Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Tavío, M. d. M.
Right arrow Articles by de Anta, M. T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tavío, M. d. M.
Right arrow Articles by de Anta, M. T. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of Antimicrobial Chemotherapy (2000) 45, 521-524
© 2000 The British Society for Antimicrobial Chemotherapy


Brief reports

In vitro selected fluoroquinolone-resistant mutants of Citrobacter freundii: analysis of the quinolone resistance acquisition

María del Mar Tavíoa,*, Jordi Vilab, Joaquím Ruizb, Gianfranco Amicosantec, Nicola Franceschinic, Antonio M. Martín-Sáncheza and María Teresa Jiménez de Antab

a Microbiology, Department of Clinical Sciences, School of Medicine, University of Las Palmas de Gran Canaria, Dr Pasteur, 35080 Las Palmas de Gran Canaria; b Department of Microbiology, Hospital Clinic, School of Medicine, University of Barcelona, Villarroel, 170, 08036 Barcelona, Spain; c Department of Science and Biomedical Technology, Universitá degli Studi dell’Aquila, Via Vetoio, Loc. Coppito, 67100 L’Aquila, Italy


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Ten quinolone-resistant mutants of Citrobacter freundii, which were selected in vitro with fluoroquinolones from two clinical isolates, were studied. The parent isolates were susceptible to quinolones in spite of showing a single substitution in the GyrB (His-417 -> Leu). No change was observed in the outer membrane proteins or in the lipopolysaccharide in any of the ten mutants studied with respect to their parent isolates. The development of quinolone resistance in selected mutants was associated with the appearance of a substitution in the GyrA (Thr-83 -> Ile) in nine of the ten mutants plus enhanced active efflux in all of them.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Resistance to fluoroquinolones is a growing problem in Citrobacter freundii as in other Enterobacteriaceae.15 Two types of mechanism are involved in quinolone resistance: (i) mutations in topoisomerases;15 and (ii) decreased accumulation of quinolones in bacterial cell.1,5,6 Previous studies have characterized mutations in bacterial topoisomerases in quinolone-resistant C. freundii clinical isolates,2,3 and other mutations in resistant isolates developed in vitro with nalidixic acid.1 Fluoroquinolones are the usual quinolones in clinical treatments. However, it is difficult to know what mutation steps led in vivo to fluoroquinolone resistance. In this study, the underlying changes with respect to a wildtype phenotype have been analysed in two C. freundii clinical isolates and in the fluoroquinolone-resistant mutants developed from them in vitro in consecutive selective steps.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Bacterial isolates and selection of mutants

Spontaneous resistant mutants were selected from two C. freundii clinical isolates (DM1 and DM2) with increasing fluoroquinolone concentrations (2x and 4x the MIC) on drug-containing MacConkey agar (Difco, Detroit, MI, USA). They are named after their parent isolate, followed by the initial letter of the selective agent used in the first, second and third selective steps: i.e. C for ciprofloxacin (Bayer, Barcelona, Spain), L for lomefloxacin (Searle, Madrid, Spain), T for temafloxacin (Abbott, Madrid, Spain), S for sparfloxacin (Rhône–Poulenc Rorer, Madrid, Spain) and O for ofloxacin (Roussel, Madrid, Spain). Only mutants in which norfloxacin MIC was >=2 mg/L were studied. Escherichia coli JF699 (OmpA deficient isolate), E. coli JF703 (OmpF deficient isolate) and E. coli KL16 (donated by Dr Berlyn, E. coli Genetic Stock Center, New Haven, CT, USA), and E. coli ATCC-25922, Klebsiella pneumoniae ATCC-10031 and C. freundii NCTC-9750 type isolate (tp) (donated by Dr Uruburu, CECT, Valencia, Spain) were used as controls.

Antibiotics and susceptibility tests

Tetracycline, nalidixic acid and norfloxacin were from Sigma (Madrid, Spain). MICs were determined by an agar dilution method according to NCCLS guidelines.7

Amplification and DNA sequencing of the quinolone resistance-determining region of the gyrA, gyrB and parC genes

They were performed using the previously described methods and oligonucleotide primers.4,5 The CATCGCCGCGAACGATTCGG primer was also used for parC gene amplification.

Preparation and analysis of outer membrane proteins (OMP) and lipopolysaccharide (LPS)

They were prepared and separated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE) using methods described previously.810

Measurements of norfloxacin accumulation

Norfloxacin accumulation was measured by the method previously described,5 simultaneously in each parent isolate and the quinolone-resistant mutants derived from it, with and without the presence of 50 and 100 µM carbonyl cyanide m-chlorophenylhydrazone (CCCP). The total bacterial suspension of each isolate (prepared at an optical density of 1.5 at 520 nm wavelength) was divided into three parts and 50 or 100 µM CCCP were added to two parts 10 min before norfloxacin 10 mg/L. Norfloxacin concentration in each cellular extract was measured at least six times by bioassay using K. pneumoniae ATCC-10031. The accepted standard deviation for all the norfloxacin uptake results was always <=5% with respect to each mean value of the three measurements that were taken at 5, 10, 15 and 20 min, with and without CCCP.


