2,3
Numerous mutations have been described in the ampC promoter of clinical strains hyperproducing a chromosomal cephalosporinase,4–7 but the precise role of these mutations has not been determined. Some of them may be simple polymorphisms while others are certainly responsible for an increased trancription rate.
The most frequently described E. coli ampC ‘strong’ promoter harbours mutations at positions –88, –82, –42, –18, –1 and +58.5 The –42CT transition creates a new displaced –35 perfect consensus sequence, TTGACA, separated by 17 bp from a new –10 sequence, caused by the –18GA transition.7 Less frequent mutations have been described in clinical strains, particularly in the attenuator and in the fourth base of the –35 box. This last mutation has also been described in mutants selected in vitro.8
In this paper, different ampC promoters from E. coli clinical strains were cloned upstream of the chloramphenicol acetyltransferase (cat) gene in the reporter plasmid pKK232-8.9 By site-directed mutagenesis, we have investigated the role of the –32 and –42 mutations that create a consensus TTGACA sequence.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Bacterial strains and plasmids
All plasmids were obtained by transforming highly competent JM109 cells (Promega, Charbonnières, France). pGEM-T Easy vector (Promega) was used for post-PCR cloning experiments, pKK232-8 (Amersham Pharmacia Biotech, Uppsala, Sweden) as a promoterless reporter gene and pALTER-Ex2 (Promega) for site-directed mutagenesis experiments. Strain 96006296 is a susceptible E. coli clinical isolate. E. coli strains 96004153 and 96010266 are AmpC hyperproducers.6 Details of the plasmids used in this study are given in Table I
.
|
PCR amplification of the E. coli ampC promoter
Primers AB1 (151GATCGTTCTGCCGCTGTG134) (5' to 3') and ampC2 (120GGGCAGCAAATGTGGAGCAA101) (5' to 3') were used to amplify a 271 bp fragment containing the –35 box, the –10 box and the attenuator from the E. coli ampC promoter.10 PCR amplification was performed in a Perkin–Elmer 480 DNA thermal cycler (Perkin–Elmer Applied Biosystems, Cergy-Pontoise, France). PCR reactions were performed in a final volume of 50 µL containing 10 mM Tris–HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 200 µM of each nucleotide, 0.5 µM of each primer, 2.5 units of Taq DNA polymerase (Gibco BRL Life Technologies SARL, Cergy Pontoise, France) and 10 ng of target DNA. After 90 s denaturation at 94°C, 30 PCR cycles were performed, each consisting of 90 s denaturation at 94°C, 30 s annealing at 57°C and 60 s extension at 72°C; a final extension step of 10 min at 72°C was performed.
Construction of reporter plasmids
The 271 bp PCR fragment was cloned in the post-PCR cloning vector, pGEM-T Easy. This plasmid was then digested with EcoRI and the fragment containing the ampC promoter was recovered from a low-melting-point agarose gel, blunt ended with the Klenow fragment of E. coli DNA polymerase I, and ligated into the SmaI restriction site of pKK232-8, previously treated with calf intestinal phosphatase (Promega). After overnight incubation at 16°C, these ligation products were used to transform highly competent JM109 cells (Promega).
Preparation of mutant promoters by site-directed mutagenesis
Site-directed mutagenesis was performed using the Altered Sites II Ex2 in vitro mutagenesis system (Promega). The EcoRI-digested fragment from pGEM-T Easy was subcloned in the EcoRI site of the mutagenesis vector pALTER-Ex2. This vector contains genes for tetracycline and chloramphenicol resistance, but the latter has been inactivated. During the mutagenesis reaction, a chloramphenicol repair oligonucleotide was annealed to alkali-denatured DNA at the same time as the mutagenesis oligonucleotide, and restored resistance to chloramphenicol. The mutagenesis reaction was carried out according to the manufacturer's recommendations; mutants were selected on LB agar containing chloramphenicol 20 mg/L. The mutagenic oligonucleotides, Mut32 (41P-TGACAGTTGTCACGCTGAT23) (5' to 3') for strain 96004153 and Mut42 (51P-GCTGCTATCCTGACAGTTG33 (5' to 3') for strain 96010266 were centred on the desired mutations and 5'-phosphorylated (Genosys Biotechnologies, London, UK). The EcoRI fragments from the mutated promoters were then subcloned in pKK232-8, as previously described.