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Ten quinolone-resistant mutants (second and third selection step mutants) were induced in which norfloxacin MICs were >= 2 mg/L. The highest and lowest frequencies of selection of mutations were obtained with temafloxacin (10–6–10–5) and ciprofloxacin (10–8–10–7), respectively, on both parent isolates and were coincident with the highest and lowest fluoroquinolone MICs, respectively, in the parent isolates (TableGo).


View this table:
[in this window]
[in a new window]
 
Table. Susceptibilities of the parent isolates and mutants
 
Likewise, norfloxacin or ciprofloxacin MICs <= 0.5 mg/L in parent isolates were concordant with the absence of amino acid changes in the GyrA and ParC subunits.2,3 Nevertheless, a single substitution in the GyrB subunit (His-417 -> Leu) as a result of a complete change in the initial codon CAT -> TTG was identified in the DM1 and DM2 isolates, and the ten mutants. This gyrB mutation has not been described previously and its role in the development of quinolone resistance cannot be excluded, although further investigation is needed. Moreover, the ten selected mutants (except the TL isolate) showed the most common substitution in the GyrA protein (Thr-83 -> Ile), which was generated by a C -> T transversion in the codon ACC.2,3 Nevertheless, norfloxacin and ciprofloxacin MICs in our mutants (1–8 mg/L) are lower than those previously reported (6.25–25 mg/L) for the same single mutation in the gyrA gene, although other possible resistance mechanisms were not analysed in the earlier study.2

In the present study, the electrophoretic profiles of OMP or LPS were the same in the ten mutants and their parent isolates. The DM1 and DM2 isolates, and the ten quinolone-resistant mutants expressed a new band with an apparent molecular weight of 46 kDa that was not expressed in the fully sensitive NCTC-9750 (tp) (FigureGo). Furthermore, the ten mutants and parent isolates did not express a band with an electrophoretic mobility in urea–SDS–polyacrylamide gels similar to E. coli OmpC, although NCTC-9750 did express it (FigureGo). Both parent isolates and the ten mutants showed a LPS smooth phenotype, as did C. freundii NCTC-9750 (FigureGo). Therefore, it seems that permeability was not involved in the development of resistance to quinolones in the ten mutants studied with respect to their parent isolates.



View larger version (77K):
[in this window]
[in a new window]
 
Figure. Electrophoretic profiles of outer membrane proteins (10 µg of each sample) in 6 M urea–SDS–polyacrylamide gel (a–c) and lipopolysaccharide extracts in 15% polyacrylamide gel with 0.5% SDS after silver staining (d). (a) Lanes: 1, E. coli JF703; 2, E. coli JF699; 3, E. coli KL16; 4, DM1; 5, DM1.TTT; 6, DM2; 7, DM2.TTT; 8, DM2.TT; 9, C. freundii NCTC-9750; 10, mol. wt standards. (b) Lanes: 1, E. coli KL16; 2, C. freundii NCTC-9750; 3, DM1; 4, DM2. (c) Lanes: 1, E. coli KL16; 2, DM2; 3, DM2.TS; 4, DM2.TL; 5, DM2.TOO; 6, DM2.TOL; 7, DM2.SSS; 8, DM2.SLL; 9, DM2.CC. (d) Lanes: 1, C. freundii NCTC-9750; 2, DM1; 3, DM1.TTT; 4, DM2; 5, DM2.TTT; 6, DM2.TT; 7, DM2.TS; 8, DM2.TL; 9, DM2.TOO; 10, DM2.TOL; 11, DM2.SSS; 12, DM2.SLL; 13, DM2.CC. Mol. wt standards correspond to, from top to bottom, bovine serum albumin (66 kDa), ovalbumin (45 kDa), glyceraldehyde-3-phosphate dehydrogenase (36 kDa).