Verification of the constructions
In order to control the sequence of the inserted fragments, two primers from pKK232-8, pKK1 (122TGCGAAGCAACGGCCCGG139) and pKK2 (212AAGCTTGGCTGCAGGTCGA194) (5' to 3') were synthesized to amplify a 389 bp fragment containing the 271 bp from the ampC gene. The PCR products were then purified on a Bio-Gel P100 (Bio-Rad SA, Ivry Sur Seine, France) and sequenced in both strands with the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin–Elmer). Sequence analysis was performed on a ABI 373 DNA sequencer (Perkin–Elmer).
CAT assays
Bacteria containing each plasmid were cultured overnight in 20 mL of Luria broth. The bacterial pellet was obtained by centrifugation of the previous culture for 30 min at 10000g. After washing and resuspension in distilled water, bacteria were sonicated in a Branson Sonifier 250 (intermittent exposure: 5 x 30 s). After centrifugation, the supernatant was used for CAT determination. Total protein concentration was determined by the ESL protein assay (Boehringer Mannheim, Meylan, France) and the volume of extract used for CAT determination was adjusted to equalize the protein concentration. CAT enzyme was measured by a sandwich ELISA test performed in a microtitre plate (Boehringer Mannheim). This test, which quantifies CAT in transfected eukaryotic cells, was used according to the manufacturer's recommendation except that five dilutions of total protein (250, 25, 2.5, 0.25 and 0.025 µg/mL) were tested for each sample to be in the linear range of the test. Each determination was performed in triplicate. Untransfected JM109 cells were used as a control.
MIC determinations
The chloramphenicol MIC was determined by serial two-fold dilution in Mueller–Hinton agar (Difco Laboratories, Detroit, MI, USA). Inocula of 104 cfu per spot from an 18 h culture in Mueller–Hinton broth were applied with a Steers multiple-inoculum replicator. After 18 h incubation at 37°C, the chloramphenicol MIC was defined as the lowest concentration that prevented visible growth of the spot on the plate.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Strength of the different ampC promoters
A 271 bp fragment containing the promoter of the gene for three different AmpC ß-lactamases from three E. coli clinical strains was cloned upstream of the cat gene of the reporter plasmid pKK232-8. The sequences of the cloned fragments are shown in the Figure. One of the promoters came from a susceptible E. coli strain (96006296); the other two were from strains hyperproducing a chromosomal cephalosporinase. These constructs were used to transform E. coli JM109 competent cells. CAT determination was then performed in two ways: (i) indirectly, by measuring the chloramphenicol MIC; and (ii) directly, using an immunoenzymatic method (Table II).
|
|
With untransformed JM109 cells, the CAT concentration was low. In the same cells transformed with pKK232-8, neither the CAT concentration nor the MIC of chloramphenicol increased, confirming the absence of promoter activity for the cat gene in this plasmid. For plasmids containing a promoter from E. coli ampC ß-lactamase, the CAT concentration was always greater. A significant difference was observed between the plasmid containing the promoter from the susceptible isolate and those containing promoters from AmpC hyperproducers. In the presence of a strong promoter, the chloramphenicol MIC was 64-fold higher while CAT concentrations increased 70- to 120-fold, according to the type of promoter inserted.
Role of the –42 and –32 point mutations
Using site-directed mutagenesis, the promoter from strain 96010266 was modified by reverting the CT transition at position –42. This single change in the promoter sequence resulted in the CAT concentration and chloramphenicol MIC decreasing to levels found with the promoter of a susceptible isolate (Table III).