 
The DM1 and DM2 isolates did not accumulate less norfloxacin than C. freundii NCTC-9750 and other previously described fully sensitive C. freundii isolates despite their different OMP electrophoretic profile.1 Nevertheless, the ten mutants accumulated <=50% of the norfloxacin accumulated by their parent isolates. The mean norfloxacin uptake measured within 20 min after its addition (in nanograms of norfloxacin accumulated per mg of dry cell) was in the range 50–57 ng in the DM2.CC and DM2.TTT mutants and 21–37 ng for the remaining eight mutants. The norfloxacin uptake increment was the same in the presence of 50 µM or 100 µM CCCP in the isolates studied and it was 1.7- to 6.3-fold in the ten mutants studied. Enhanced efflux might therefore be contributing to the increase in the fluoroquinolone MICs in these ten mutants, as has been previously reported.5,6 In this way, tetracycline and fluoroquinolone MICs increased in the mutants as well as CCCP MIC (200 µM in the DM1, DM2 and NCTC-9750 isolates and DM2.TS, and 400 µM in the remaining nine quinolone-resistant mutants). All of these drugs are substrates of active efflux systems in other Enterobacteriaceae.6 Furthermore, CCCP caused nearly a doubling in the norfloxacin uptake in the DM1, DM2 and NCTC-9750 isolates, also suggesting an enhanced efflux in these isolates.

These results suggest that the development of resistance to fluoroquinolones in nine selected mutants of C. freundii resulted from a combination of enhanced efflux and a single substitution in the GyrA subunit. However, only enhanced active efflux plus the pre-existent single mutation in the gyrB gene can explain the fluoroquinolone MICs in the TL isolate.


    Notes
 
* Corresponding author. Tel: +34-928-453405/451459; Fax: +34-928-451416; E-mail: mtavio{at}infovia.ulpgc.es Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
1 . Aoyama, H., Fujimaki, K., Sato, K., Fuji, T., Inoue, M., Hirai, K. et al. (1988). Clinical isolate of Citrobacter freundii highly resistant to new quinolones. Antimicrobial Agents and Chemotherapy 32, 922–4.[Abstract/Free Full Text]

2 . Nishino, J., Deguchi, T., Yasuda, M., Kawamura, T., Nakano, M., Kanematsu, E. et al. (1997). Mutations in the gyrA and parC genes associated with fluoroquinolone resistance in clinical isolates of Citrobacter freundii. FEMS Microbiology Letters 154, 409–14.[Web of Science][Medline]

3 . Weigel, L. M., Steward, C. D. & Tenover, F. C. (1998). gyrA mutations associated with fluoroquinolone resistance in eight species of Enterobacteriaceae. Antimicrobial Agents and Chemotherapy 42, 2661–7.[Abstract/Free Full Text]

4 . Vila, J., Ruiz, J., Goñi, P. & Jiménez de Anta, M. T. (1996). Detection of mutations in parC in quinolone-resistant clinical isolates of Escherichia coli. Antimicrobial Agents and Chemotherapy 40, 491–3.[Abstract]

5 . Tavío, del Mar M., Vila, J., Ruiz, J., Ruiz, J., Martín-Sánchez, A. M. & Jiménez de Anta, M. T. (1999). Mechanisms involved in the development of resistance to fluoroquinolones in Escherichia coli isolates. Journal of Antimicrobial Chemotherapy 44, 735–42.[Abstract/Free Full Text]

6 . Marshall, N. J. & Piddock, L. J. V. (1997). Antibacterial efflux systems. Microbiología 13, 285–300.

7 . National Committee for Clinical Laboratory Standards. (1996). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically—Third Edition: Approved Standard M7-A3. NCCLS, Villanova, PA.

8 . Sawai, T., Hiruma, R., Kawana, N., Kaneko, M., Taniyasu, F. & Inami, A. (1982). Outer membrane permeation of ß-lactam antibiotics in Escherichia coli, Proteus mirabilis, and Enterobacter cloacae. Antimicrobial Agents and Chemotherapy 22, 585–92.[Abstract/Free Full Text]

9 . Peterson, A. A. & McGroarty, E. J. (1985). High-molecular-weight components in lipopolysaccharides of Salmonella typhimurium, Salmonella minnesota, and Escherichia coli. Journal of Bacteriology 162, 738–45.[Abstract/Free Full Text]

10 . Hitchcock, P. J. & Brown, T. M. (1983). Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. Journal of Bacteriology 154, 269–77.[Abstract/Free Full Text]

Received 15 June 1999; returned 19 August 1999; revised 17 September 1999; accepted 22 October 1999


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
C. Kehrenberg, S. Friederichs, A. de Jong, and S. Schwarz
Novel Variant of the qnrB Gene, qnrB12, in Citrobacter werkmanii
Antimicrob. Agents Chemother., March 1, 2008; 52(3): 1206 - 1207.
[Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
K. Poole
Efflux-mediated antimicrobial resistance
J. Antimicrob. Chemother., July 1, 2005; 56(1): 20 - 51.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
K. Poole
Efflux-Mediated Resistance to Fluoroquinolones in Gram-Negative Bacteria
Antimicrob. Agents Chemother., September 1, 2000; 44(9): 2233 - 2241.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Tavío, M. d. M.
Right arrow Articles by de Anta, M. T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tavío, M. d. M.
Right arrow Articles by de Anta, M. T. J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?