|
Using the same method, the promoter from strain 96004153 was modified, causing reversion of the T
A transversion at position –32. This change resulted in a 13-fold decrease in the CAT concentration, and a decrease in chloramphenicol MIC from 2048 to 256 mg/L (Table III
). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Reporter genes have been widely used for studying gene regulation and comparing the strength of various promoters in eukaryotes and prokaryotes. The first protein to be used as a reporter was CAT,11 but numerous other systems have been developed since then, including ß-galactosidase, luciferase and alkaline phosphatase.12 In this study, we used the plasmid pKK 232-8, containing a promoterless cat gene, to study transcriptional regulation of the ampC gene from E. coli. This method has been widely used for studying prokaryotic gene expression,9 including ß-lactamase gene expression.13,14 CAT production can be assessed easily by measuring the MIC of chloramphenicol.15 CAT concentration was determined accurately using a simple, non-radioactive, immunological method. This method, previously used for CAT determination in transfected eukaryotic cells, has been adapted for plant protoplasts, but not for bacteria.16
With this method, CAT concentration was 70- to 120-fold higher when a strong promoter was cloned than when a weak promoter from a sensitive isolate was used. At the same time, the chloramphenicol MIC increased by 64-fold. Aramori & Kojo showed a 23- to 70-fold increase in CAT activity for ampC promoters from E. coli hyperproducing a chromosomal cephalosporinase, but the sequence of these promoters was unknown.17 Recently, using a luciferase reporter gene method, Nelson & Elisha detected an eight- to 18-fold increase in promoter strength from AmpC hyperproducers.7
In 1983, by analysis of 168 promoter regions of E. coli genes, Hawley & McClure confirmed the presence of two conserved regions, the –35 hexamer and the –10 hexamer, also called the Pribnow box.18 It is now known that these elements are crucial for fixation of the 
subunit of RNA polymerase.19 For most promoters, there is a good correlation between promoter strength and the degree of homology to the consensus sequence for the –35 box, TTGACA, and for the –10 box, TATAAT. The distance between these two sequences also plays an important role in the strength of the promoter, the optimal distance being 17 bp.20 In E. coli wild-type ampC promoter, a –35 TTGTCA sequence is separated by 16 bp from a –10 TACAAT sequence. The most frequently described strong ampC E. coli promoter presents a CT transition at base –42 that creates a perfect TTGACA box upstream of the normal –35 box, modifying the transcription initiation site.4 By site-directed mutagenesis, we confirmed that the abolition of this single mutation in the promoter from strain 96010266 decreased its strength to the level of a sensitive isolate. This does not mean that other mutations present in this promoter do not play any role. The –18 mutation, by creating a new –10 box, certainly plays an important role.
In the ampC promoter from strain 96004153, the TA transversion at position –32 gave perfect homology to the –35 sequence and was suspected to increase the transcription rate. This hypothesis was confirmed by reverting this mutation using site-directed mutagenesis; the strength of the mutated promoter was decreased by about 13-fold. However, it was still stronger than the weak promoters (96006296), suggesting that at least one of the other mutations present in this strong promoter must be implicated in the increased transcription rate. Among the other mutations, one (+24 mutation) is localized in the attenuator. This structure has been identified in the E. coli ampC promoter and is involved in low-level transcription of the gene.21 A mutation in this part of the gene could destabilize the hairpin structure and increase transcription. We tried to revert the mutation at position +24, but were not successful, probably because of the hairpin structure.22
With this system, it could be interesting to determine the role played by mutations in other parts of the promoter, particularly in the Pribnow box, since such mutations have been described in laboratory mutants but, as yet, not in clinical strains.8
|
Acknowledgments |
|---|
This study was supported by grants from SmithKline Beecham Laboratories.
|
Notes |
|---|
* Corresponding author. Tel: +33-2-40412952; Fax: +33-2-40083829; E-mail: interepi{at}chu-nantes.fr
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
1 . Medeiros, A. A. (1997). ß-Lactamases: quality and resistance. Clinical Microbiology and Infection 3, Suppl. 1, S2–8.
2 . Edlund, T., Grundstrom, T. & Normark, S. (1979). Isolation and characterization of DNA repetitions carrying the chromosomal ß- lactamase gene of Escherichia coli K12. Molecular and General Genetics 173, 115–25.
3 . Jaurin, B. & Normark, S. (1983). Insertion of IS2 creates a novel ampC promoter in Escherichia coli. Cell 32, 809–16.[Web of Science][Medline]
4 . Olsson, O., Bergström, S. & Normark, S. (1982). Identification of a novel ampC ß-lactamase promoter in a clinical isolate of Escherichia coli. EMBO Journal 1, 1411–6.[Web of Science][Medline]
5
.
Olsson, O., Bergström, S., Lindberg, F. P. & Normark, S. (1983). ampC ß-lactamase hyperproduction in Escherichia coli: natural ampicillin resistance generated by horizontal chromosomal DNA transfer from Shigella. Proceedings of the National Academy of Sciences, USA 80, 7556–60.
6 . Caroff, N., Espaze, E., Bérard, I., Richet, H. & Reynaud, A. (1999). Mutations in the ampC promoter of Escherichia coli isolates resistant to oxyiminocephalosporins without extended-spectrum ß-lactamase production. FEMS Microbiology Letters 173, 459–65.[Web of Science][Medline]
7
.
Nelson, E. C. & Elisha, B. G. (1999). Molecular basis of AmpC hyperproduction in clinical isolates of Escherichia coli. Antimicrobial Agents and Chemotherapy 43, 957–9.
8 . Jaurin, B., Grundström, T. & Normark, S. (1982). Sequence elements determining ampC promoter strength in E. coli. EMBO Journal 1, 875–81.[Web of Science][Medline]
9 . Brosius, J. (1984). Plasmid vectors for the selection of promoters. Gene 27, 151–60.[Web of Science][Medline]
10
.
Jaurin, B. & Grundström, T. (1981). ampC cephalosporinase of Escherichia coli K-12 has a different evolutionary origin from that of ß-lactamases of the penicillinase type. Proceedings of the National Academy of Sciences, USA 78, 4897–901.
11 . Lewis, J. C., Feltus, A., Ensor, C. M., Ramanathan, S. & Daunert, S. (1998). Applications of reporter genes. Analytical Chemistry 70, 579A–85A.[Medline]
12 . Groskreutz, D. & Schenborn, E. T. (1997). Reporter systems. Methods in Molecular Biology 63, 11–30.
13 . Levesque, C., Brassard, S., Lapointe, J. & Roy, P. H. (1994). Diversity and relative strength of tandem promoters for the antibiotic-resistance genes of several integrons. Gene 142, 49–54.[Web of Science][Medline]
14
.
Fournier, B., Gravel, A., Hooper, D. C. & Roy, P. H. (1999). Strength and regulation of the different promoters for chromosomal ß-lactamases of Klebsiella oxytoca. Antimicrobial Agents and Chemotherapy 43, 850–5.
15
.
Sohaskey, C. D., Arnold, C. & Barbour, A. G. (1997). Analysis of promoters in Borrelia burgdorferi by use of a transiently expressed reporter gene. Journal of Bacteriology 179, 6837–42.
16 . Porsch, P., Merkelbach, S., Gehlen, J. & Fladung, M. (1993). The nonradioactive chloramphenicol acetyltransferase-enzyme-linked immunosorbent assay test is suited for promoter activity studies in plant protoplasts. Analytical Biochemistry 211, 113–6.[Web of Science][Medline]
17 . Aramori, I., Kojo, H., Nishida, M., Goto, S. & Kuwahara, S. (1988). Role of cephalosporinase gene in the resistance of clinically isolated cephem-resistant Escherichia coli. Journal of Antibiotics 41, 113–22.[Medline]
18
.
Hawley, D. K. & McClure, W. R. (1983). Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Research 11, 2237–55.
19 . Busby, S. & Ebright, R. H. (1994). Promoter structure, promoter recognition, and transcription activation in prokaryotes. Cell 79, 743–6.[Web of Science][Medline]
20
.
deHaseth, P. L., Zupancic, M. L. & Record, M. T. (1998). RNA polymerase–promoter interactions: the comings and goings of RNA polymerase. Journal of Bacteriology 180, 3019–25.
21 . Jaurin, B., Grundström, T., Edlund, T. & Normark, S. (1981). The E. coli ß-lactamase attenuator mediates growth rate-dependent regulation. Nature 290, 221–5.[Medline]
22 . Ling, M. M. & Robinson, B. H. (1997). Approaches to DNA mutagenesis: an overview. Analytical Biochemistry 254, 157–78.[Web of Science][Medline]
Received 30 September 1999; returned 21 December 1999; revised 12 January 2000; accepted 21 January 2000
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Grobner, D. Linke, W. Schutz, C. Fladerer, J. Madlung, I. B. Autenrieth, W. Witte, and Y. Pfeifer Emergence of carbapenem-non-susceptible extended-spectrum {beta}-lactamase-producing Klebsiella pneumoniae isolates at the university hospital of Tubingen, Germany J. Med. Microbiol., July 1, 2009; 58(7): 912 - 922. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. A. Jacoby AmpC {beta}-Lactamases Clin. Microbiol. Rev., January 1, 2009; 22(1): 161 - 182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Mammeri, M. Galleni, and P. Nordmann Role of the Ser-287-Asn Replacement in the Hydrolysis Spectrum Extension of AmpC {beta}-Lactamases in Escherichia coli Antimicrob. Agents Chemother., January 1, 2009; 53(1): 323 - 326. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Haldorsen, B. Aasnaes, K. H. Dahl, A.-M. Hanssen, G. S. Simonsen, T. R. Walsh, A. Sundsfjord, and E. W. Lundblad The AmpC phenotype in Norwegian clinical isolates of Escherichia coli is associated with an acquired ISEcp1-like ampC element or hyperproduction of the endogenous AmpC J. Antimicrob. Chemother., October 1, 2008; 62(4): 694 - 702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Vinue, M. Lantero, Y. Saenz, S. Somalo, I. de Diego, F. Perez, F. Ruiz-Larrea, M. Zarazaga, and C. Torres Characterization of extended-spectrum {beta}-lactamases and integrons in Escherichia coli isolates in a Spanish hospital J. Med. Microbiol., July 1, 2008; 57(7): 916 - 920. [Full Text] [PDF]
|
|
|
|
|
|
A. Smet, A. Martel, D. Persoons, J. Dewulf, M. Heyndrickx, B. Catry, L. Herman, F. Haesebrouck, and P. Butaye Diversity of Extended-Spectrum {beta}-Lactamases and Class C {beta}-Lactamases among Cloacal Escherichia coli Isolates in Belgian Broiler Farms Antimicrob. Agents Chemother., April 1, 2008; 52(4): 1238 - 1243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Mammeri, F. Eb, A. Berkani, and P. Nordmann Molecular characterization of AmpC-producing Escherichia coli clinical isolates recovered in a French hospital J. Antimicrob. Chemother., March 1, 2008; 61(3): 498 - 503. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Mammeri, L. Poirel, and P. Nordmann Extension of the hydrolysis spectrum of AmpC {beta}-lactamase of Escherichia coli due to amino acid insertion in the H-10 helix J. Antimicrob. Chemother., September 1, 2007; 60(3): 490 - 494. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Girlich, L. Poirel, A. Carattoli, I. Kempf, M.-F. Lartigue, A. Bertini, and P. Nordmann Extended-Spectrum {beta}-Lactamase CTX-M-1 in Escherichia coli Isolates from Healthy Poultry in France Appl. Envir. Microbiol., July 15, 2007; 73(14): 4681 - 4685. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Jorgensen, L. M. Cavaco, H. Hasman, H.-D. Emborg, and L. Guardabassi Occurrence of CTX-M-1-producing Escherichia coli in pigs treated with ceftiofur J. Antimicrob. Chemother., May 1, 2007; 59(5): 1040 - 1042. [Full Text] [PDF]
|
|
|
|
 |
|
 T. Spanu, M. Sanguinetti, M. Tumbarello, T. D'Inzeo, B. Fiori, B. Posteraro, R. Santangelo, R. Cauda, and G. Fadda Evaluation of the New VITEK 2 Extended-Spectrum Beta-Lactamase (ESBL) Test for Rapid Detection of ESBL Production in Enterobacteriaceae Isolates. J. Clin. Microbiol., September 1, 2006; 44(9): 3257 - 3262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Mammeri, L. Poirel, N. Fortineau, and P. Nordmann Naturally Occurring Extended-Spectrum Cephalosporinases in Escherichia coli. Antimicrob. Agents Chemother., July 1, 2006; 50(7): 2573 - 2576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Liebana, M. Batchelor, K. L. Hopkins, F. A. Clifton-Hadley, C. J. Teale, A. Foster, L. Barker, E. J. Threlfall, and R. H. Davies Longitudinal Farm Study of Extended-Spectrum {beta}-Lactamase-Mediated Resistance. J. Clin. Microbiol., May 1, 2006; 44(5): 1630 - 1634. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Brinas, M. Lantero, I. de Diego, M. Alvarez, M. Zarazaga, and C. Torres Mechanisms of resistance to expanded-spectrum cephalosporins in Escherichia coli isolates recovered in a Spanish hospital J. Antimicrob. Chemother., December 1, 2005; 56(6): 1107 - 1110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kojima, Y. Ishii, K. Ishihara, H. Esaki, T. Asai, C. Oda, Y. Tamura, T. Takahashi, and K. Yamaguchi Extended-Spectrum-{beta}-Lactamase-Producing Escherichia coli Strains Isolated from Farm Animals from 1999 to 2002: Report from the Japanese Veterinary Antimicrobial Resistance Monitoring Program Antimicrob. Agents Chemother., August 1, 2005; 49(8): 3533 - 3537. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. E. Coudron Inhibitor-Based Methods for Detection of Plasmid-Mediated AmpC {beta}-Lactamases in Klebsiella spp., Escherichia coli, and Proteus mirabilis J. Clin. Microbiol., August 1, 2005; 43(8): 4163 - 4167. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Fernandez-Cuenca, A. Pascual, and L. Martinez-Martinez Hyperproduction of AmpC {beta}-lactamase in a clinical isolate of Escherichia coli associated with a 30 bp deletion in the attenuator region of ampC J. Antimicrob. Chemother., July 1, 2005; 56(1): 251 - 252. [Full Text] [PDF]
|
|
|
|
|
|
D. M. Tracz, D. A. Boyd, L. Bryden, R. Hizon, S. Giercke, P. Van Caeseele, and M. R. Mulvey Increase in ampC promoter strength due to mutations and deletion of the attenuator in a clinical isolate of cefoxitin-resistant Escherichia coli as determined by RT-PCR J. Antimicrob. Chemother., May 1, 2005; 55(5): 768 - 772. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Brinas, M. A. Moreno, T. Teshager, Y. Saenz, M. C. Porrero, L. Dominguez, and C. Torres Monitoring and Characterization of Extended-Spectrum {beta}-Lactamases in Escherichia coli Strains from Healthy and Sick Animals in Spain in 2003 Antimicrob. Agents Chemother., March 1, 2005; 49(3): 1262 - 1264. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Mulvey, E. Bryce, D. A. Boyd, M. Ofner-Agostini, A. M. Land, A. E. Simor, S. Paton, the Canadian Hospital Epidemiology Committee, and the Canadian Nosocomial Infection Surveillance Pro Molecular Characterization of Cefoxitin-Resistant Escherichia coli from Canadian Hospitals Antimicrob. Agents Chemother., January 1, 2005; 49(1): 358 - 365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Mammeri, H. Nazic, T. Naas, L. Poirel, S. Leotard, and P. Nordmann AmpC {beta}-Lactamase in an Escherichia coli Clinical Isolate Confers Resistance to Expanded-Spectrum Cephalosporins Antimicrob. Agents Chemother., October 1, 2004; 48(10): 4050 - 4053. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Corvec, N. Caroff, E. Espaze, C. Giraudeau, H. Drugeon, and A. Reynaud AmpC cephalosporinase hyperproduction in Acinetobacter baumannii clinical strains J. Antimicrob. Chemother., October 1, 2003; 52(4): 629 - 635. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. K. Siu, P.-L. Lu, J.-Y. Chen, F. M. Lin, and S.-C. Chang High-Level Expression of AmpC {beta}-Lactamase Due to Insertion of Nucleotides between -10 and -35 Promoter Sequences in Escherichia coli Clinical Isolates: Cases Not Responsive to Extended-Spectrum-Cephalosporin Treatment Antimicrob. Agents Chemother., July 1, 2003; 47(7): 2138 - 2144. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Oliver, L. M. Weigel, J. K. Rasheed, J. E. McGowan Jr., P. Raney, and F. C. Tenover Mechanisms of Decreased Susceptibility to Cefpodoxime in Escherichia coli Antimicrob. Agents Chemother., December 1, 2002; 46(12): 3829 - 3836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Bagge, O. Ciofu, M. Hentzer, J. I. A. Campbell, M. Givskov, and N. Hoiby Constitutive High Expression of Chromosomal {beta}-Lactamase in Pseudomonas aeruginosa Caused by a New Insertion Sequence (IS1669) Located in ampD Antimicrob. Agents Chemother., November 1, 2002; 46(11): 3406 - 3411. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Brinas, M. Zarazaga, Y. Saenz, F. Ruiz-Larrea, and C. Torres {beta}-Lactamases in Ampicillin-Resistant Escherichia coli Isolates from Foods, Humans, and Healthy Animals Antimicrob. Agents Chemother., October 1, 2002; 46(10): 3156 - 3163. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Corvec, N. Caroff, E. Espaze, J. Marraillac, and A. Reynaud -11 Mutation in the ampC Promoter Increasing Resistance to {beta}-Lactams in a Clinical Escherichia coli Strain Antimicrob. Agents Chemother., October 1, 2002; 46(10): 3265 - 3267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Philippon, G. Arlet, and G. A. Jacoby Plasmid-Determined AmpC-Type {beta}-Lactamases Antimicrob. Agents Chemother., January 1, 2002; 46(1): 1 - 11. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||